HBVdb

Dataset for nucleotide sequence Genomes of genotype B

[Download (right click)] [Alignment] [Repertoires]

2064 sequence(s)

>gnl|hbvnuc|AB010289_FT00000_P-B Feature FT:source AB010289_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
tacccattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacttggccacaggatcatattgtacaaaaaatcaaactatgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgctgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcatttactttctcgccaacttataaggcctttc
taagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccgtcggtgcgagacctcctagataccg
ccgctgctctgtatcgggaagcattagaatctcctgaacattgctcacctcaccacacagcactaaggcaagctattctg
tgctggggggaattaatgactctagctacctgggtgggtaataatttagaagatccagcatccagggatctagtagtcaa
ttatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatacttggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactcataaggtgggaaac
tttacggggctctattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttccagacattcatttgca
ggaggatattattgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagactaaaaataataatgc
ctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacaagacattatttgcatactctttggaaggcgggtatcttatataaaagagagtcaacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgctcacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacatctgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU330999_FT00000_P-B Feature FT:source EU330999_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1044). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcgaagactggggaccctgcaccgaacatggag
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttgtcgctggatgtgtctgcggctttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatataattggaggttggggcaccttaccccaagaacatattgtatagaaaatcaaacaatgttttagaaaacttcct
acaaataggcctattgattggaaggtatgtcaacgaattgtgggtcttttgggatttgctgctcccttcacacaatgtgg
ttatcccgctttactgcctttatatgcatgtatacaagctaaacaggctttcactttctcgccaacttataaggcctttc
taaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatacggcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattctgtcgttctttcccggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgactggggctctaccgcccgcttctccgtctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggactctgcccaaggtcttacataagaggactactggactttcagcaa
tgtcaatgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggagagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctagctttaatcctgaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttaataggtgtaaacaatttgtaggtcccctcacagtgaatgaaaacaggagactaaaattgattatgc
ctgctaggttctatcctaacgttactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagaaacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcgaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattccttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccatacaaggatacctggccggacgccaacaaggtgggagtgggagcattcgggc
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatgctcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctccacctctaagagatactcatccgca
ggccatgcagtggaa
>gnl|hbvnuc|KP148318_FT00000_P-B Feature FT:source KP148318_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-19). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccgggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatgtgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacggattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacagggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagccggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctatcctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatggatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagacaaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacagggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggggccctcaggctcagggcctactaacaaatgtgccagcagct
cctcctcctgcctccaccaatcggcggtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173340_FT00000_P-B Feature FT:source KJ173340_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX001M(e202)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtactctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcgtttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccggccgactac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggatgttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttaccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttagaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaattcgacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
cggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacttcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964133_FT00000_P-B Feature FT:source KU964133_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 23_11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaacgcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaatagtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcttgtatacaaacaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtgtgtttaatgagtgggaggagttgggggaagaggtcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctactcgacaccg
cctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcatatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgacgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaactggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctctttttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcggcc
cagggttcacccctccccatgggggactgttggggtggagccctcacgctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX276803_FT00000_P-B Feature FT:source KX276803_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctcmaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattggatgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaccctttatcccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctccactgccaatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcattcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctrccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggamgatcaagcatccagggaattaatagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaca
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacgcttccggaaactactgttgttagacaaagaggcaggtccactagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctacatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgataaatgtgagcaatttgtggggccccttacagtaaatgaaaaaaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC510656_FT00000_P-B Feature FT:source KC510656_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaactcaaactgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacacgcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggagct
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtactctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttataccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactgtcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtgcgttcacggggtccatgcggctttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattttg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctagattttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacacctggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccgccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173385_FT00000_P-B Feature FT:source KJ173385_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vac02-M(m603)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
tacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaagaacatattgtacaaaaaatcaaaacatgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tctgtaaacaatatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaactccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggactggggcgaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccatccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcctcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagcaatactg
tgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtctttcttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcgcctatctta
tcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggagaatattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaacaggagacttaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccggagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggt
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674447_FT00000_P-B Feature FT:source MF674447_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV050057). Complete genome. [Hepadnaviridae] (length=3209 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
ttccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggggttggggctccttgccacaggaacatattgtacacaaaatcaaatcatgctttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaattctgtcgtgctatcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgccaacggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaagcagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttgagaaactgttc
ttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatcttatcaaca
cttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaaggtctca
atcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaactttacg
gggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttacaggagga
cattgttgataggtgtaagcaatttgtgggacccctaacaataaatgaaaacaggagactaaaattaattatgcctgcta
gattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatccagagcatgtagttaatcat
tacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtagcgcctc
attttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggcatgggg
acaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactcagaaaa
tccagattgggacctcaatccacacaaggacacttggccggacgccaacaaggtgggagtgggagcattcggaccagggt
tcatccctccccatgggggcctgttggggtggagccctcaggctcagggtatactcacaactgtgccagcagcacctcct
cctgcctccaccaatcggcagtccggaaggcagcctactcccttatctccacctctaagggacactcatcctcaggccat
gcagtggaa
>gnl|hbvnuc|AB073826_FT00000_P-B Feature FT:source AB073826_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi89). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tatgtaaacagtatctgtacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgccttgtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactcaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaagctcagggcctactcacaactatgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY293309_FT00000_P-B Feature FT:source AY293309_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagccaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgtccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctatcctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
cggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggattttatataaaagggagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacacctggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttgaggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC510657_FT00000_P-B Feature FT:source KC510657_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggagcatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgctgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatttgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttataccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactgtcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtgcgttcacggggtccatgcgactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttccggacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattccgccccacgggggactgttggggtggagccctcaggctcagggcatacttacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB205119_FT00000_P-B Feature FT:source AB205119_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-IF687-1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aatgccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattggatgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggactggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagctgcctgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtactctcccgcaaat
atacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgcgccttctcatcttccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcatcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaatctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaagctcagggcatactcacaactctgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ410516_FT00000_P-B Feature FT:source KJ410516_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Occult_HK4777). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctccgaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcccaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaactgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcaccgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggactctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctcaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccatattatccagagtatgtagtt
aatcattacttccaaacgcgacattatttacacactctttggaaggcggggattttatataaaagagagtccacacgtat
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatttttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MG571333_FT00000_P-B Feature FT:source MG571333_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 19574). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgtttcaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgagtgtcttggccaaaattcgcagtccc
gaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctca
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgactggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagccaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctccactgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaatcagtagtcag
ctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggatgcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacgcttccggaaactactgttgttagaccacgaggcaggtcccttagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
tgaggatattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattggaacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcaaggtctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY596104_FT00000_P-B Feature FT:source AY596104_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatctccttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcattcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgacaac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaagccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaggagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacaccg
cctctgatctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaagatccggcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacacgcacaaggacaactggccggacgccaacaaggtgggagccggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX765856_FT00000_P-B Feature FT:source KX765856_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PID:9231). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggggttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtaggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgtcaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggactgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctgggggaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtataccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcaacaa
cgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatctgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
ggcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaacggtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674396_FT00000_P-B Feature FT:source MF674396_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV040027). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgcctctcccatatcatcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcccaggacccctgctcgtgtcacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacatgcacgactactgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctat
taccaattttcttttgtctttgggtatacagttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggctccttgccacaggaacatattgtacaaaaaatcaaatcatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggattcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacaatatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgctcctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgccaacggtcttacataagaggactcttggactttccgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctctggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagatattctg
tgttggggtgagttgatgaatctagctacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgca
ggaggacatcgttgataggtgtaagcaatttgtgggacccctaacaataaatgaaaccaggagactaaaattaattatgc
ctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattacccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccacacaaggacaattggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtccggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB073835_FT00000_P-B Feature FT:source AB073835_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Vi29). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
tagtaaaccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattggtagttggggttccttgccacaggaacatattgtacaaaaaatcaaattatgttttaggaaacttcct
gtaaacaggcctattgatgggaaagtatgtcaacgaattgtgggtcttctggggttcgctgccccttttacacaatgtgg
atatcccgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaattctgtcgtgctgtcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttacggagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctgttcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgca
ggaagacattgttgataggtgtaagcaatttgtaggacccctaacagtaaatgaaatcaggagactaaaattaataatgc
ctgctagattttatcccaaggttaccaaatacttgcccttagataaaggaatcaaaccctattatcccgagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagwcaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacttcaatccacacaaggacaattggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB106884_FT00000_P-B Feature FT:source AB106884_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
tagtaagccctgctcagaacactgtctctaccatatcgtcaatcttatcgacgactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgttttatcatc
tgcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacgaaaagatggggatactcccttaacttcatgg
gatatgtaattgggggttggggcacattgccacaggaacatattgtacaaaaaatcaaactatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgctgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcgaaaaaggcttttactttttcgccaacttacaaggcctttc
tacgtcaacagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtcccctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctccaggggccgcctggggctataccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcacatggagaccaccgtgaacgcccaccagaacctgcccaaggtcttgcataagaggactcttggactttcagcag
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactttcttttttgcctcctgacttctttccgtcggcgagagacctcctagataccg
ccgctgctctgtatcgggaagccttagaatctcctgaacattgctcaccccaccacacagcactcaggcaagctrttctg
tgctggggggaattaatgactctagctacctgggtgggtaataatttrcaagatccagcatccagggatctagtagtcaa
ttatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctgtcttatgtttggaaaagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtatcccttggactcacaaggtgggaaac
tttacagggctctattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttccagacattcatttgca
ggaggatattgttgatagatgtgaacaatttgtgggaccccttacagtaaatgaaaaaaggagactgaaattaataatgc
ctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatccagagcagggagtt
aatcattacttccagactagacattatttgcatactctttggaaggcgggtatcttatataaaagagagtcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgctggggtggagccctcaggctcagggcatactcacatctgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KM213036_FT00000_P-B Feature FT:source KM213036_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CSW-k1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccagactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaaaatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagacttgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttgctagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcctgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagagaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaacaccttctttccctgacattcatttgaa
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagacttaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatcccgagtatgtagtt
gatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattctgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatggggggctgttgggttggagccctcaagctcaaggcctattcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB713528_FT00000_P-B Feature FT:source AB713528_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv44). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcccccaagttccaccaaactcttcaagatccccgagtcagggctctgtacttccctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
cctgttgctgtacaaaacctatggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
tacccattttcttttgtctttgggtatacatttaaatcctcataaaacaagaagatggggctactcccttaactttatgg
ggtatgtaattggaagttggggcaccttaccccaggaacatattgtgttgaaaatcaaacaatgttttaggaaacttcct
gtaaatcggcctattgattggaaggtgtgtcaacgaattgtgggtcttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctctaatgcctttatatgcatgtatacaagctaaacaggctttttctttctcgccaacttataaggcctttc
taaacaaacaatatctgaacctttaccccgttgcgcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcagaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgacaattctgtcgttctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctccaggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
cggttcttgaatatttggtctcttttggggtgtggattcgcacccctactgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctatctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacatcgttaataggtgtaaacaatttgtgggacccctcacagtgaatgaaaacaggagactaaaattgatcatgc
ctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaattaaaccttattatccagagcacgtagtt
aatcattacttccagacgagacactatttacatactctttggaaggcgggtattttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcgacaaggc
atggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagcgggagcattcgggc
cgggattcactccaccccatgggggactgttggggtggagccctcaatctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggaaggaagcctactcccctgtctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ562224_FT00000_P-B Feature FT:source FJ562224_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I16). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatctccttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttactgcctttatatgcatgtatacaagcaaaacaagcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgcacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccacctcttctaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcarcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccagaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtagg
ctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
gatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttacgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cggggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctacccccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881780_FT00000_P-B Feature FT:source KY881780_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient-01). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
tagtgagccctgctcagaatactgtctctcccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggatcatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccacac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttcacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tggcaacgaccgaccttgaggcatacttcaaagactgtgtgtttacggagtgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctgctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactgctgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcccgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttaccgtaaatgaaaacaggagactaaaattattcatgc
ctgctaggttctatcccaatgttactaaatattgacctttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagatacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacttcaaccagcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcactcctccccatgggggactgttggggtggagccctcaggctcaggccatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB073854_FT00000_P-B Feature FT:source AB073854_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry30). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
caatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgttttatcatc
tkcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtrtacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaactatgttttagraaacttcct
gtaaacaggcctattgattggaaagtttgtcaaagaattgtgggtcttttggggtttgctgccccttttacacaatgtgg
atatcctgctttaaagcctttatatgcatgcatacaagccaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcgaaactcatcgggactgacaattctgtcgtgctctcccgcaaat
atacatcctttccatggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtcggtgcgggacctcctagataccg
cttctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcaccatacagcaatcaggcaagctattcta
tgctgggtggaattaatgactctagcttcctgggtgggtcagaatttacaagatcaagcgtccagggacctagtagtcaa
ttatgttaacactaacatgggactaaagatcaggcaattattgtggtttcacatttcctgtcttacttttgaaagagaag
ttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttgatataccttggactcataaggtgggaaac
tttacggggctttattcttctacagtacctgtttttaatcctgaatggcaaactccttcttttccagacattcatttgca
ggaggacattgttgatagatgtgagcaatttgtgggaccccttacagtgaatgaaaggaggagactaaaattagtaatgc
ctgctagattttatcctaaggttaccaaatatctgccgttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagactagacattatttgcatactctttggaaggcgggtatcttatataaaagagagtcaacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcatccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacatctgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ386656_FT00000_P-B Feature FT:source FJ386656_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S142). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttccagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcgacaacgagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggcaaaatctgtacaccatcttgagtccctttatgccgctgt
taccacttttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaagaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgcattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tgagtcaacagtatctgcacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggcaatwggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaatgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttg
aaggtctttgtactaggaggctgtagcaataaattggtgtgttcacctgcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctatgtttcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattcta
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccagcaaatgcccctatctta
tcaacacttccggaacatactgttgttagacaaagacgcaggtcccctggaagaagaactccctcgcctcgccgaccaag
gtctaaatcgccgcgtcgcagaagatctcggtctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccgtgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaaaaggagactaaacttaattatgc
ctgctaggttttatcccaatgatactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggattttatataaaagagagtccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaraaggc
atggggacaaatctttctgtccccaatcccctgggattcttcccttatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccattcagtggaa
>gnl|hbvnuc|JX661470_FT00000_P-B Feature FT:source JX661470_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1221-B12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcca
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggatttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttgtatgcatgtatacaagcaaaacgggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatttgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgtccaactac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgccaacggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgagacatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaactagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
cggttcttgaatatttggtgtcttttggagtgtggattcgcactccacctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccttattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatcccgccccacgggggactgttggggtggagccctcaggctcagggcatacttacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB073846_FT00000_P-B Feature FT:source AB073846_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry565). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactctgcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcagactgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtttgtcaacgaattgtgggtctcttggggttcgctgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgcattcaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacaatatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacctcatttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcagacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctctacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccgtcggtgcgggacctcctagataccg
ctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcaccacacagcactcaggcaagctattctg
tgctggggggaattaatgactctagctacctgggtgggtaataatttagaagatccagcgtccagggatctagtagtcaa
ttatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccacgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttacggggctttattcttctacagtacctgtctttaatcctgaatggcaaacgccttcttttccagacattcatttgca
ggaggacattgttaatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagactaaaattagtaatgc
ctgctagattttatcctaatgctaccaaatatttgcctttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagactagacattatttgcatactctttggaaggcgggtatattatataaaagagagtcaacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacatctgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggacggaagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ386660_FT00000_P-B Feature FT:source FJ386660_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S221). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtatyttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaactgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatcagaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgcccgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgctcctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattgggctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttccgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagcatccagggacttagtagtcag
ctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagata
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaaacactttgtggggccccttacaataaatgaaaaaagaagactacaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcagggaggcagcctactcccatatctccacctctaagggactctcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148457_FT00000_P-B Feature FT:source KP148457_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Y167-3-24). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatccaagagtcagagctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgtctcttccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcgcaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctttgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcaccttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaatttcctgttgtctctgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatataattggaggttggggcaccttaccccaggaacatattgtattgaaaatcaaacaatgttttagaaaacttcct
gtaaacaggcctattgattggaaaatatgtcaacgcattgtgggtcttttgggattcgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggctttcactttctcgccaacttataaggcctttc
taaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtgtctccgctgccgatccatactgcggagct
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattctgtcgttctttcccgaaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcatggggctttaccgcccgcttctccgtctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctcaccggaccctgcccaaggtcttacataagaggactattggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctt
tgttggggtgagttgatgaatctagctacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctctattcttctacggtacctaactttaatcctgaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttaataggtgtacacaatttgtaggccccctcacagttaatgaaaacaggagactaaaattgatcatgc
ctgctaggttctattctaacgttactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagaaacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattccttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaactgtgccaacacct
cctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ386669_FT00000_P-B Feature FT:source FJ386669_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S411). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgttggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatctcatcaggacccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcgaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtaaccagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcctgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgcatcgggaggccttagagtctccggaacattgtacacctcaccatacagcactcaggcaagctattgtg
tgttggggtgagttgatgaacctagccacctgggtgggaagtaatttggacgatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgattggcaaactccttcttttcctgacattcatttgca
ggaggatattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagcatgtagtt
gatcattacttccagacacgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttctctccacctctaagggacactcatcctca
ggccatgacccggaa
>gnl|hbvnuc|GU815692_FT00000_P-B Feature FT:source GU815692_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccacttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatattatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcaaggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JN792894_FT00000_P-B Feature FT:source JN792894_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MN2009). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggca
cagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttccagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatccctggatgtgtctgcggcgttttatcatc
ttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaagacttgcacgactcctgctcaaggaacctctatgtttccct
catgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttctgtctttgggtatacatttgaaccctcagaaaacaaaacgttggggttattcccttaacttcatgg
gatatgtaattggaagttggggcacattaccgcaagaacacatcgtgtcraaaatcaaacaatgttttagaaaacttcct
gtaaacagrcctattgattggaaggtgtgtcaacgaattgtgggtcttttgggatttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctttatatgcatgtatacactctaaacaggcttttactttctcgccaacatataaggcctttc
taaacaaacaatatttgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattcggttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccacttctccgcctgccgttccgaccgaccac
ggggcgtacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaatgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagactaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgcggagttactctctttcttgccttctgacttctttccgtcggttcgggatctcctagacaccg
ccgctgcgttgtatcgggaagccttagagtctcctgaacattgctcgtatcaccatacagcactcaggcaagccattttg
tgctggggggaattaatgactctagcttcatgggtgggtaataatttacaagatccagcatccagagacctagtagtcaa
ttatgttaacactaacatgggactaaagatcaggcaattattgtggtttcacgtttcctgtcttacctttgggagaaaca
ctgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaggaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttaatattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcctaacatacatttgca
ggagaacattattgataggtgtcaacaatttgtgggacccctcacagtaaatgaaaaaaggagactaacattgatcatgc
ctgctaggttttttcctaatactactaaatatttgcccttagataaaggaatcaaaccttattatcccgagcatatagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagaaacaacgcgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcgttcaaagccaactc
cgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatcctcacatctctgccagcagct
cctcctcctgcctccgccaatcggcaggtaggaaggcagcctactcccctttctccacctctaagagacactcatcctca
agccgtgcagtggaa
>gnl|hbvnuc|KC774395_FT00000_P-B Feature FT:source KC774395_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa1073). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaactttatgg
gatatgtaattgggagttggggcacattgccacaagaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgacaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctccactgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaatgaccgaccttgaggcatacttcaaagactgtgtgtttacggagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggtctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctcaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
tagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaaatgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964085_FT00000_P-B Feature FT:source KU964085_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 20_7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcccaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatataattgggagttggggcacattgccacaggaacatattgtaacaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatacggcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaacactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacctataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagccattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgaagaggcaggccccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgagaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
gatcattacttccagacacgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcctgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggaatcctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MT645057_FT00000_P-B Feature FT:source MT645057_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HuN5). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattctcttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagccaaacaggcttttactttctcgccaacgtacaaggccttcc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacatttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgactac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ562311_FT00000_P-B Feature FT:source FJ562311_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I202). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttcmaccaaactcttcaaratcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtcattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaagaaacttcct
gtaaacaggactattgattggaaagtatgtcaacaaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctctaatggctttatatgcatgtatacaatcaaaacaggcttttactttctcaccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgtacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgcgttcaccggcaccttgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcaatcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaaggatccagggatttagtagtcgg
atatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcacatttcttgtcttacttttgggagacaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcgtatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagagggagacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaccaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgccttcaaagccaactc
araaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattccgccccatgggggactgttggggtggagccctcaggctcagggcatacttacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774389_FT00000_P-B Feature FT:source KC774389_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww1121). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacttttcacaaaactcttcaggatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggaacattgccacaggaccatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaagactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgttccgaccaaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcatctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacagaagactaaaattaattatgc
ctgctaggttttatcccaatattactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963959_FT00000_P-B Feature FT:source KU963959_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 11_15). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
accatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaacccacacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagcaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaacactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaaccctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964145_FT00000_P-B Feature FT:source KU964145_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 24_8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcgacgactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaaccctaacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttggggaccaaatctgtacaacaccttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggggttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccgtctgacttctttcctaatattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacatcaccatacggcactcaggcaagctattgtg
tgttggggtgagttaatgagtctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatttttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccgccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggcccctcacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagaaaaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccaaacgcgacattatttacacactctttggaaggcggggatcttatataaaagagaatccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttgggatggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX276785_FT00000_P-B Feature FT:source KX276785_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctccgaacactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtaccgaacatggag
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgttttatcatc
tgcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactactgctcaaggaacctctatgttwccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttrtctttgggtatacatktaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattatacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgctgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcmaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacartatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaamctmatcgggactgacaattctgtcgtgctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccctcgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcagtgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctggcgagttactctcttttttgccgtctgacttctttccttctattcgagatctcctcgacaccg
cttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcrg
ctatgtcaacgttaatatgggcctaaaamtcagacaactattrtggtttcacatttcctgtcttacttttgggagagaaa
ctrttmttgaatatttggtgtcttttggagtgtggattcgcactcctyctgcatatagaccaccaaatgcccctatcttr
tcaacacttccggaaactrctgttgttagacgaagakgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagacttaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccaarcgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaaccaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgaagtggaa
>gnl|hbvnuc|MH932712_FT00000_P-B Feature FT:source MH932712_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Hiroshima GtB CL1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatactcccttaacttcatgg
gatatgtaattgggggttggggcacattgccacaggaacatattgtacaaaaaatcaaactatgttttaggaaacttcct
gtaaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttggggtttgctgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaagcaggcttttactttctcgccaacttacaaggcctttc
taagtcaacagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcccggggccgtttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgtacctctctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgcggagttactttcttttttgccttctgacttctttccgtcggtgcgagacctcctagatactg
cggctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcaccacacagcactaaggcaagctattctg
tgctggggggaattaatgactctagctacctgggtgggtaataatttagaagatccagcctccagggatctagtagtcaa
ttatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttacggggctctattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttccagacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagactaaaattagtaatgc
ctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttgcatactctttggaaggcgggtatcttatataaaagagagtcaacacatag
cgcctcattttgcgggtcaccatattcttgggagcaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacatctgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggaaggcagcctactcccctatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148418_FT00000_P-B Feature FT:source KP148418_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-58). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccaagttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaatatggag
aacatcgcatcaggactcctcggacccctgctcgcgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctctcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatattattggaagttggggcaccttaccccaggaacatattgtattgaaaatcaaacaatgttttagaaaacttcct
gtaaacagacctattgattggaaggtgtgtcaacgaattgtgggacttttgggattcgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttataaggcctttc
tgaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctttgccgatccatacggcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcgaaacttatcgggactgacaattctgttgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgaccccccccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttgggatgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactattgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgcatggcaaactccttcttttcctgacattcatttaca
ggaggacattgttaataggtgtaaacaatttgtgggacccctcacagtgaatgaaaacaggagactaaaattgatcatgc
ctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgtggtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggattccaacaaggtgggagtgggagcattcgggc
cgggattcgctccaccccatgggggactgttggggtggagtcctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggacggcagcctactcccctatctccacctctaagagacactcatcctca
ggccatgcattggaa
>gnl|hbvnuc|MK534575_FT00000_P-B Feature FT:source MK534575_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 481). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tcagtcaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcatcagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatcccgggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcccgactggcaaactccttcttttcctcacattcatttgaa
agaagatattatcaataggtgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacctaaccaaatatttgcccttagataaaggcattaaaccttattatcctgaatatacagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439548_FT00000_P-B Feature FT:source MZ439548_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TF006-2019-Quasi-11). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
ccgtgagccctgctcagactactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaaaacccgtgtgtcctggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcgaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgaggccctttatgccgctgt
taccacttttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggctccttgccacaggaacatattgtacaaaaaatcaaattatgttttaggaagcttcct
gtaaacaggcctattgattggaaagtgtgtcaacgaattgtaggtcttttggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtacacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgcggaacctttgtgtctccgctgcctatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgcttctccgcctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagtcgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcctgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccgtataa
agaatttggagcctctgcggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaagccttagagtctccggaacattgtacatatcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
atatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatctcctgtcttacttttggaagagaag
ttgttctcgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggactctcaatgttgatattccttgcactcatagagtgggaaac
tttacggggctttattcttctactgtacctatctttaatcctgattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgataggtgtgagcaatttgtgggacccctaacagtaaatgaaaaaagaagattaaaattaattatgc
ctgctagattttatcccaaggttaccaaatacttgcccttagataaaggaatcaaaccctattatccagagcacgtagtt
aatcattacttccagacgagacattatttacatattctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctcccaacctcgaaaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccatacaaggacaactggccggatgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacacgcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963830_FT00000_P-B Feature FT:source KU963830_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3_3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttctgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctgtgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggtagttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctcccgaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatctagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggggtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
agaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964106_FT00000_P-B Feature FT:source KU964106_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 21_14). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgaactttcctgctggtggctccagttcaggaa
cagtgatccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatctccttgttggttcttctggactatcaaggtatgttacccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgggg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacaatatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctttcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttatccgcctgttgtaccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacagaaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaagttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacttcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439538_FT00000_P-B Feature FT:source MZ439538_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TF006-2019-Quasi-1). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
ccgtgagccctgctcagactactgcctcagccatatcgtcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaaaacccgtgtgtcctggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcgaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggctccttgccacaggaacatattgtacaaaaaatcaaattatgttttaggaagcttcct
gtaaacaggcctattgattggaaagtgtgtcaacgaattgtaggtcttttggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgctaacttacaaggcctttc
tacgtacacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgcggaacctttgtgtctccgctgcctatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgcttctccgcctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagtcgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcctgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccgtataa
agaatttggagcctctgcggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaagccttagagtctccggaacattgtacatatcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
atatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaag
ttgttctcgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggactctcaatgttaatattccttgcactcatagagtgggaaac
tttacggggctttattcttctactgtacctatctttaatcctgattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgataggtgtgagcaatttgtgggacccctaacagtaaatgaaaaaagaagattaaaattaattatgc
ctgctagattttatcccaaggttaccaaatacttgcccttagataaaggaatcaaaccctattatccagagcacgtagtt
aatcattacttccagacgagacattatttacatattctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctcccaacctcgaaaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccatacaaggacaactggccggatgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacacgcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU564822_FT00000_P-B Feature FT:source EU564822_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-10TA). Complete genome. [Hepadnaviridae] (length=3215 residues).
cgccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
cagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcgacgactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggtaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
tctagcagcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtcctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaagggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccctgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctgttcgagatctcctcgacaccg
cctctgctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacggcgctcaggcaagctattcaa
tgttggggtgaagtaatgaatctagccacctgggtgggaagtaatttggaagatcctgcatccagggaatcagtagttag
ctatgtcaacattaatatgggcctcaaaatgagacaactattgtggtttcacatttcctgtcttacttttgggagagata
ctgttcttgaatatttagtgtcttttggagtgtggattcgcactcctccagcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcccaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaataggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccatcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagggaaactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815576_FT00000_P-B Feature FT:source GU815576_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggccccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacagcaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctacttacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MN689123_FT00000_P-B Feature FT:source MN689123_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YNMA8_31). Complete genome. [Riboviria] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatccaagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacattgtctctcacatattgtcaatcttctcgacgattggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggagcacccgcgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccatttataccgctgt
tatcaattttcttatgtctttgggtatacatctaaaccctcagaaaacaaaaagatggggctactcccttaacttcatgg
ggtatataattggtagttggggcaccttaccccaggaacatattgtgttgaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctattgattggaaggtatgtcaacgcattgtgggtcttttgggctttgctgctcctttcacacaatgtgg
ttatcctgctttaaagcctttatatgcatgtatacaagccaaacaggcttttactttctcgccaacttataaggcctttc
tacacaaacaatatctgaacctttaccccgttgctcggcaacggcaaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcctgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattctgtcgttctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactttaccgcccgcttctccgcctgctgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctcgccaagtcctgcccaaggtcttacataaaaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgaattgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcgctaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatctccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacgggactttattcttctacgatacctagctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttaataggtgtaaccaatttgtaggttcacttactgtgaatgaaaacagaagactaaaattgatcatgc
ctgctagattctatcctaatgttaccaaatatttgcccttagataagggaattaaaccttattatccggagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagaaacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctctctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU439023_FT00000_P-B Feature FT:source EU439023_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcctcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgctgcccgtttgtcctct
aattccaggaccatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttaccttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcatggccattggccatcagcgcatgcgtggaacctttgtgtctcctctaccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtctacgaccgaccttgaggcatacttcaaggactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagaaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgcgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
cggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccctgctttaatcctatatggcaaactccttcctttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgtcactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcaggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctggaattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
tagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JN406371_FT00000_P-B Feature FT:source JN406371_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WHUB1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgctgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatgtgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacctcatcgggactgacaattctgtcgtgctttcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccgaggtcttgcataagaggactcttggactttcagtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacatgggtgggaagtaatttggaagatccagcatcccgggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgctactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggaaccctcaggctcagggcctattcacaaccgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963833_FT00000_P-B Feature FT:source KU963833_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3_6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgttgtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttctgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctgtgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggtagttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctcccgaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatctagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggggtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
agaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815649_FT00000_P-B Feature FT:source GU815649_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 4.D1.5-4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaagaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtattcaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacacgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963848_FT00000_P-B Feature FT:source KU963848_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 4_7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcacggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcaccgcaccatacggcactcaggcaagctattctg
tgttggggggagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattggtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccaaacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaattc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881786_FT00000_P-B Feature FT:source KY881786_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient-01). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctcgtccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttctactggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggatcatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttcacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgcatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tggcaacgaccgaccttgaggcatacttcaaagactgtgtgtttacggagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctgctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactgctgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcccgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttaccgtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttctatcccaatgttactaaatatttgcctttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacttcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ463787_FT00000_P-B Feature FT:source DQ463787_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 928-9_1979). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgagtgtcttggccaaaattcgcagttcc
aaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctttgcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctttataccgctgt
taccaattttcttatgtctttgggtatacatttgaaccctcagaaaacaaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggcacattaccgcaagaacacatcgtgtcaaaaatcaaacaatgttttagaaaacttcct
gtaaacagacctattgattggaaggtatgtcaacgaattgtgggtcttttgggatttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctttatatgcatgtatacaatctaaacaggcttttactttctcgccaacttataaggcctttc
tacacaaacaatatttgaacctttaccccgttgctcggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattcggttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgttccgaccgaccac
ggggcgtacctctctttacgcggcctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttatataagaggactcttggactttcatcaa
tgtcaatgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctctttcttgcctgctgacttctttccgtcggttcgggatctcctagacaccg
cctctgctttgtatcgagaagccttagagtctcctgaacattgctcgcatcaccatacagcaatcaggcaagctgttttg
tgctggggggaattaatgactctagcttcctgggtgggtagtaatttagacgatccagcatccagagacctagtagtcaa
ttatgttaacattaacatgggactaaagatcaggcaattattgtggtttcacctttcctgtattacctttgggaaagaca
ctgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggactcataaggtggggaac
tttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcccaacatacatttgca
ggaggacattattaataggtgtcaacaatttgtgggacccctcacagtaaatgaaaaaaggagactaaaattgatcatgc
ctgctaggttttttcctaatactactaaatatttgcccttagataaaggaatcaaaccttattatcccgagcatgtagtt
aatcattatttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagaaacaacgcgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctgtctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcgttcaaagccaactc
cgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cgggattcactcctctccatgggggactattggggtggagccctcaggctcagggcatactcacatctctgccagcagct
cctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctccacctctaagagacactcatcctca
agccatgcagtggaa
>gnl|hbvnuc|KJ173379_FT00000_P-B Feature FT:source KJ173379_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YY019C(e121)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccttgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacacaaaatcaaaatatgttttaggaaacttcct
gtaaaccggcctattgattggaaagtctgtcaacgaattgtgggtcttttggggtttgcagcccctttcacgcaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggccttcc
tgagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttttagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagagctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ccatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggatccgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacatcgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcggttcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcaccccttcccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF621878_FT00000_P-B Feature FT:source MF621878_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBVVZ0614). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtacagaacatggag
aacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcgtggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtatgaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggctccttgcctcaggaacacattgtacaaaaactcagatcatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggattcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtatttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctcctctgccgatccatactgcagaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggacggacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtttatgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcgctcaggcaagctattctg
tgttggggagagttaatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccatatagaccacaaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctaattttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgataggtgtaagcaatttgtgggacccctaacagtaaatgaaaacaggagattaaaattgattatgc
ctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaagccctattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagaccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccatacaaggacaactggccggatgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcttgttggggcgaagccctcaggctcagggcatactcacaacygtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ904357_FT00000_P-B Feature FT:source DQ904357_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaacgcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctcccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtgtacatataaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacgagcttttactttctcgccaacttacaaggcctttc
taagtaaacaatatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggactgacaattctgtcgtgctctcccgcaagt
atacgtcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtactgggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctgttctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaactcagacaactattatggtttcacatttcctgtctttcttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggagacttgtgttgttagacgaagaggcaggtcccctagaagaagagctccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaactggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgccattggataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgagattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacagctggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EF134946_FT00000_P-B Feature FT:source EF134946_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G247-B5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaagaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacctcatgg
gatacgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
ctatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tgagcaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacatcctttatttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttcggacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatacgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcagactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggcatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaaccgcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
caggtttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU306707_FT00000_P-B Feature FT:source EU306707_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagcgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatgccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgcacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaatctgcctacggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtgctaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcgctcctcctgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgccgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggcttcattcttctacggtaccttgctttaatcctaaatggcaaactccctcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctagattttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagttctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
tagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ023638_FT00000_P-B Feature FT:source FJ023638_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B5_M04-0465). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
caatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatatcattggaggttggggcaccttaccccaggaacatattgtattgaaaatcaaacaatgttttcggaaacttcct
gtaaaccggcctattgattggaaggtatgtcaacgaattgtgggtcttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggctttcactttctcgcccacttataaggcctttc
tacacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctaccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgataattctgtcgttctttcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgctactccgtctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaccctgcccaaggtcttacataagaggactattggactttcaccaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatagggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatcttgctacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctacggtacctggctttaatcctgaatggcaaactccttcttttcctgacattcatttgcg
ggaggacattgttaataggtgtaaacaatttgtaggccccctcacagtaaatgagaacaggagattaaaattgatcatgc
ctgctaggttctatcctaacgttactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagaaacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattccttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cgggattcactccaccccatgggggactgttggggtggagtcctcaagctcagggcatactcacaactgtgccaacagct
ccacctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815591_FT00000_P-B Feature FT:source GU815591_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccaatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttccggatattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcctttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacaagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccttgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtaggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC510647_FT00000_P-B Feature FT:source KC510647_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggagcatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgctgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatttgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggctaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcgactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttccggacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcccaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
tagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148371_FT00000_P-B Feature FT:source KP148371_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaatatggag
aacatcgcatcaggactcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcctcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatattattggaagttggggcaccttaccccaggaacatattgtattgaaaatcaaacaatgctttagaaaacttcct
gtaaacagacctattgattggaaggtgtgtcaacgaattgtgggacttttgggattcgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttataaggcctttc
tgaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctttgccgatccatacggcggaact
cctagccgcttgtttcgctcgcagcgggtctggagcgaaacttatcgggactgacaattctgttgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtgtgttttctgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgctcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattttg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctgggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgcatggcaaactccttcttttcctgacattcatttaca
ggaggacattgttaataggtgtaaacaatttgtgggacccctcacagtgaatgaaaacaggagactaaaattgatcatgc
ctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgtggtt
aatcattacttccagacaagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggattccaacaaggtgggagtgggagcattcgggc
cgggattcgctccaccccatgggggactgttggggtggagtcctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggacggcagcctactcccctatctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964249_FT00000_P-B Feature FT:source KU964249_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 32_7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccgccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaagacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactttcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaagcctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
tacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgttcacaaaattaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
tctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccccaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctattcgagatcttctcgacaccg
cctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggcagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaactggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgccattagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctctctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacacctggccggacgccaacaaggtgggagtgggagcattcggga
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881746_FT00000_P-B Feature FT:source KY881746_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate control-02). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaattctgtctcggccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaacaaccagcaccggaccatgcaaaacatgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcactttgccacaggaacatattgtacaaaaaatcaaattgtgttttaagaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcacggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgccaaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttaccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactccccccgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctacatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaatcatgc
ctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgaggcattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacacgatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattccgccccatgggggactgttggggtggagccctcaggctcagggcatacttacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HM011470_FT00000_P-B Feature FT:source HM011470_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgcacgttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcgtggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaaactctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttyagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggggatggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatacatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacaatatctgaacctttaccccgttgttcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctttcccgcaagt
atacatcttttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggctaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcacgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgtacacctcaccatacggcactcagacaagttattctg
tgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaagatccagcatccagggaagcagtagtcag
ctatgtcaacgttaatatgggcctaaaagtcagacaactattgtggtttcacatttcttgtcttacttttgggagagaag
ttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtsagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttccccttggataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcmttcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
caggagtcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaacggtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148368_FT00000_P-B Feature FT:source KP148368_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaatatggag
aacatcacatcaggactcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatattattggaagttggggcaccttaccccaggaacatattgtattgaaaatcaaacaatgttttagaaaacttcct
gtaaacagacctattgattggaaggtgtgtcaacgaattgtgggacttttgggattcgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttataaggcctttc
tgaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtgggacctttgtgtctcctttgccgatccatacggcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcgaaacttatcgggactgacaattctgttgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtccgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattttg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgcatggcaaactccttcttttcctgacattcatttaca
ggaggacattgttaataggtgtaaacaatttgtgggacccctcacagtgaatgaaaacaggagactaaaattgatcatgc
ctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgtggtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggattccaacaaggtgggagtgggagcattcgggc
cgggattcgctccaccccatgggggactgttggggtggagtcctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggacggcagcctactcccctatctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148375_FT00000_P-B Feature FT:source KP148375_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactacctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaatatggag
aacatcgcatcaggactcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatattattggaagttggggcaccttaccccaggaacatattgtattgaaaatcaaacaatgttttagaaaacttcct
gtaaacagacctattgattggaaggtgtgtcaacgaattgtgggacttttgggattcgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcgtgtatacaagctaaacaggcttttactttctcgccaacttataaggcctttc
tgaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctttgccgatccatacggcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcgaaacttatcgggactgacaattctgttgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattttg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgcatggcaaactccttcttttcctgacattcatttaca
ggaggacattgttaataggtgtaaacaatttgtgggacccctcacagtgaatgaaaacaggagactaaaattgatcatgc
ctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgtggtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggattccaacaaggtgggagtgggagcattcgggc
cgggattcgctccaccccatgggggactgttggggtggagtcctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggacggcagcctactcccctatctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU882004_FT00000_P-B Feature FT:source EU882004_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient21). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaggcctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgctcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttctgttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggggttggggcacattgccacaagaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagaataggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatccagggaattggtagtcgg
ctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacatttgggagagaaa
ctgttcttgaatatttggtatcttttggagtgtggattcgcactccttctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatcttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacaagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
tgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggtcggtcttccaaacctcgaaaaggc
atggggacaaatcttgctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacccctggccggacgcctggaaggtgggagtgggagcattcgggc
cagggttcgtccctccacatgggggactgttgggatggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ924617_FT00000_P-B Feature FT:source GQ924617_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M34). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccgccaagttccaccaaactcttcaagataccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
tagtaaaccctgttcagaacactgcctctcccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagacttgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgtgggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgacgcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcagaaaacaaaaagatggggctactcccttaacttcatgg
ggtatgtaattggaagttggggcaccttaccccaagaacatattgtgttgaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggatttgctgctcctttcacacaatgtgg
gtatcctgctttaatgcctttatatgcatgcatacaagctaaacaggcttttactttttcgccaacgtataaggcctttc
tacacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgacaattctgtcgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgttcaatgagtgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgagtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctatacgggatcttctcgacaccg
cttctgctctgtatcgggaggcattagagtctccggaacattgttcacatcaccatacggcactcaggcaagctattctg
tgctggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaag
ttgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcttgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagaccacgaagcaggtcccttagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctccatgttagtattccttggactcataaggtgggaaac
tttacggggctctattcttctacggtacctaactttaatcctgaatggcaaactccttcctttcctgacattcatttgca
ggaggacatcattaataggtgtaaacaatttgtgggaccccttacagtaaatgaaaacaggagactaaaattgattatgc
ctgctaggttctatcccaatggtactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattatttccagacgagacattatttacataatctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcgacaaggc
atggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctacattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccgaactccaacaaggtgggagtgggagcattcgggc
cgggattcactccaccccatgggggactattggggtggagtcctcaagctcagggcatactcacaactgtgccaacagct
cctcctcctgcctccaccaatcggcagttaggaaggaagcctactcccctgtctccacctctaagagactctcatcctca
ggcaatgcagtggaa
>gnl|hbvnuc|KU964122_FT00000_P-B Feature FT:source KU964122_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 22_15). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacaccgcatcaggactcctaggacccctgctcgtattacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttatctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgttcaaaaaatcaaaatgtgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctccactgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaaatattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggcaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcttcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaggccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactcttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148361_FT00000_P-B Feature FT:source KP148361_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D93-3-42). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatatgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagccggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtctgtttaatgagtgggaggagttgggggaggaggttgggtta
aaggtctttgtactaggaggctgtgggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctatcctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagacaaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactaacaaatgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963988_FT00000_P-B Feature FT:source KU963988_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 13_13). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccgacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgtatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggtctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagattaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
tagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcggct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MG571325_FT00000_P-B Feature FT:source MG571325_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 13536). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttccaggggggacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
cctgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtcattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaacaggcccattgattggaaagtatgtcaacgcattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgcacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgggtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgccaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataa
agaatttggagctcctgtggaattaatctcttttttgcctkctgacttctttccttctgctcgagatctymtcgacaccg
cctctgctctgtatcrggaggccttagagtctccggaacattgttcacatcaccatacggcactcaggcaagctattctg
tgttggggtgakttaatgaatctagccacctgggtgggaagtaatttggacgatccagcatccagggaattagtagtcaa
ctatgtcaacgktaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggmaagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcatatagaccacaaaatgcccctatctta
tcaacgcttccggaaactactgttgttagacaaagatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacaacaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgtcactaaatatttgcccttagacaaagggatcaaaccgtattatccagagtatgtagtt
gatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgtgggtcaccatattcgtgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggtcggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccacatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148386_FT00000_P-B Feature FT:source KP148386_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-32). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaatatggag
aacatcacatcaggactcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatattattggaagttggggcaccttaccccaggaacatattgtattgaaaatcaaacaatgttttagaaaacttcct
gtaaacagacctattgattggaaggtgtgtcaacgaattgtgggacttttgggattcgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttataaggcctttc
tgaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctttgccgatccatacggcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcgaaacttatcgggactgacaattctgttgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattttg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgcatggcaaactccttcttttcctgacattcatttaca
ggaggacattgttaataggtgtaaacaatttgtgggacccctcacagtgaatgaaaacaggagactaaaattgatcatgc
ctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgtggtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggattccaacaaggtgggagtgggagcattcgggc
cgggattcgctccaccccatgggggactgttggggtggagtcctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggacggcagcctactcccctatctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|LC279271_FT00000_P-B Feature FT:source LC279271_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ku_2nd_child_UC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaattatgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttagggtttgctgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttataaggcctttc
taagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatttgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccgtcggtgcgagacctcctagataccg
ctgctgctctgtatcgggaagctttagaatctcctgaacattgctcacctcaccacacagcactcaggcaagctattctg
tgctggggggaattaatgactctagctacctgggtgggaaataatttagaagatccagcatccagggatctagtagtcaa
ttatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttacggggctctattcttctacagtacctgtctttaattctgaatggcaaactccttcttttccagacattcatttaca
ggaggatattgttgatagatgtaagcaatttgtaggaccccttacagtaaatgaaaacaggagactaaaattaataatgc
ctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattactttcagacaagacattatttgcataccctttggaaggcgggtatcttatataaaagagagtctacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacatctgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ675799_FT00000_P-B Feature FT:source MZ675799_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Viet_HBV284). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtaccgaacatggag
aacattgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgctggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctttgtttccct
catgttgctgtacaaaacctatggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattccttaaacttcatgg
gatatgtaattggaagttggggtaccttgccacaagatcatattgtacaaaaactcaaattatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaagcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcgcggcaacggcccgggctatgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
gctagccgcctgttttgctcgcagccggtctggagcaaaacttatcggaactgacaattctgtcgtcctctcccgtaagt
acacctcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggcctttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgaattgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatatcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgataggtgtaagcaatttgtgggacccctaaccgtaaatgaaaacaggagactaaaattaattatgc
ctgctagattttatcccactgttaccaaatacttgcccttagataaaggaatcaaaccttattatccagagcatgtagtt
aatcattactttcagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacgacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccacacaaggacaactggccggatgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcttgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccctatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ463802_FT00000_P-B Feature FT:source DQ463802_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 234-6_2004). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccaccacgttccaccaaactcttcaagattccacagtcaggactctgaaccttcctgctggtggctccagttcaggaa
cagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctttgcatcctgctgctatgccacatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttctgtctttgggtatacatttgaaccctcagaaaacaaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggaacattaccgcaagaacacatcgtggcaaaaatcaaacaatgttttagaaaacttcct
gtaaacagacctattgattggaaggtgtgtcaacgaattgtgggtcttttgggatttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctttgtatgcatgtatacactctaaacaggcttttactttctcgccaacttataaggcctttc
taaacaaacaatatttgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattcggttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccac
ggggcgtacctctctttacgcggcctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcatcaa
tgtcaatgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctctttcttgcctgctgacttctttccgtcggttcgggatctcctagacaccg
cctctgctttgtatcgggaagccttagagtctcctcaacattgctcgcctcaccatacggcaatcaggcaagctatttta
tgctggggggaattaatgactctagcttcctgggtgggtaataatttagacgatccagcatccagagacctagtagtcaa
ttatgttaacactaacatgggactaaagatcaggcaattattgtggtttcacctttcctgtattacctttggaaaagata
ctgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggacgcataaggtgggaaac
tttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcctaacatacatttgca
ggagaacattattgataggtgtcaacaatttgtgggacccctcacagtaaatgaaaccaggagactaaaattgatcatgc
ctgctaggttttttcctaatactactaaatatttgcccttagataaaggaatcaaaccttattatcccgaacatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtgtcttatataaaagagaatcaacgcgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtcccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcaaagccaactc
cgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatactcacatctctgccagcagct
cctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctttctccacctctaagagactctcatcctca
agccatgcagtggaa
>gnl|hbvnuc|KP148321_FT00000_P-B Feature FT:source KP148321_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggtccgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagccggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgccaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctccttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctatcctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatctgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagacaaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatccacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactaacaaatgtgccagcagct
cctccccctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674394_FT00000_P-B Feature FT:source MF674394_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV040025). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggttccttgccacaggaccatattgtacaaaaaatcaaactatgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacaatatctgaccctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcagacgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgtatcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgca
ggaagacattgttgataggtgtaagcaatttgtgggacccctaacagtaaatgaaatcaggagactaaaattaattatgc
ctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatcccgagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacttcaatccacacaaggacaattggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY167101_FT00000_P-B Feature FT:source AY167101_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vb). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttctctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattggctgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaactccct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacgggcttttactttctcgcccacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctctcgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatagggaggccttagagtctccggaacattgttcagctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctggaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccctgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacactatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcaaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattctttcccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK534601_FT00000_P-B Feature FT:source MK534601_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 573). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaacgatggggatattcccttaacttcatgg
gatatgtaattggaagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctatggtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaagctcagggcctactcacaactgtgccagcggct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ671237_FT00000_P-B Feature FT:source MZ671237_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Viet_ocHBV/chr153). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttacaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatatacccttaaattcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaatttacaaggcctttt
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggcaattggccatcagcgcatgcgtggcacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcattcccatggctgctaggctgtgctgccaactggatcctgcgcgggacatcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
catctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtctttcggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaaggaatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgagacattatttgcacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagttggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815700_FT00000_P-B Feature FT:source GU815700_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcgccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatattatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcaaggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148582_FT00000_P-B Feature FT:source KP148582_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Y300-18). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctcggccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcttcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaagcaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacagaaaatcaaaatatgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgctgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggccttcc
tgagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctaccgatccatactgcggaact
cctggccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattattcacctcaccatacggcactcgggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatacgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactcctccttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674464_FT00000_P-B Feature FT:source MF674464_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV050087). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtaagggctctgtattttcctgctggtggctccagttcaggaa
cagtgagccctgctcagattactgcctctgccacatcgtcaaccttctcgacgactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccatttatgccgctgt
taccacttttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattctcttaatttcatgg
gatatgtaattgggagttggggttccttgccacaggaacatattatacaaaaaatcaaatcatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtttgtcaacgaattgtgggtcttttggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacaatacctgaacctttaccccgttgctcggcaacggcctggtctctgccaagtgtttgctgacgcaaccccc
actggttggggcttggctataggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
ccgctgctttgtatcgggaggccttagagtctccggaacattgttcagctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagttag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgactatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaattactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgca
ggaagacattgttgataggtgtaagcaatttgtgggacccctaacagtaaatgaaaccaggagactaaaattaattatgc
ctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatcccgagcatgtagtt
aatcattacttccagacaagacattatttacatactctttggaaggcgggtatcttatataaaagagagaccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggatctcaatccactcaaggacaattggccggacgccaacaaggtgggagtgggagcattcggac
cagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagggacacccatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU939559_FT00000_P-B Feature FT:source EU939559_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C67). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaagagatggggatactcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaacatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacaatatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcgtgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggtggagggtaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctattgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcagctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattaatagtcgg
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacaaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctaaggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaaaaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcagggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173415_FT00000_P-B Feature FT:source KJ173415_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N16-V(FY137C)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttccggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacgaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgacttgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgttccaaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtactccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgatattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggggcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MH663473_FT00000_P-B Feature FT:source MH663473_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 268). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggagcatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgccttgtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttaggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacctttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatataggccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcggatcaccatattcttgggaacaagatctacagcatgggaggttggtcgtccaaacctcgaaaaggc
atggggacaaatctttctgtacccaatcctctgggattctttcccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctgcccatgggggactgttggggtggagccctcaggctcagggcctactcacaactatgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964081_FT00000_P-B Feature FT:source KU964081_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 20_3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcccaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatataattgggagttggggcacattgccacaggaacatattgtaacaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatacggcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaacactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacctataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgaagaggcaggccccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgagaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
gatcattacttccagacacgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggaatcctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY470956_FT00000_P-B Feature FT:source KY470956_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LYL-D2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacgggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtaggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggactgacaattctgtcgtgctttcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttctaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagcgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctccttgacaccg
cctctgctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtctttcggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaat
tttacggggctttattcttctacggtaccttgctttaatcctcaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaaggttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgttcccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaaatggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MT645041_FT00000_P-B Feature FT:source MT645041_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HN12). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgttccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattggaagttggggcacattaccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaacactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctatcgcccgcttctccgcctgtcgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atcgcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcatatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgtcactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcaccccttcccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ027331_FT00000_P-B Feature FT:source JQ027331_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactytccaccaaactcttcaagatcccagagtcagggcccwgaactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctcwgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacactgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaataggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcctttactttctcgccaacttacaaggcctttc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtcctctcccgcaagt
atacatcctttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccrgaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagtctgtgtgtttattgagtgggaggagctgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcwtgttcatgtcctactgttcaagcctccgagctgtgccttgggtggctttagggcatggacattgaccastataa
agaatttggagcttctgtggagttactctcatttttgccgtctgacttctttccttctrttcgagatctcctcgayaccg
cctctgctctgtatcgggaggctttagagtctccggaacatgtttcacctcaccatacrgcmctcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccggcatccagggaattagtagtcrg
ctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctgtattacttttggragagaaa
ytgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagacctcaaaatgcccctatctta
tcaacacttccggaaactactgttgttagaccaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgcttcaatcctaaatggcaaactccttcttttcctgacattcatttgaa
ggaggacattgttgatagatgtaatcaatttgtggggccccttacagtaaatgaaaacaggagactgaaattaattatgc
ctgctaggttttaccccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggktcatccctccacatgggggactgttgggatggagccctcaggctcagggcatacktacaamcgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttawctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964140_FT00000_P-B Feature FT:source KU964140_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 24_3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcgacgactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaaccctaacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttggggaccaaatctgtacaacaccttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggggttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccgtctgacttctttcctaatattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacatcaccatacggcactcaggcaagctattgtg
tgttggggtgagttaatgagtctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatttttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccgccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggcccctcacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagaaaaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccaaacgcgacattatttacacactctttggaaggcggggatcttatataaaagagaatccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttgggatggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MT645058_FT00000_P-B Feature FT:source MT645058_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HuN6). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattctcttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagccaaacaggcttttactttctcgccaacgtacaaggccttcc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacatttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgactac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ803821_FT00000_P-B Feature FT:source KJ803821_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY500621). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattctctaggggaaacacccgtgtgtcctggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttctcctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagcaccggaccgtgcaaaacctgcacgacgcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatattgatgatttggttttgggggccaagactgtacaacatcttgagtccgtttttgccgctgt
taccaattttcttatgtctttgggtatacatttaaacactcacaaaacaagaagatggggatattcccttcacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgttggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctctaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtaaacagtatctggacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaacctcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggaattgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaatgtatctgttaaacagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgctgagttactctcttttttgcctcatgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacggcactcaggcaagaaattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccatatagaccaccaaatgcccctatctta
tcaacgcttccggaaactgctgttgttagacacagacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatccaaaatggcaaactccttcttttccggacattcatttgag
ggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaaaaggcgactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaagcggggatcttatatagaagagagtccacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964086_FT00000_P-B Feature FT:source KU964086_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 20_8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcccaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatataattgggagttggggcacattgccacaggaacatattgtaacaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatacggcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaacactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacctataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgaagaggcaggccccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgagaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
gatcattacttccagacacgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggaaccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964275_FT00000_P-B Feature FT:source KU964275_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 34_4). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccaccaagttccaccaaacgcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatccgaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtaaacagtatctggacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatgggaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagtctaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgctcaccaataccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcaatcaggcaagctattctg
tgttggggtgatttgatgaatctagccacctgggtgggaagtaatgtggatgatccagcatccagggatttaatagtcgg
ctatgtcaacatgaatatgggactaaaattcagacaactattatggtttcacatttcctgtcttacttttgggagagacg
ttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctgctccatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagaggaaggggaagaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtg
ggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattca
tttgcaggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaaaaggagactaaaattaa
ttatgcctgctaggttttatccccatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagaatat
gtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccac
acatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttcgtcttccaaacctcga
aaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagc
caactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcat
tcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgcca
gcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcctctatctccacctctaagggacactca
tcctcaggcnnngcagtggaa
>gnl|hbvnuc|GU815779_FT00000_P-B Feature FT:source GU815779_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaaaacccgtgtgtcttggccaaaattcgcagtccc
aaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttctttcgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggggttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaacggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctctattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctaacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaagtatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcaaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattcctccccatgggggactgttggggtggagccctcaggctcagggcacactcacaactgtgtcagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccgtatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148345_FT00000_P-B Feature FT:source KP148345_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-20). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagctggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttagggtttgccgcccctttcacgcaatgtgg
atatcctgcgttaatgcctttatatgcatgtatacaagcacaacaggcttttactttctcgccaacttacaaggccttcc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtccggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgactac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacatctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccgcctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atgggggcaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674482_FT00000_P-B Feature FT:source MF674482_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VN04A0321). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
tagcgagccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaactaaaagatggggatattcccttaatttcatgg
gatatgtaattggtagttggggtaccttgccacaggaacatattgtacaaaaaatcaaattatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacggattgtgggtcttctggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
tgagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaccttatcgggactgacaattctgtcgtgctatcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcagacgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgaccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgca
ggaagacattgttgatagatgtaagcaatttgtaggacccttaacagtaaatgaaatcaggagactaaaattaattatgc
ctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatcccgagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccacacaaggacaattggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcataatcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ358145_FT00000_P-B Feature FT:source GQ358145_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KDI04). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaaactcttcaagatccgagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaaccttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggactttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacgaaaagatggggctactcccttcacttcatgg
gatatgtaattggaagttggggcaccttaccccaggaacatattgtgttgaaaatcaaacaatgttttcggaaacttcct
gtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttgggttttgccgctccattcacacaatgtgg
ttatcctgctttaaagcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcttttc
tgagcaaacagtacctgaacctttaccccgttgctcggcaacgaccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttctcgggactgacaattctgtcgtgctttcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgcccgcttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaccgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggaggtactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtcaccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggggagttgatgaatctagcaacctggttgggaagtaatttgaaagacccagcatccagggaattagtagtcag
ttatgttaatgttaatatgggcctaaaaataagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagaggaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctacggtacctaactttaatcctgaatggcaaaccccttcttttcctgacattcatttgca
ggaggacattgttaatagatgtaaacaatttgtgggacccctcacagtaaatgaaaccagaagactaaaattgattatgc
ctgctaggttctatcctaaggttactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcggaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggatctcaacccacacaaggacaactggccggactccaacaaggtgggagtgggagcattcgggt
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaactatgccagcagct
cctccttctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KM875416_FT00000_P-B Feature FT:source KM875416_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate pt9N). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaaaatcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaagcttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgccgttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtaaacagtatctgaccctttaccccgttgccaggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggagct
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgtccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttttcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagaatatgtagtt
gatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccacgggggactgttggggtggagccctcaggcgcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963816_FT00000_P-B Feature FT:source KU963816_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2_3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgacttctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatttggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtcattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tatgtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctcctcctgttataccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgttcaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactgggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccatctattcgagacctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagagaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcttgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccgccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagacttaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccagacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttgggatggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815555_FT00000_P-B Feature FT:source GU815555_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacagcaacatattgtacaaaaaatcaaaatgtgttttcggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcatcttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctacttacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815715_FT00000_P-B Feature FT:source GU815715_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctagggcccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgcctcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcgtttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgctactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881857_FT00000_P-B Feature FT:source KY881857_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient-04). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacaccgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacgaaaaatcacaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggccttcc
tacgtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccacggtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggtgttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtgtgctcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccgagctgtgccttgggtggctttaggacatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgtacacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacctttggaagagaag
ttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccgtggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtacgcaatttgtggggccccttaccgtaaatgaaaccaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtgtcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaatctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaggaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccaccactaagggacactcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|KJ173371_FT00000_P-B Feature FT:source KJ173371_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P009-C(B135)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcacgactcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccgggccatgcaaaacctgcacaactcctgctcaaggaacctctttgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
ggtatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgcattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttttcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttatgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcctctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtgag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgccttacctttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagacctccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaaggttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttycccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatattcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148411_FT00000_P-B Feature FT:source KP148411_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-31). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccaagttccaacaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaatatggag
aacatcgcatcaggactcctcggacccctgctcgtgtcacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatattattggaagttggggcaccttaccccaggaacatattgtattgaaaatcaaacaatgttttagaaaacttcct
gtaaacagacctattgattggaaggtgtgtcaacgaattgtgggacttttgggattcgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttataaggcctttc
tgaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctttgccgatccatacggcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcgaaacttatcgggactgacaattctgttgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctacctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttgggatgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgcatggcaaactccttcttttcctgacattcatttaca
ggaggacattgttgataggtgtaaacaatttgtgggacccctcacagtgaatgaaagcaggagactaaaattgatcatgc
ctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgtggtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggattccaacaaggtgggagtgggagcattcgggc
cgggattcgctccaccccatgggggactgttggggtggagtcctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggacggcagcctactcccctatctccacctctaagagacactcatcctca
ggccatgcattggaa
>gnl|hbvnuc|KU963838_FT00000_P-B Feature FT:source KU963838_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3_11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttctgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctgtgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggtagttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctcccgaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatctagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggggtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
agaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY217358_FT00000_P-B Feature FT:source AY217358_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B8r-4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
tacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatgggggtattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaactgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtaggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccgacttacaaggcctttc
tgagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggctaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacctataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgcgttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggaaactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815661_FT00000_P-B Feature FT:source GU815661_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaagaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtattcaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctccgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacacgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggatctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963828_FT00000_P-B Feature FT:source KU963828_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3_1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttctgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctgtgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggtagttcggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctcccgaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatctagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggggtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
agaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964166_FT00000_P-B Feature FT:source KU964166_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 25_14). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttcctccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcatcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggacacctaggacccctgctcgtgttacagggggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgttatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacatctcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctaccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactgggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagttag
ctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcttgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
agaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaacgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgtcactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagaatccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|KY470961_FT00000_P-B Feature FT:source KY470961_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LYL-E8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgctgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgcattgtaggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacgaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggactgacaattctgtcgtgctttcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttctaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctcctgacttcttcccttccattcgagatctcctcgacaccg
cctctactctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggctctcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaat
tttacggggctttattcttctacggtaccttgctttaatcctcaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaaatggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggtctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674509_FT00000_P-B Feature FT:source MF674509_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VN05T0226). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaattctgcctctgccatatcgtcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggctccttgccacaggaacatattgtacaaaaaatcaaattatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtaggtcttttagggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtattcaggctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatttgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttatgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctaccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggcgaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttagaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatccgacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
cggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgcg
ggaggacattgttgataggtgtaagcaatttgtgggaccactaacagtaaatgaaaacaggagattaaaattaattatgc
ctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacgacacgtag
cgcctcattttgcgggtcaccttattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccatacaaggacaactggccggatgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcttgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ924626_FT00000_P-B Feature FT:source GQ924626_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M47). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacactcgtgtgtcgtggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaacatgcagaacatgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaatcctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggctccttaccacaggaacatattgtacaaaaaatcaagttatgttttagaaaacttcct
gtaaacaggcccattgattggaaagtatgtcaacgaattgtgggtcttttggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaattctgtcgtgctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgcttctccgtctgccgtatcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgatgacttctttccttctgttcgagatcttcttgacactg
cttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagagaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaattattgtggtttcacrtttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctgctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacaacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctaaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctaactttaatcctgattggcaaacgccttctttccctgacattcatttgca
ggaggacattgttgatagatgtaagcgatttgtgggacccctaacagtaaatgaaaacaggagattaaaattaattatgc
ctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatccagagcatgtagtt
aatcattacttccaaaccagacattatttacatactctttggaaggcgggtatattatataaaagagagacgacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccaaacaaggacaactggccggaggccaacaaggtgggagtgggagcattcgggc
cagggttcacccctcctcatgggggcttgttggggtggagccctcaggcccagggaatacycacaactatgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttgtctccacctctaagggacactcaccctca
ggccatgcagtggaa
>gnl|hbvnuc|JN792895_FT00000_P-B Feature FT:source JN792895_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KM2004). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatccggactcctaggacccctgctcgtgttacaggcggggtttttcttgtkgacaaaaatcctcacaatacc
gcagagtctagacttgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctttgcatcctgctgctatacctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggcttttagttatatggatgatgtggtattgggggccaagtctgcgcaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggcacattacctcaagaacacattgtgtcaaaaatcaaacaatgttttagaaaacttcct
gttaacagacctattgattggaaggtgtgtcaacgaattgtgggccttttgggatttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctttatatgcatgtatccaagctaaacaggcttttactttctcgccaacttataaggcctttc
tacgcaaccaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcggaactgacaattcggttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttactgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggcgctactgtggagttactctcttttttgcctactgacttctttccgtcggttcgagatctcctagacaccg
ccgctgctttgtttcgggaagccttagagtcccctgaacattgctcacctcaccatacagcactcaggcaagctattttg
tgctggggggaattaatgactctagctacctgggtgggtaataatttagaagatcaagcatccagagacctagtagtcaa
ttatgttaacactaatatgggactaaagatcaggcaattattgtggtttcacgtttcctgtattatctttgggagagaca
ttgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgacg
atctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggactcataaggtgggaaac
tttgcgggtctttactcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcctaacatacatttgca
ggagaacattattgatagatgtgaacaatttgtgggacccctcacagtaaatgaaaaaaggagactaaaattgatcatgc
ctgctaggttttatcctaatactactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagaaacaacgcgtag
cgcctcattttgtgggtcaccatattcttgggaacaacagctacatcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcattctcacatctgtgccagcagct
cctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcctctttctccacctctaagagacactcatcctca
agccatgcagtggaa
>gnl|hbvnuc|JQ707745_FT00000_P-B Feature FT:source JQ707745_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_23). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatctcatcaggactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacaggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatattgatgatattgtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttttctttgggtatacatttaaaccctcacaaaaccaaaagatggggatattcccttaattttatgg
gatatgtaattgggagttggggatccttgccacaggaacatattgtacaaaaaatcaaattatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacaatatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgccgtatcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccactggaacctgcccaaggtcttacataaaaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtttatgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgaccactataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
ccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgaa
ggaggacattgttgataggtgtaagcaatttgtgggacccctaacagtaaatgaaaccaggagattaaaattaattatgc
ctgctagattttatcccaccgttaccaaatacttgcccttagataaaggaatcaaaccctattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacgacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccatacaaggacaactggccggatgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcttgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctccttctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY217360_FT00000_P-B Feature FT:source AY217360_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6-4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtattttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaaaaatcaaactgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
ttagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacaaccgaccttgagcaatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcatcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttccggacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaatcaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggattaaaccttattatccagagtatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
tgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacctgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HM011475_FT00000_P-B Feature FT:source HM011475_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtacttycctgctggtggctccagttcagraa
cagtgagccctgctcagaatactgtctcdgccatatcgtcaatcttrtcgaagactggggaccctgtaccgaacatggag
aacatcrcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggraacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattggaagttggggcaccttgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaatcgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tccgtacacagtatmtgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcmtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgttgtwccaaccgaccac
ggggcgcacctctctttacgcggtctccccrtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccccgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgwaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacatygacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
ccwctgctttgtatcgggaggccttagagtctccrgaacattgyacwcctcaccatacggcactcaggcaagctattstr
tgytggggtgagttaatgaayctagccacctgggtgggargwaatytggaagatcmakcatccagggamkyagtagttrg
ctatgtcaacgttaatatgggcctaaaamtcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtttggattcgcactcctattgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaamtactgttrttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaayctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccctcttttcctaacattcatttgca
ggaggacattgttgatagatgtcagcaatttgtggggccccttacagtaaatgaaamcaggagactaaaattaattatgc
ctgctaggttttatccymakgytacdaaatatttgcccttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgmgacattatttacacactctgtggaaggcgggggtcttatayaaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcgtccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcmaagccaactc
agaaaatccagattggaacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagagggagcattcgggc
cagggktcacycctccccatgggggactgttggggtggagccctcaggctcagggcctacwcacaactgygccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggmagccgactcccttatctccacckctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ801516_FT00000_P-B Feature FT:source JQ801516_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CONTROL24). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccaccacgttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgttttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagtaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggcgaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgggtctcctctgccgatccatactgcggaact
tctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctacggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattcta
tgttggggtgagttaatgaatctagccacctgggtgggaggtaatttggaagatccagcatccagggaagcagtagtcgg
ctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagagaaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctgtggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815737_FT00000_P-B Feature FT:source GU815737_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgcctcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccgaaacctgcccaaggtcttgcatcagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcgtttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgctactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
tgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774374_FT00000_P-B Feature FT:source KC774374_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bur1053). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttaacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaatttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggctataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagtcgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcgtttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacacaaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatattatataaaagagagtccacgcgtag
cgcatcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963799_FT00000_P-B Feature FT:source KU963799_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1_1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacacgcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggcaattggccatcagcgcatgcgtggcacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
catctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgcg
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattatttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
caggattcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173404_FT00000_P-B Feature FT:source KJ173404_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N10-C(3953B)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatgaag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctcaaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacgcaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtcattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttaaaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaacatgggtctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttagtgtcttttggagtgtggatccgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttactgggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagaaaaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
tagggttcacccctccccatgggggactgttgggatggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964163_FT00000_P-B Feature FT:source KU964163_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 25_11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcatcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggacacctaggacccctgctcgtgttacagggggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctaccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactgggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagttag
ctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcttgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccatcttttcctgacattcatttgca
agaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaacgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgtcactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagaatccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK534699_FT00000_P-B Feature FT:source MK534699_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H416). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggcacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacaccttgagtccctttataccgctgt
tactaattttctttggtctttgggcatacatataaaccttcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatgtaattggaagttggggcaccttaccccaagaacatattgtattgaaaatcaaacaatgttttagaaaacttcct
gttaataggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggatttgctgctcccttcacacaatgtgg
ttatcccgctttaatgcctttatatgcatgtatacaagctaaacaggctttcactttctcgccaacttataaggcctttc
taaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcacgtctggagcgaaactcatcgggactgacaattctgtcgttctttcccggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgactggggctctaccgcccgcttctccgtctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggactctgcccaaggtcttatataagaggactattggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaacagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctacggagttactctcttttttgcctggcgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggagcattgttctcctcaccatacggcactcaggcaagctattctg
tgttggggagagttgatgaatctggccacctgggtgggaggtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
cggttcttgaatatttggtgtcttttggagtgtggattcgcactcccactgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctagctttaatcctgaatggcaaactccttcttttcctgacattcatttgca
ggaggacatcgttaataggtgtaaacaatttgtagggcccctcacagtgaatgaaaacaggagactaaaattgattatgc
ctgctaggttctatcctaacgttactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagaaacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagatacagcatgggaggttggtcttcgaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggatcctgcattcaaagccaactc
agcaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatacttgcaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB302095_FT00000_P-B Feature FT:source AB302095_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtatcggccatatcgtcaatcttatcgacgactggggaccctgtgacgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcgtggccaaaattcgcagtccc
aaacctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaaactcttcgattccct
catgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcgtcatgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtcccttcatgccgctgt
taccaattttcttatgtctttgggtatacatttgaaccctcacaaaacaaaaaggtggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacataaaatcaaactatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgcattgtgggtcttttggggtttgctgccccttttacgcaatgtgg
atatcctgctttaaagcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tccgtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcggcactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagcagggggaggagatgaggtta
aaggtctttgtattgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
acctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagctactgctgagttactctcttttttgcctcctgacttctttccgtcggcgcgagacctcctcgatacca
ctgctgctctgtatcgggaagccttagaatctcctgaacattgctcatctcaccacacagccctcaggcaagctattctg
tgctggggggaattaatgactctagctacctgggtgggtaataatttacaagatccagcgtccagggatctagtagtcaa
ttatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacgtttcctgtattatgtttggaagagaca
ctgttgttgaatttttggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactgctgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaat
tttacggggctctattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttccagacattcatttgca
ggaggacattattgatagatgtaagaattttgtgggaccccttacagtaaatgaaaacaggagactaaaattaataatgc
ctgctagattttatcctaatggtaccaaatatttgcccttagataaagggatcaaaccttattacccaaatcaggtagtt
aatcattacttccagacgagacattatttgcatactctttggaaggcgggtatcttatataaaagagagtcaacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtctgccaaacctcgaaaaggc
atggggacaaacctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagtgggagcattcgggc
cagggttcacccctcctcatgggggactgttggggcggagccctcaggctcagggcatactcacatctgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagggacactcatcctca
ggccgtgaagtggaa
>gnl|hbvnuc|JX504532_FT00000_P-B Feature FT:source JX504532_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctctgaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcctggccaaaattcgcagtccc
aaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaaaactgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaacgatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtaggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgcacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctgttctaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggcggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctttggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcaatcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtggggaac
tttacggggctttattcttctacggtaccttgctttaatcctaactggcaaactccttcctttcctgacattcatttgca
ggaggacattgttgatagatgtaaacaatttgtggggccccttacagtaaatgaaaataggagactaaaattaattatgc
ctgctagattttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattatttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccgcatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK534696_FT00000_P-B Feature FT:source MK534696_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H410). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttcacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgaaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgcctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaactctgcccaaggtcttacataagaggactattggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagttgg
ctatgtcaatgttaatatgggcctaaaaattagacagttattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgacg
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctagctttaatcctgaatggcaaactccttcttttcctgacattcatttgca
ggaggacattattaataggtgtaaacaatttgtaggtcccctcacagtgaatgaaaacaggagactaaaattgatcatgc
ctgctaggttctatcctaacgctactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagaccagacattatttacatactctttggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ993710_FT00000_P-B Feature FT:source DQ993710_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6144-0718-ETC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttctctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccatttatgccgctgt
tacccattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggggttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatagcccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaagagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttgaactctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgcatcgggaggccttagagtctccggaacattgttcgcctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtagtttcacatttcctgtctcactttcgggagagaaa
ttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacattctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattctttcccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ358151_FT00000_P-B Feature FT:source GQ358151_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAN011). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagaccccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaaaccctgttcagaacactgcatcttccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
gatatgtaattggaagttggggcacattacctcaggaacatattgtgtcaaaaatcaaacaatgtttcaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggattcgctgctcctttcacacaatgtgg
ttatcctgctttaatgccgttatatgcgtgtatacaagctaaacaagcttttaccttctcgccaacttacaaggcctttc
taaacaaacagtatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcaataggccatcagcgcatgcgcggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttctcgggactgacaattctgtcgtcctctcccgtaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaaacctgcccaaggtcttgcacaagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagaccttctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctgactttaatcctgagtggcaaactccttctttccctgacattcatttgca
ggaggacattgttgatagatgtaaacaatttgtgggacccctcacagtaaatgaaaacaggagactaaaattgatcatgc
ctgctagattctatcctaatgttactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacaaactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggatcctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcggga
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatgctcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggaaggcagcctactcccctctctccacctctaagagactctcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377582_FT00000_P-B Feature FT:source GQ377582_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J131). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacttttcaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaactttatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacgaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgctgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggcacctttgtgtctccactgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcaaaaaaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctgctcgacaccg
ctactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggctctcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggtctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggttccttgctttaatcctacatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
gatcattacttccagacgcgacattatttacacaccctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
tagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
ccacctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815568_FT00000_P-B Feature FT:source GU815568_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacagcaacatattgtacaaaaaatcaaaatgtgttttcggaaacttcct
gtaaacaggcccattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctacttacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173364_FT00000_P-B Feature FT:source KJ173364_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P002-M(007)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaacgtctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
ctaccctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccacactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttataccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctgatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagttag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaat
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcctttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgcgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881896_FT00000_P-B Feature FT:source KY881896_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient-06). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacgaaaaatcacaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggccttcc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggtgttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtgtgctcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgtacacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaag
ttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccgtggacacataaggtgggaaac
cttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtacgcaatttgtggggccccttaccgtaaatgaaaccaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtgtcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaggaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcggac
tctgtaccagtggaa
>gnl|hbvnuc|EU939661_FT00000_P-B Feature FT:source EU939661_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C40). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactctgcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtatcggccatatcgtcaatctcatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaagacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaacctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaaccaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggaacattgccacaggatcatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcttctgccgatccatacggcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaatctcatcgggactgacaattctgtcgtgctttcccgcaagt
atacatcatttccatggctggtaggttgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggcctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgcctactgacttctttccttctattcgagatctcctcgacaccg
caactgctctgtatagggaggccttagagtctccggaacattgctcatatcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaagcagtagttag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggaaggaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagatgtagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagacgaactcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggcccctcacaaaaaatgaaaacaggagacttaaattgattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatacaaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggacggactccaacaaggtgggagtaggagcattcgggc
cagggttcacccctcctcacgggggactgttggggtggagccctcaggctctgggcatactcacagctgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964261_FT00000_P-B Feature FT:source KU964261_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 33_5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcata
tccctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacgaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctgttgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
ataccctgctttaatgcctttatatgcatgtatacaagcaaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttctaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccacaggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttg
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctggggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagcatccagggatttagtagtcgg
ctatgtcaacgttaatatgggcctaaaacttagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaaggggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaaacaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaaggttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacatag
cgcctcattttgcgggtcaccctattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881865_FT00000_P-B Feature FT:source KY881865_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient-04). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcccccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagactactgtctcgtccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcccct
aattccaggatcatcaacaaccagcaccggaccgtgcaaaacctgcacaactcccgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaaccaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacacaaaatcaaaatgtgttttcggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tcagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcagaact
cctagccgcttgttttactcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcttttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcagacaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcatatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccatcaaatgcccctatctta
tcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaccaggagactaaacttaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
gatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcaccagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
tagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagcg
cctcctcctgcctccaccaatcggcagtctggaaggcagcctactcccttaactccacctctaagggacactcatcctca
ggccatgaagtggaa
>gnl|hbvnuc|KX276782_FT00000_P-B Feature FT:source KX276782_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccacaaaactcttcaagatccaagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcctggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttctatcata
ttcctttgcatcctgcagctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaacgcctgctcaaagaaactctacgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggnctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgwaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtggggcttttgggatttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacaatatctgaccctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggacgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgtacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtaytaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgyggagttactctcttttttgcctgctgacttctttccttctgttcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcmcmtcaccatacrgcaatcaggcaagctattctg
tgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggacgatccagcatccagggaattagtagtcaa
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaag
ttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacatcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatccggaatggcaaactccttcttttcctracattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaagattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagaacatgtagtt
actcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagggggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacatctgtgccagcagct
cctcttcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881728_FT00000_P-B Feature FT:source KY881728_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate control-01). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaattctgtctcggccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaacaaccagcaccggaccatgcaaaacatgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcactttgccacaggaacatattgtacaaaaaatcaaattgtgttttaagaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcacggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgccaaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttaccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactccccccgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctacatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaatcatgc
ctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgaggcattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacacgatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattccgccccatgggggactgttggggtggagccctcaggctcagggcatacttacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881731_FT00000_P-B Feature FT:source KY881731_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate control-01). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaattctgtctcggccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaacaaccagcaccggaccatgcaaaacatgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcactttgccacaggaacatattgtacaaaaaatcaaattgtgttttaagaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcacggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgccaaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttaccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactccccccgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctacatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaatcatgc
ctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgaggcattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacacgatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattccgccccatgggggactgttggggtggagccctcaggctcagggcatacttacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB287323_FT00000_P-B Feature FT:source AB287323_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgctcagagtactgcctctgccatatcgtcaaccttatcgacgactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaatgcccgggtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatctgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctttgcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtaggtctttcccccac
tgtatggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatcttgaggccatttacaccgctgt
taccaattttcttatgtctttgggtatacatttaaaccctcataaaacacaacgttggggttactcccttaacttcatgg
gatatgtaattggcagttggggcacattacctcaagaacacatcgtgtcaaaaatcaaacaatgttttagaaaacttcct
gtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttgggatttgctgcaccttttacacaatgtgg
gtatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcaccaacttataaggcctttc
taaacaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggaactgacaattcggttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcacctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttacataaaaggactcttggactttcagcaa
tgtcaatgaccgaccttgaggcatacttcaaagactgtgtgtttactgactgggaggagttgggggaggagactaggttg
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataa
agaatttggagctactgtggagttactctctttcttgcctactgacttctatccgtcggttcgagatctcctagataccg
cctctgctttgtatcgggaagccttagagtcttctgaacattgcacgcctcaccatacagcactcaggcaagctattttg
tgctggggggaattaatgactctagctacctgggtgggtaataatttacaagatccagcatccagagacctggtagttaa
ttatgttaacactaacatggggctgaagatcagacaattattgtggtttcacatttcctgtcttacctttgggagacaag
ttgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagaccaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcctaacattcatttgca
ggaggacattattaataggtgtgaacaatttgtgggacccctcacagtaaatgagaaacggagactaaatttggtcatgc
ctgctaggttttatcctaatactactaaatatttccccttggagaaaggaattaaacctcattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcaggtatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtctgccaaacctcgaaaaggc
atggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatccagattgggacctcaacccacacaaggacaactggccagacgccaacaaggtgggagtgggagcattcgggc
cgggattcactcctccccatgggggattattggggtggagccctcaggctcagggcatactcacctctctgccagcagct
cctcctcctgcctccaccaatcggcaggtaggaaggctgcccactcccctttctccacctctaagagacactcatcctca
agccatgcaatggaa
>gnl|hbvnuc|GU815688_FT00000_P-B Feature FT:source GU815688_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaaccttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatattatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcaaggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963831_FT00000_P-B Feature FT:source KU963831_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3_4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttctgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctgtgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggtagttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctcccgaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatctagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggggtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
agaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB365445_FT00000_P-B Feature FT:source AB365445_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BOL1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacaactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaacgcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggtgcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacaccttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacacattatacaaaaaatcaaaatgtgttttagraaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgtattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttataaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatacggcggaact
cctggccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggaccgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccccaggaacctgcccaaggtcttgcataagaggactcttggactttcaacaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttg
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaggcaatttggaagatcaaggatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaactcagacagctattgtggtttcacatttcctgtcttatgtttgggagagaaa
ctgttctggaatatttggtgtcttttggagtgtggattcgcactcctgctgcatatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaccaggagactaaaattagttatgc
ctgctaggttttatcccaaagttactaaatatttgcccttagataaagggattaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctaccgcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgtacaaggacaattggccggacgccaacaaggtgggagcgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagtcctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
agccatgcagtggaa
>gnl|hbvnuc|KY881906_FT00000_P-B Feature FT:source KY881906_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient-06). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggatctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacgaaaaatcacgatgtgttttagaaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggccttcc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggtgttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtgtgctcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgtacacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaag
ttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccgtggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtacgcaatttgtggggccccttaccgtaaatgaaaccaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtgtcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaggaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|MF674395_FT00000_P-B Feature FT:source MF674395_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV040026). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggttccttgccacaggaacatattgtacaaaaaatcaaattatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggcacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgacaattctgtcgtgctatcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgctcctctgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgaccaaggtcttacataagaggactcttggactttcagtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcacaaggtgggaaac
tttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgca
ggaagacattgttgataggtgtaagcaatttgtgggacccctaacagtaaatgaaatcaggagactaaaattaattatgc
ctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatcccgagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccacacaaggacaattggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB302944_FT00000_P-B Feature FT:source AB302944_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3641NN). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcacgatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgttggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcatcaaccaccagcaccggaacatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccatttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgccaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttt
tacgtaaccagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actgggtggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgcccgcttctccgcctgctgtaccgaccattcac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctacttttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttgcaagatcaagcatccagggaagcagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcatatagaccaccaaatgcctctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtactccctggacacataaggtgggaaac
tttacggggctttattcttctacagtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaccaggagactaaaattaattatgc
ctgctaggttttatcccaagggtactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacattctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggatcctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcagactcagggcctactaacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatacagtggaa
>gnl|hbvnuc|JN792893_FT00000_P-B Feature FT:source JN792893_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MN2004). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgctcagattactgcctctcccatatcgtcaatcttaccgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaaaaacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaaaacttgcacgactcctgctcaaggaacctctatgtttccct
catgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttctgtctttgggtatacatttgaaccctcagaaaacaaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggcacattaccgcaagaacacatcgtgtcaaaaatcaaacaatgttttagaaaacttcct
gtaaacagacctattgattggaaggtgtgtcaacgaattgtgggtcttttgggatttgcagccccttttacacaatgtgg
gtatcctgctttaatgcctttatatgcatgtatacaatctaaacaggcttttactttctcgccaacttataaggcctttc
tacacaaactatatttgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattcggttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgttccggccgaccac
ggggcgtacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttatataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagactaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgcggagttactctctttcttgccttctgacttctttccgtcggttcgggatctcctagacaccg
ccactgctttgtatcgagaagccttagagtctcctgaacatgtctcgcctcaccatacagcactcaggcaagccattttg
tgctggggggacttaatgactctagctacatgggtgggtaataatttagaagatccagcatccagagacctagtagtcaa
ttatgttaacaataccacgggactaaagatcaggcaattattgtggtttcacatttcctgtcttacctttgggagagaca
ctgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatctccgcgtcgcagaagatctcaatctcgggaatcctaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcctaacatacatttgca
ggagaacattattaataggtgtcaacaatttgtgggacccctcacagtaaatgaaaacaggagactaaaaatgatcatgc
ctgctaggttttttcctaatactactaaatatttgcccttagataaaggaatcaaaccttattatcccgagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagaaacaacgcgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcgttcaaagccaactc
cgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatcctcacatctctgccagcagct
cctcctcctgcctccgccaatcggcaggtaggaaggcagcctactcccctttctccaccgctaagagacactcatcctca
agccgtgcagtggaa
>gnl|hbvnuc|MF674382_FT00000_P-B Feature FT:source MF674382_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV040003). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctatactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgcctcagccatatcgtcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggctccttgccacaggaacatattgtacaaaaaatcaaattatgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtaggtcttttagggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtattcaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacttttgtgtctcctctgccgatccatacggcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagctacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggtctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgca
ggaagacattgttgataggtgtaagcaatttgtgggacccctaacagtaaatgaaaacaggagattaaaattaattatgc
ctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacgacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacttcaatccatacaaggacaactggccggatgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcttgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB073853_FT00000_P-B Feature FT:source AB073853_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry24). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtaagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctcagccatatcgtcaatcttctcgaagactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggaccccttctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagacttgtggtggacttctctcagttttctaggggaaccacccgtgtgccatggccaaaattcgcagtgcc
aaatctgcagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcccct
aattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttatgtctttgggtatacatataaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacgttgccacaagaccatattgtacaaaaaatcaaactatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtctgttggggtttgctgccccttttacacaatgtgg
atatcctgctttaaagcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
tccgtcaacagtatttgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttstgtcccctctgccgatccatacagcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattctgtcgtgctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
atgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgacgac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactgtcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgtccaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtcggtgcgagatctcctagataccg
ccgctgctctgtttcgggatgccttagaatctcctgaacattgctcacctcaccacacagcaatcaggcaagctatcgtg
tgctggggggaagtaatgactctagcttcctgggtgggtaataatttacaagatccagcatccagggacctagtagtcga
ttatgttaacactcacatgggcctaaagatcaggcaattattgtggtttcacatttcctgtattatttttggaagagaag
ttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttgatattccttggactcataaggtgggaaac
tttacggggctttattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgataggtgtcagcaatttgtggggcccctcacagcaaatgaaaccagaagactaaaattaattatgc
ctgccagattttatcctaaggttaccaaatatttgcccttagavaaagggatcaaaccctattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagtcaacacgtag
cgcttcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgtccccaatcccctgggattcttccccgatcatcagttggacccagcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcactcctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacacacatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY217362_FT00000_P-B Feature FT:source AY217362_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 582-4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactctgcaagatcccagagtcagggccctgtacgttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tgcgtcaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcggggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtactctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgtccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttgacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacctataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttttttccttccattcgagatctcctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacggcactcaggcaagctattgtg
tgttggggtgagttaatgaatctagccacctgggtgggaagcaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttagtattccttgggcacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctcaatggcaaactccttcttttcctaacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaataggagactaaaattgattatgc
ctgctaggttttatcccaatggtactaaatatttgcccttagataaagggatcaagccctattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggacccagcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatacttacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcagggaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815564_FT00000_P-B Feature FT:source GU815564_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacagcaacatattgtacaaaaaatcaaaatgtgttttcggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgagtctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttaggtaaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctacttacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815586_FT00000_P-B Feature FT:source GU815586_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccaatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttccggatattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcctttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacaagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcgccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccttgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtaggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcctttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815711_FT00000_P-B Feature FT:source GU815711_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcacagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgtcgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgcctcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcggcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtccaccggaccgtgtgcacttcgcttcacctccgc
acgtcgcatggagaccaccgtgaacgcccaccgaaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgttttaatcctaaatggcaaactccttcgtttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgctactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ707737_FT00000_P-B Feature FT:source JQ707737_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatctcatcaggactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatattgatgatattgtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttttctttgggtatacatttaaaccctcacaaaaccaaaagatggggatattcccttaattttatgg
gatatgtaattgggagttggggatccttgccacaggaacatattgtacaaaaaatcaaattatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacaatatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtttatgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccactataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
ccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgaa
ggaggacattgttgataggtgtaagcaatttgtgggacccctaacagtaaatgaaaccaggagattaaaattaattatgc
ctgctagattttatcccaccgttaccaaatacttgcccttagataaaggaatcaaaccctattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacgacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccatacaaggacaactggccggatgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcttgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctccttctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MG571321_FT00000_P-B Feature FT:source MG571321_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 7049). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaaaatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggacacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacatctcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatgtggatgatttggttttgggggccaagtctgttcaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattccctcaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatgttgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgcgttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tcagtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggtctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccggcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagacctccaaatgcccctatctta
tcaacacttccggaaactgctgttgttagacaacgaggcaggtccactagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacacaaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaactggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaaggttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttgggaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattctttcccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggctcacccctccccatgggggaatgttggggtggagctctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacacgcatcctca
ggccatgaggtggaa
>gnl|hbvnuc|MG571356_FT00000_P-B Feature FT:source MG571356_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 28144). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaactttatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagaccaattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagccaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttggggctctaccgcccgcttctccgcctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccacggtcttgcataagaggacccttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagcctgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaattc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK534704_FT00000_P-B Feature FT:source MK534704_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H424). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctcccatatcgtcaatcttatcgaagactggggaccctgtacagaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttatatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagctggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttagtaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttagggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcacaacaggcttttactttctcgccaacttacaaggccttcc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgtggaact
cctggccgcttgttttgctcgcagcacgtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgactggggctctaccgcccgcttctccgtctgttttaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggactctgcccaaggtcttacataagaggactattggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactaccgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgtcagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattatcaatagatgtcaacaatatgtaggccctcttacggtcaatgagaaaaggagattatccttaattatgc
cggctaggttctatcccaatattaccaaatatttgcccttagataaaggcattaaaccttattatcctcaccacgcagtt
aatcattacttcaaaactaggcattatttgcatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttatgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgtccccaatcccctgggattcctccccgatcatcagttggatcctgcattcaaagccaactc
agacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggaatgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatattcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR152339_FT00000_P-B Feature FT:source KR152339_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactctgcaagatcccagagtcagggccctgtattttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaactaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattccctgaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtggggcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttacccagttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctttcccgcaagt
atacatcatttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaacctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcgtatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
agaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactcaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacaagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881752_FT00000_P-B Feature FT:source KY881752_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate control-02). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaattctgtctcggccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaacaaccagcaccggaccatgcaaaacatgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcactttgccacaggaacatattgtacaaaaaatcaaattgtgttttaagaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcacggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgccaaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttaccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactccccccgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctacatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaatcatgc
ctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgaggcattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacacgatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattccgccccatgggggactgttggggtggagccctcaggctcagggcatacttacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439527_FT00000_P-B Feature FT:source MZ439527_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TF006-2013-Quasi-6). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
ccgtgagccctgctcagactactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaaaacccgtgtgtcctggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcgaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggctccttgccccaggaacatattgtacaaaaaatcaaattatgttttaggaagcttcct
gtaaacaggcctattgattggaaagtgtgtcaacgaattgtaggtcttttggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtacacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgcggaacctttgtgtctccgctgcctatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgcttctccgcctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagtcgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaagccttagagtctccggaacattgtacatatcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaag
ttgttctcgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgctagtattccttgcactcatagagtgggaaac
tttacggggctttattcttctactgtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgataggtgtgagcaatttgtgggacccctaacagtaaatgaaaaaagaagattaaaattaattatgc
ctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatccagagcacgtagtt
aatcattacttccagacgagacattatttacatattctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctcccaacctcgaaaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccatacaaggacaactggccggatgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcttgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacacgcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377622_FT00000_P-B Feature FT:source GQ377622_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J207). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaacactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactactgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgtattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcagaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctrtcgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacttgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttagttta
atgatctttgtactgggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgacg
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacacgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatggaaggttggtcttccgaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaaatgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881863_FT00000_P-B Feature FT:source KY881863_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient-04). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtgccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtctggctttcagttacatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacgaaaaatcgcaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacgtacaaggccttcc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtagaacctttgtgtctcctctgccgatccatactgcagaact
cctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
ttacatcctttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagaccgtgtgtttaatgagtgggaggtgttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtgtgctcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctacatcgggaggccttagagtctccggaacattgtacacctcaccatacagcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaag
ttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccgtggacacataaggtgggaaac
tttacgaggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtacgcaatttgtggggccccttaccgtaaatgaaaccaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtgtcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcactcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaggaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccgtacagtggaa
>gnl|hbvnuc|KY881944_FT00000_P-B Feature FT:source KY881944_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient-08). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccaagttccaccaaactcttcaagatccaagggtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctctgccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggcgaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaatcctcataaaacaaaacgatggggctactcccttaacttcatgg
gatatgtaattggtagttggggcaccttaccccaggaacatattgtgttgaaaatcaaacaatgttttaggaaacttcct
gtaaacagacctattgattggaaggtgtgtcaacgaattgtgggtcttttggggtttgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagcgagacaggctttcactttctcgccaacttacaaggcctttc
taaacaaacagtatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggctatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatacagcggaact
cctagctgcctgttttgctcgcagccggtctggagcgaaacttatcgggactgacaattctgtcgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttttagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagaccttctcgacaccg
ccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagcaattctc
tgttgggatgagttaatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcctgacattcatttgca
tgaggacattgttaataggtgtaaacaatttgtgggacccctcacagtaaatgaaaataggagactaaaattgattatgc
ctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaattaaaccttattatccagaacatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatattatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcaaaacctcgaaaaggc
atggggacgaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggatctcaacccacacaaggacaactggccggactccaacaaggtgggagtggaagcattcgggc
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctccgcctctaagagacactcatcctca
ggccatgcactggaa
>gnl|hbvnuc|GU815654_FT00000_P-B Feature FT:source GU815654_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 9.D1.5-9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaagaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtattcaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacacgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815713_FT00000_P-B Feature FT:source GU815713_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgttatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgctatttgttcagtggttcgtagggctttcccccac
tgtccggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgcctcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgctactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881850_FT00000_P-B Feature FT:source KY881850_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient-04). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
tagtgagccctgctcagaatactgtctctcccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcggtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggatcatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttcacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacccttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tggcaacgaccgaccttgaggcatacttcaaagactgtgtgtttacggagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagttattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttgaaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagacaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcccgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttaccgtaaatgaaaacaggagactaaaattaattatgc
cggctaggttctatcccaatgctactaaatatttgcctttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagatacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacttcaaccagcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY167097_FT00000_P-B Feature FT:source AY167097_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIIb). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
acttggtggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctgtctgtccccaatcccctgggattctttcccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccgaacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148440_FT00000_P-B Feature FT:source KP148440_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H75-26). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccaagttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaatatggag
aacatcgcatcaggactcctcggacccctgctcgcgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttccggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatattattggaagttggggcaccttaccccaggaacatattgtattgaaaatcaaacaatgttttggaaaacttcct
gtaaacagacctattgattggaaggtgtgtcaacgaattgtgggacttttgggattcgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttataaggcctttc
tgaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctttgccgatccatacggcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcgaaacttatcgggactgacaattctgttgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaa
tgtcaacaaccgaccttgaggcatgcttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttgggatgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgcatggcaaactccttcttttcctgacattcatttaca
ggaggacattgttaataggtgtaaacaatttgtgggacccctcacagtgaatgaaaacaggagactaaaattgatcatgc
ctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgtggtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggattccaacaaggtgggagtgggagcattcgagc
cgggattcgctccaccccatgggggactgttggggtggagtcctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggacggcagcctactcccctatctccacctctaagagacactcatcctca
ggccatgcattggaa
>gnl|hbvnuc|KU964251_FT00000_P-B Feature FT:source KU964251_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 32_9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccgccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcagaaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaagacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
tacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgttcacaaaattaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacctataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctattcgagatcttctcgacaccg
cctctgctctacatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgccattagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctctctgtccccngtcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacttcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagggactctcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY596109_FT00000_P-B Feature FT:source AY596109_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate II-1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaacttctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattggatgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgcgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacaatatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatacgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgtttgttttgctcgcagcaggtctggggcaaaactcattgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacattgttcatctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatatcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatcttg
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggcaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgccaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttgcacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148346_FT00000_P-B Feature FT:source KP148346_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-22). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagctggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttagggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcacaacaggcttttactttctcgccaacttacaaggccttcc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgactac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtcggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881898_FT00000_P-B Feature FT:source KY881898_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient-06). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacgaaaaatcgcaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtgtgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacgtacaaggccttcc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcagaact
cctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggtgttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtgtgctcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccgagctgtgccttgggtggctttaggacatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgtacacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaag
ttgttcttgaatatttggtgtcttttggagtgtggatccgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccgtggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatctgca
ggaggacattgttgatagatgtacgcaatttgtggggccccttaccgtaaatgaaaccaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtgtcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaggaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggcctttcagtggaa
>gnl|hbvnuc|GU815643_FT00000_P-B Feature FT:source GU815643_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaagaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcctggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacacgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JX661478_FT00000_P-B Feature FT:source JX661478_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1211-B7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaagcaaaacaggcttttacgttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctatcctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagacaaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964113_FT00000_P-B Feature FT:source KU964113_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 22_6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacaccgcatcaggactcctaggacccctgctcgtattacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttatctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgttcaaaaaatcaaaatgtgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctactgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggcaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagaatccacacgtag
cgcttcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaggccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactcttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JX429900_FT00000_P-B Feature FT:source JX429900_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-24). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaacccttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggtacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcgtttactttctcgcaaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcgacaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcggcattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964141_FT00000_P-B Feature FT:source KU964141_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 24_4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcgacgactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaaccctaacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgcgctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttggggaccaaatctgtacaacaccttgagtccctttataccgctgt
ttccaattttcttttgtctttgggtatacatttgaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggggttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtactctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccgtctgacttctttcctaatattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacatcaccatacggcactcaggcaagctattgtg
tgttggggtgagttaatgagtctagccacctgggtgggaagtaatttggaagatccatcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatttttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccgccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggcccctcacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagaaaaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccaaacgcgacattatttacacactctttggaaggcggggatcttatataaaagagaatccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatccccggggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttgggatggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881855_FT00000_P-B Feature FT:source KY881855_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient-04). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacgaaaaatcacaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggccttcc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cccggccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccacctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggtgttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtgtgctcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgtacacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaag
ttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccgtggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtacgcaatttgtggggccccttaccgtaaatgaaaccaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccctagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtgtcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaggaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|JQ801506_FT00000_P-B Feature FT:source JQ801506_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CONTROL13). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
cagtgagccctgctccgaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgccacaggcacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggatttgccgccccatttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggacgcttggggctctaccgcccgcttctccgcctagtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgtccaccggaacctgcccaaggtcttgcacaagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccancaccatgccactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagcatccagggacttagtagtcag
ctatgtcaacgttaatatgggcctaaaattcagacaaatattgtggtttcacatttcctgtcttacttttgggagagaag
ttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagacgatctcaatctcgggaacctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattcctccccatgggggactgttggggtggagcccccaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX276830_FT00000_P-B Feature FT:source KX276830_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcccccacgttccaccaaactctgcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaaaccctgttcagaacactgcctcttccatatcgtcaaccttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctactcgtgttacaggcggggtttttcttgttaacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgayttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcgtgagtccgtttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcagaaaacaaaaagatggggctactcccttaacttcatgg
gttatgtaattggaagttggggcaccttaccccaagaacatattgtattgaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttttcgccaacgtataaggcctttc
tacrcaaacaatatctgcacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacatttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgacaattctgtcgtcctgtcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggacgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcayctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgaatggagaccaccgtgaacgcccatyggaacctgcccaaggtcttrcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccattcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctacagagttactctcttttttgccttctgacttttttccttctatacgggatcttctcgacaccg
cttctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtatcttttggagtgtggattcgcacacctcctccatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctctattcttctacggtacctagctttaatcctaattggcaaactccttcctttcctgacattcatttgca
ggaggacatcattgataggtgtaaacaatttgtgggaccccttacagtaaatgaaaacaggagactaaaattgattatgc
ctgctaggttctatcccaatgttaccaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcgacaaggc
atggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaattc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagtgggagcattcgggc
caggattcactcccccccatgggggaatgttggggtggagccctcaagctcagggcatactcacaactgtgccaacaact
cctcctcctgcctccaccaatcggcagttaggaaggaagcctactcccctgtctccacctctaagagacactcatcctca
ggcaatgcggtggaa
>gnl|hbvnuc|X98077_FT00000_P-B Feature FT:source X98077_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
agcatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcaagacttgcacagctcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaacgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagagaactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctgctgttcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcaatcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagcatccagggacttagtagtcag
ctatgtcaacgttaatatgggcctaaaattcagacaactattgtggtttcacatttcctgtcttacgtttgggagacaaa
ctgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacaaagaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttactgggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatcttgctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agacaatccagattgggacctcaacacgcacaaggactactggccggacgcatggaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagagacactcatccaca
ggccatgaagtggaa
>gnl|hbvnuc|KP148317_FT00000_P-B Feature FT:source KP148317_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccccgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagccactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaagcctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcaccagtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgttgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatccgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctggcgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagccggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
cgtcaacgaccgaccttgaggcatacttcaaagactgtttgcttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctatcctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagacaaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatggggggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactaacaaatgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963971_FT00000_P-B Feature FT:source KU963971_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 12_12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
tacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcacctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgcatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taaggcaacagtatttgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagcaacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaacatgggcctaaaaatcagacaactattgtggtttcatatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccctgctttaatcctaaatggcaaactccttcttttcccgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacacctggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcgcaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MG571344_FT00000_P-B Feature FT:source MG571344_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 22732). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtatcttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgctgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttt
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgccattagataaaggaatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB900111_FT00000_P-B Feature FT:source AB900111_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3218 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctctgccatatcgtcaatctcatcgacgactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtttctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcraccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaccatcttgagtccctttatgccgctgt
tacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaactatgttttagaaaacttcct
gtaaacaggcctattgattggaaggtatgtcaacgaattgtgggtcttttggggtttgctgccccttttacgcaatgtgg
atatcctgctttaaagcctttatatgcatgtatacaagccaaacaggcttttactttctcgccaacttataaggcctttc
tacgtcaacagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggrgcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagattaggtta
awgrtctttgtactaggaggctgtaggcataaattggtctgttcaccagtaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctatccgtcggtgcgagatctcctagataccg
ccgctgctctgtatcgggatgcattagaatctcctgaacattgctcagctcaccacacagcactcaggcaagctgttctg
tgctggggggaattaatgactctagctacctgggtgggtaataatttagacgatccagcatccagggatctagtagtcaa
ttatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatacttggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagaggacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggatcgatcccaatgttagtatcccttggactcacaaggtggga
aactttacggggctctattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttccagacattcattt
gcaggaggatattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagactaaaattaataa
tgcctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtg
gttaatcattacttccagacaagacattatttgcatactctttggaaggcgggtatcttatataaaagagagtcaacaca
tagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaa
ggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
ctcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagtgggagcattcg
ggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacatctgtgccagca
gctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcc
tcaggccatgcagtggaa
>gnl|hbvnuc|KC774371_FT00000_P-B Feature FT:source KC774371_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bur1036). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccaaagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtactctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccctagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccaaacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggccttctcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964254_FT00000_P-B Feature FT:source KU964254_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 32_12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccgccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcagaaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaagacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
tacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgttcacaaaattaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacctataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctattcgagatcttctcgacaccg
cctctgctctacatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgccattagataaagggatcaaaccgtattatccagagtatgcagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctctctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacttcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC510651_FT00000_P-B Feature FT:source KC510651_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcca
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacacgcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctaaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgcgttcacgaggaccatgcgactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacggtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcatttgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964267_FT00000_P-B Feature FT:source KU964267_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 33_11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcgaagactggggaccctgtaccgaacatggag
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
tccctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacgaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacaattaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagctggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctgttgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
ataccctgctttaatgcctttatatgcatgtatacaagcaaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttctaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccacaggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctggggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagcatccagggatttagtagtcgg
ctatgtcaacgttaatatgggcctaaaacttagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaaggggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaaacaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaaggttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK534611_FT00000_P-B Feature FT:source MK534611_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D412). Complete genome. [Riboviria] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggctctatactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggccccagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagccggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagct
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaagtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattcggcta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctatcctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacacctggccggacgccaacaaggtgggagtaggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB900102_FT00000_P-B Feature FT:source AB900102_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtrccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttccagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattggggkccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacraaaagatggggatactcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaattatgttttaggaaacttcct
gtmaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttggggtttgctgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtaaccagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttrtataagaggactcttggactttcagtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagctgggggaggagattaggtta
awgrtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgaccattataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctatccgtcggtgcgggaccttctagacaccg
ctactgctctgtatcgggaagccttagaatctcctgaacattactcacctcaccacacagcactaaggcaagctattttg
tgctggggggaattaatgaatctagctamctgggtgggtaataatttacaagatccagcctccagggatctagtagtcaa
ttatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgttggtattccttggactcataaggtgggaaac
tttacggggctctattcttctacagtacctgtctttaatcctgaatggcagactccttcttttccagacattcatttgaa
ggaggacattgttgatagatgtaagcaatttgtgggaccccttacagcaaatgaaaacaggagactaaaattaataatgc
ctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacaagacattatttgcatactctttggaaggcgggtatcttatataaaagagagtcaacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaattggccggacgcccacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacatctgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964293_FT00000_P-B Feature FT:source KU964293_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 35_7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaacccttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctaggggggacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggctatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcaatttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggacgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttcacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttt
tacgtaaccagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaacttatcgggactgacaattctgtcgtactctcccgcaagt
acacctcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgccaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtattaggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ccaatgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggacacataaggtgggaaac
ttcgcggggctttattcttctacggtaccttgctttaatcctaactggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtctacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
caggggtcacccccccacatgggggactgttggggtggagcccccaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MG571362_FT00000_P-B Feature FT:source MG571362_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 30671). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggccttcc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgtttggggctctaccgcccgcttctccgcctgttgtaccgaccgactac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctactcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccgtcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatccccatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccgccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815579_FT00000_P-B Feature FT:source GU815579_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccaatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggggttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttccggatattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcctttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacaagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccttgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtaggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148380_FT00000_P-B Feature FT:source KP148380_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-20). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaatatggag
aacatcgcatcaggactcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagacccgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgctcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacgacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatattattggaagttggggcaccttaccccaggaacatattgtattgaaaatcaaacaatgttttagaaaacttcct
gtaaccagacctattgattggaaggtgtgtcaacgaattgtgggacttttgggattcgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttataaggccttcc
tgatcaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggtttggccataggccatcagcgcatgcgtgggacctttgtgtctcctttgccgatccatacggcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcgaaacttatcgggactgacaattctgttgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattttg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgcatggcaaactccttcttttcctgacattcatttaca
ggaggacattgttaataggtgtaaacaatttgtgggacccctcacagtgaatgaaaacaggagactaaaattgatcatgc
ctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgtggtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggattccaacaaggtgggagtgggagcattcgggc
cgggattcgctccaccccatgggggactgttggggtggagtcctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggacggcagcctactcccctatctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674407_FT00000_P-B Feature FT:source MF674407_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV040043). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
ccgtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcaaaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatcccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
tacccattttcttttgtctttgggcatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggctccttgccacaggaccatattgtacaaaaaatcaaattatgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcaccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgcggaacctttgtgtctcctctgcccatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgcttctccgcctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttgcggagtgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcatatcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaagacccagcatccagggatttagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactgctgttgttagacaacgacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgca
agaggacattgttgataggtgtacgcaatttgtgggacccctaacagtaaatgaaaacaggagattaaaattaattatgc
ctgctaggttttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacgacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccatacaaggacaactggccggatgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcttgttggggtggagccctcaggctcaaggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148360_FT00000_P-B Feature FT:source KP148360_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D93-3-36). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagccggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtatgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctatcctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaagtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagacaaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgtattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactaacaaatgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881821_FT00000_P-B Feature FT:source KY881821_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient-03). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttcaaccaaactcttcaagatcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtaccgaacatggag
aacatcgcatcaggacacctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaaat
atacatcctttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
cagaatgcagcgaaggacacagcacggggacgctaagagctctaccgcccgcttctccgtctgttgtacagaccgagcac
ggggcgcacctctctttacgcggaccccgcgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgccaaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctgctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagcaattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccagcaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacgcataaggtgggaaac
tttacggggctttattcttctacggtaccatgctttaatcctaactggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ccgctaggttttatcccaaggttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttccacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcggct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|LC349878_FT00000_P-B Feature FT:source LC349878_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatccccgagtcagggctctgtaccttcctgctggtggctccagttcaggaa
cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgccgaatatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
tacccattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactctcttaacttcatgg
gatatgtaatcggaagttggggcaccttaccccaggaacatattgtgttgaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctctgctgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttataaggcctttc
taaacaaacaatatctgaacctttaccccgttgcgaggcaacggtcaggtacgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggtcatcagcgcatgcgcgggacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgacaattccgttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgcggtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgaattaatgaatctagccacctgggtgggaagtaatttggaagaccctgcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtctcttttggagtgtggattcgcactcctactgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacgcataaggtgggaaac
tttacggggctttattcttctacggtacctagctttaatcctaactggcaaactccttcttttcctgacattcatttgaa
ggaggacatcgttgataggtgtaaacaatttgtgggacccctcacagtaaatgaaaacaggagactaaaattgattatgc
ctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtattttatacaaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcctccaaacctcgacaaggc
atggggacaaatctttccgtccccaatccgctgggcttctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagtgggagcattcgggc
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggaaggaagcctactcccctgtctccacctctaagagatactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815629_FT00000_P-B Feature FT:source GU815629_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaagaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacacgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148452_FT00000_P-B Feature FT:source KP148452_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Y167-5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatccaagagtcagagctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgtctcttccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctgggtgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaacaccagcaccggaccatgcagaacctgcacgactactgctcaaggaacctctttgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttctgttgtctctgggcatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatataattggaggttggggcaccttaccccaggaacatattgtattgaaaatcaaacaatgttttagaaaacttcct
gtaaacaggcctattgattggaaaatatgtcaacgcattgtgggtcttttgggattcgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggctttcactttctcgccaacttataaggcctttc
taaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtgtctccgctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattctgtcgttctttcccgaaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcatggggctctaccgcccgcttctccgtctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctac
acgtcgcatggagaccaccgtgaacgctcaccggaccctgcccaaggtcttacataagaggactattggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacactgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagctacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctctattcttctacggtacctaactttaatcctgagtggcaaactccttcttttcctgacattcatttgca
ggaggacattgttaataggtgtacacaatttgtaggccccctcacagtaaatgaaaaaaggagactaaaattgatcatgc
ctgctaggttctatcctaacgttactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcgttacttccagacgagacattatttacatactctttggaaggcgggtatcttatatgaaggagaaacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattccttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaactgtgccaacagct
cctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctcaacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964264_FT00000_P-B Feature FT:source KU964264_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 33_8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcata
tccctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacgaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctgttgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
ataccctgctttaatgcctttatatgcatgtatacaagcaaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttctaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccacaggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagggtaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctgatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctggggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagcatccagggatttagtagtcgg
ctatgtcaacgttaatatgggcctaaaacttagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaaggggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaaacaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaaggttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcccaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KM359440_FT00000_P-B Feature FT:source KM359440_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FF3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacagaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcagtgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaacttatcgggactgacaattctgtcgtgctctcccgaaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttagggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcccctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttctgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatytgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatggggggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggatcctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagtt
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MG571361_FT00000_P-B Feature FT:source MG571361_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 30357). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcccccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatcccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttcgaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccac
ggggcgtacctctctttacgcggactccccatctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctatgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctatggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcaggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacgcttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaactggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcttccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgaagtggaa
>gnl|hbvnuc|MT757450_FT00000_P-B Feature FT:source MT757450_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1_P05). Complete genome. [Riboviria] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaccacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgacttctgctcaaggaacctctatgtttccct
cctgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctcataaaacaaaaagatggggctattcccttaacttcatgg
gatatgtaattggaagttggggcactttaccccaggaacatattgtattgaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtgtgtcaacgaattgtaggtcttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgcccacttacaaggcttttc
taaacaaacagtatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagctgcctgttttgctcgcagcaggtctggagcgaaacttatcgggaccgacaattctgtcgtcttgtcccgtaaat
atacatcgtttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcg
ctgaatcctgcggacgacccctcccggggccgcttggggctctatcgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggacttttagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctacttttcaagcctccaagctgtgtcttgggtggctttggggcatggacattgaccactataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatcttctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacactgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccgggctttaatcctgaatggcaaactccttcttttcctgacattcatttgaa
ggaggatattgttgataggtgtaaacaatttgtgggacccctcacagtaaatgaaaacaggagactaaaattgatcatgc
ctgctaggttttattctaatgttaccaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacaagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgtccccaatccgctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggactactggccggactccaacaaggtgggagtgggagcattcgggc
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcaggtagcaaggccgcctactcccctgtctccacctctaagggacactcatcctca
ggccattcagtggaa
>gnl|hbvnuc|FJ023633_FT00000_P-B Feature FT:source FJ023633_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_C04-0583). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
ccgtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatwccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
tacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggctccttgccacaggaacatattgtacaaaaaatcaaattatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttataaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggcacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgcttctccgcctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcatcatacggcactcaggcaagctattctg
tgttggggtgaattgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctaactttaatcctgattggcaaactccttcttttcctgacattcacttgca
ggaggacattgttgataggtgtaagcagtttgtgggacccctaacagtaaatgaaaacaggagattaaaattaattatgc
ctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacgacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccatacaaggacaactggccggatgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcttgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815669_FT00000_P-B Feature FT:source GU815669_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaagaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtattcaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgagtctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacacgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MT757436_FT00000_P-B Feature FT:source MT757436_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1_L03). Complete genome. [Riboviria] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgacttctgctcaaggaacctctatgtttccct
cctgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctcataaaacaaaaaggtggggctattcccttaacttcatgg
gatatgtaattggaagttggggcactttaccccaggaacatattgtattgaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtgtgtcaacgaattgtaggtcttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgcccacttacaaggcttttc
taaacaaacagtatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagctgcctgttttgctcgcagcaggtctggagcgaaacttatcgggaccgacaattctgtcgtcctgtcccgtaaat
atacatcgtttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttccgtcccctcggcg
ctgaatcctgcggacgacccctcccggggccgcttggggctctatcgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggacttttaacaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccactataa
agaatttggcgcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacactgctcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccgggctttaatcctgaatggcaaactccttcttttcctgacattcatttgca
ggaggatattgttgataggtgtaaacaatttgtgggacccctcacagtaaatgaaaacaggagactaaaattgatcatgc
ctgctaggttctatcctaaggttaccaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacaagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgtccccaatccgctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggactactggccggactccaacaaggtgggagtgggagcattcgggc
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcaggtagcaaggctgcctactcccctgtctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EF494382_FT00000_P-B Feature FT:source EF494382_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TWD347). Complete genome. [Hepadnaviridae] (length=3200 residues).
actttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaacagtgag
ccctgctcagaatactgtctctgccatatcgtcaaccttatcgaagactggggaccctgtaccgaacatggagaacatca
catcaggactcctaggacccctgctcgtgtcacaggcagggtttttcttgttgacaaaaatcctcacaataccacagagt
ctagactcgtggtggacttctctcaattttctaggggagacacccgtgtgtcgtggccaaaattcgcagtcccaaatctc
cagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctct
gcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaattcca
ggatcatcaacaaccggcacgggaccatgcaaaacctgcacgagtcctgctcaaggaacctctatgtttccctcatgttg
ctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagt
gggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctgg
ctttcagttatatggatgatgtggtattgggggccaagtctatacaacaccttgagtccctttatgccgctgttaccaat
tttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgggatatgt
aatagggtgttggggcacattgccacaggaacatattgtgcaaaaaatcaaaatgtgttttaggaaacttcctgtaaaca
gacctattgattggaaggtatgtcaacgaattgtgggtcttttagggtttgccgcccctttcacgcaatgtggatatcct
gctttaatgcctttatatgcatgtatacaagcaaaacaggctttcactttctcgccaacttataaggcctttttacgtca
acagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgttcgctgacgcaacccccactggtt
ggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaactcctagcc
gcttgttttgctcgcagcaggtctggggcgaacctcatcgggactgacaattctgtcgtgctctcccgcaagtatacatc
attcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatc
ccgcggacgacccctcccggggccgcttggggctctaccgcccgcttccccgcctgatgtaccgaccgaccacggggcgc
acctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgc
atggaaaccaccgtgaacgccccccggactctgcccaaggtcttgcatgagaggactattggactttcagcaatgtcaac
gaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttaatgatct
ttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatcatctctt
gttcatgtcctacttttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacacgtataaagaattt
ggagcttctgtggagttactctcttttttgccttctgacttctttcctaatattcgagatctcctcgacaccgccaatgc
tctgtatcgggaggccttagagtctccggaacattgttcagctcaccatacggcactcaggcaagctattgtgtgttggg
gtgagttgatgaatctagccacctgggtgggaggtaatttggaagatccaggatctagagaattagtagtcggctatgtc
aacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaactgttct
tgaatttttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatcttatcaacac
ttccggaaactactgttattagacaaagaggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctaaa
tcaccgcgtcgcaaaagatctcaatctcgggactctcaatgttagtattccttggacacataaggtgggaaactttacgg
ggctttattcttctacggtaccttgctttaatcctgaatggcaaactccttcttttcctgacattcatttgcaggaggac
attgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaaaaggagactgagattaattatgcctgctag
gttttatcctaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagttaatcatt
acttccagacgagacattatttacatactctttggaaggcaggtatcttatataaaagagagtccacacgtagcgcctca
ttttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggcatgggga
caaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactcagaaaat
ccagattgggacctcaacccgcgcaaggacaactggccggacgccaacaaggtgggagcgggagcattcgggccagggtt
cgtccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactatgccagcagctcctcctc
ctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctcaggccatg
>gnl|hbvnuc|GU815556_FT00000_P-B Feature FT:source GU815556_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaactccatgg
gatatgtaattgggagttggggcacattgccacagcaacatattgtacaaaaaatcaaaatgtgttttcggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgccccattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctacttacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881790_FT00000_P-B Feature FT:source KY881790_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient-01). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
tagtgagccctgctcagaatactgtctctcccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggatcatgcaaaacctgcacgactcctgctcaaggaacctctatgttcccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttcacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tggcaacgaccgaccttgaggcatacttcaaagactgtgtgtttacggagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgctcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctgctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactgctgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttctttccctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttaccgtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttctatcccaatgttactaaatatttgcctttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagatacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacttcaaccagcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY167100_FT00000_P-B Feature FT:source AY167100_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Va). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctccgaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgtatcaggactcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatccttacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccatttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaagaacatattgttcaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tcagaaatcagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtactctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagagaactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaagagttgggggaggaggttaagtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggcagtaatttggacgatccagcatccagggaattagtagtcag
ttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaca
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaccaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagtatgtagtt
aatcattacttccagacacgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcctccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacacgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccacatgggggattgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagagacactcatcctca
ggccatgcattggaa
>gnl|hbvnuc|KJ173416_FT00000_P-B Feature FT:source KJ173416_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N201M(e401)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactctgcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaccatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgctgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaaatcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccggcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcctctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgtgaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgataaatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacttcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggtctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KM875417_FT00000_P-B Feature FT:source KM875417_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate pt9T). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaagcttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtaaacagtatctgaccctttaccccgttgccaggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggagct
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgtccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggaatgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttttcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggcgcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148373_FT00000_P-B Feature FT:source KP148373_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaatatggag
aacatcgcatcaggactcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatgcc
acagagtctagactcgtggtggacttctcccaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcaccttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatattattggaagttggggcaccttaccccaggaacatattgtattgaaaatcaaacaatgttttagaaagcttcct
gtaaacagacctattgattggaaggtgtgtcaacgaattgtgggacttttgggattcgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttataaggcctttc
tgaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctttgccgatccatacggcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcgaaacttatcgggactgacaattctgttgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagaccttctcgacaccg
cctctgcactgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattttg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctgtcttacttttggaaaagaaa
ctgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgcatggcaaactccttcttttcctgacattcatttaca
ggaggacattgttaataggtgtaaacaatttgtgggacccctcacagtgaatgaaaacaggagactaaaattgatcatgc
ctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgtggtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggattccaacaaggtgggagtgggagcattcgggc
cgggattcgctccaccccatgggggactgttggggtggagtcctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggacggcagcctactcccctatctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674453_FT00000_P-B Feature FT:source MF674453_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV050074). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
ccgtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggctccttgccacaggaacatattgtacaaaaaatcaaattatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
tacataaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctcctctgccaatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaccttatcgggactgacaattctgtcgtgctttcccgcaagt
atacatcgtttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgcccgcttctccgcctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtagcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctaactttaatcctgattggcaaactccttcttttcctgacattcatttaca
ggaggacattgttgataggtgtaagcaatttgtgggacccctaacagtaaatgaaaaaaggagattaaaattaattatgc
ctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacgacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccatacaaggacaactggccggatgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcttgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674466_FT00000_P-B Feature FT:source MF674466_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV050092). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcagaaa
cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttatctttgggtatacatttaaaccctcacaaaacgaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggttccttgccacaggaacatattgtacaaaaaatcaaattatgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctggggttcgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcaccaacttacaaggcctttc
tgtgtaaacagtatctgaaccttttccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaattctgtcgtgctatcccgccggt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgaccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgca
ggaagacattgttgataggtgtgagcaatttgtgggacccctaacagtaaatgaaatcaggagactaagattaattatgc
ctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatcccgagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccacacaaggacaattggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU306699_FT00000_P-B Feature FT:source EU306699_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcatcaacaaccagcaccggaccatgcagaaccagcacaactcttgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcggtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctcccagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctcacaaaacaaaaagatggggatattccctcaacttcatgg
gatatgtaattgggagttggggcacattaccacaagaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcacctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagccaaacaggcttttactttctcgccaacgtacaaggcctttc
taagtaaacagtatctgaacctgtaccccgttgcacggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgcccgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacttgcccaaggtctggcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatactttaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atcacatgttcatgtcctactgttcaagcctccaagctgtgcctggggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatttcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgtgttgatgaatctagccacctgggtgggaagtaatttggaaaatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU939636_FT00000_P-B Feature FT:source EU939636_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctatacttccctgctggtggctccagttcaggga
cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcgaagactggggaccctgtaccgaatatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttggggtccaaatctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttt
tacgtaaccagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgtataagaggactcttggactgtcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgcctcctgacttttatccttctattcgagatctcctcgataccg
cctctgctctatatcgggaggccttagagtctccggaacattgtacagctcatcatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaggcaatttggaagatcccgcatccagagaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaag
ttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactgctgttattagacgaagaagcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcccaatgttagtattccttggacacataaggtgggaagc
tttacggggctgtattcttctactgtaccttgctttaatcctaactggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaaaaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggaatcttatataaaagagagtccacacgtag
cgcctcattttacgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatcccgattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
tagggttcacccctccccacgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964128_FT00000_P-B Feature FT:source KU964128_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 23_6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaacgcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcaccttgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaatagtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcttgtatacaaacgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggcgcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaagaggtcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctactcgacaccg
cctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcatatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaactggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcggcc
cagggttcacccctccccatgggggactgttggggtggagccctcacgctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ787475_FT00000_P-B Feature FT:source FJ787475_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX-2). Complete genome. [Hepadnaviridae] (length=3218 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctagggcccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacctctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaacgcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggtgtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccgtatatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatataattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgatcggaaggtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctccactgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtcttgtttgtactaggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgccta
atcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacacgta
taaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgaca
ccgccactgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctatc
ctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatcaagcatccagggatttagtagt
cggctatgttaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttgggagag
aaactgttcttgaatatttggtatcttttggagtgtggattcgcacccctcctgcatatagaccaccaaatgcccctatc
ttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacg
aaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacacataaggtggga
aactttacggggctctattcttctacggtaccttgctttaatcctaattggcaaactccttcctttcctgatattcattt
gcaggaagacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaatta
tgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagcatgtc
gttaatcattacttccagacgagacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacg
tagcgcctccttttacgggtcaccctattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaa
ggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
ctcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcg
ggccagggttcacccctccccatgggggactgttggggtggagcccgcacgctcagggcatactcacaactgtgccagca
gctcctcctcctgcctccaccaatcggcagtcaggaaggcagccgactcccttatctccacctctaagggacactcatcc
tcaggccatgcaatggaa
>gnl|hbvnuc|KU964260_FT00000_P-B Feature FT:source KU964260_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 33_4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
tccctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacgaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagctggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctgttgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
ataccctgctttaatgcctttatatgcatgtatacaagcaaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttctaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccacaggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctgatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctggggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagcatccagggatttagtagtcgg
ctatgtcaacgttaatatgggcctaaaacttagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaaggggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaaacaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaaggttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgagacattatttacacaccctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674409_FT00000_P-B Feature FT:source MF674409_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV040047). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
tagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttcccccat
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctcacaaaactaaaagatggggatattcccttaatttcatgg
gatatgtaattggtagttggggttccttgccacaggaacatattgtacaaaaaatcaaattatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
tgagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaattctgtcgtgctatcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctggccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatatttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgca
ggaagacattgttgataggtgtaagcaatttgtgggacccctaacagtaaatgaaatcaggagactaaaattaattatgc
ctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatcccgagcatgtagtt
aatcattactttcagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattctgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccacacaaggacaattggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ803820_FT00000_P-B Feature FT:source KJ803820_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY081397). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctttatgccgctgt
taccaattttctgttgtctttgggcatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gttatgtaattggatgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaaaccaaacaggcttttactttctcgccaacttacaaggcctttc
tcagacaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaagactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcattcccatggctgctaggctgtgctgccaactggatactgcgcggaacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctgctgtaccgaccgaccac
ggggcgtacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctatggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctatcctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacatcgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcctccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
caggattcatccctccccatgggggactgttggggcggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccactcggcagtcaaggaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcggtggaa
>gnl|hbvnuc|KY470830_FT00000_P-B Feature FT:source KY470830_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 10-2-15). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtgctttcctgctggtggctccagttcaggaa
cagtgacccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttagcccctcacaaaactaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtctgtcaacgcattgtgggtcttctggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggcaataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctactgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctccccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaggagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgctcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggatgatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatattactaaatatttgcccttagataaagggatcaaaccgtattatccagagaatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagaatccacacgtag
cgcctcattttgcgggtcaccatattcttggaaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacagggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY470834_FT00000_P-B Feature FT:source KY470834_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 10-D6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgacccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtaccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaactaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggaacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttctggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtttgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggcaataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttccgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaggagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgctcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaatcagtagtcgg
ctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatattactaaatatttgcccttagataaagggatcaaaccgtattatccagagaatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagaatccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|KU963847_FT00000_P-B Feature FT:source KU963847_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 4_6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcacggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcaccgcaccatacggcactcaggcaagctattctg
tgttggggggagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattggtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccaaacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaattc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|LC279272_FT00000_P-B Feature FT:source LC279272_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ku_3rd_child_UC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaattatgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttagggtttgctgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaatcaaaacaggcttttactttctcgccaacttataaggcctttc
taagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatttgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccgtcggtgcgagacctcctagataccg
ctgctgctctgtatcgggaagctttagaatctcctgaacattgctcacctcaccacacagcactcaggcaagctattctg
tgctggggggaattaatgactctagctacctgggtgggaaataatttagaagatccagcatccagggatctagtagtcaa
ttatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttacggggctctattcttctacagtacctgtctttaattctgaatggcaaactccttcttttccagacattcatttaca
ggaggatattgttgatagatgtaagcaatttgtaggaccccttacagtaaatgaaaacaggagactaaaattaataatgc
ctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattactttcagacaagacattatttgcataccctttggaaggcgggtatcttatataaaagagagtctacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacatctgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MT757445_FT00000_P-B Feature FT:source MT757445_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1_L24). Complete genome. [Riboviria] (length=3215 residues).
caccaccacgttccaccaaacccttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgacttctgctcaaggaacctctatgtttccct
cctgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctcataaaacaaaaagatggggctattcccttaacttcatgg
gatatgtaattggaagttggggcactttaccccaggaacatattgtattgaaaatcaaacaatgtttcaggaaacttcct
gtaaacaggcctattgattggaaagtgtgtcaacgaattgtaggtcttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgcccacttacaaggcttttc
taaacaaacagtatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagctgcctgttttgctcgcagcaggtctggagcgaaacttatcgggaccgacaattctgtcgtcctgtcccgtaaat
atacatcgtttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcg
ctgaatcctgcggacgacccctcccggggccgcttggggctctatcgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttgcataaaaggactcttggacttttagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccactataa
agaatttggcgcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacactgctcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcctgtcttacttttggaaaagaaa
ctgttcttgaatatttggtgtcgtttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tccacacttccggagactactgttattagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccgggctttaatcctgaatggaaaactccttcttttcctgacattcatttgca
ggaggatattgttgataggtgtaaacaatttgtgggacccctcacagtaaatgaaaacaggagactaaaattgatcatgc
ctgctaggttctatcctaaggttaccaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacaagacattatttacatactctttggaaggcgggtatcttatataaaagagagacgacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgtccccaatccgctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggactattggccggactccaacaaggtgggagtgggagcattcgggc
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcaggtagcaaggccgcctactcccctgtctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY220697_FT00000_P-B Feature FT:source AY220697_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttaccggcggggttttccttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcgtggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatgtggatgatttggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttattttctcgccaacttacaaggcctttc
tgagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgttcaatgagtgggaggagttgggggaggagtttaagtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatcaagcatccagggatttagtagtcgg
ctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcatatagaccgccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacacacaaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaataggagacttaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
gatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgtacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttgggttggagccctcaggctcagggtctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatacagtggaa
>gnl|hbvnuc|FJ562219_FT00000_P-B Feature FT:source FJ562219_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctcttcgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaaggtggggatattcccttaacttcatgg
gatatgtaattgggagttggggcactttgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagacaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttctaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctgatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcacccctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgatattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattactttcagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacacccatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963956_FT00000_P-B Feature FT:source KU963956_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 11_12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
accatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaacccacacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagcaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaacactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaaccctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173357_FT00000_P-B Feature FT:source KJ173357_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX065C(e313)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagttcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttacatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacaaaaaatcagaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
ataccctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttttcgccaacttacaaggccttcc
taagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggcacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttagggctgtaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggtgttgggggcggagattaggtta
aaggtctttgtacttggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaaccctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtaggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX276809_FT00000_P-B Feature FT:source KX276809_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctcagccacatcgtcaatcttatcgaagactggggaccctgtgacgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgttggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtccact
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gttaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgccgttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcrttcccatggctgctaggctgtgctgccaactggatcctrcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttttagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgygttcaccagcaccctgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagctactgtggagttactctcttttttgcctaacgacttctttccttctatgcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaaatgagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaaggggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccycaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtgaacaatttgtggggccccttacagtaaatgaaaamaggagactaaaattaattatgc
ctgctagrttttatcccaatgttactaaatatttgcccttagagaaagggatcaaatcttattatccagaacatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatattatataaaagagagtccacacrtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggrctgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881756_FT00000_P-B Feature FT:source KY881756_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate control-02). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaattctgtctcggccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaacaaccagcaccggaccatgcaaaacatgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcactttgccacaggaacatattgtacaaaaaatcaaattgtgttttaagaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcacggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgccaaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttaccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactccccccgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctacatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaatcatgc
ctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgaggcattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacacgatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattccgccccatgggggactgttggggtggagccctcaggctcagggcatacttacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB073832_FT00000_P-B Feature FT:source AB073832_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Th65). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcccccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgagtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccgtttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggggttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcaccaacttacaaggcctttc
taagtcaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggagtaccgaccaaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgattcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccmtgcaactttttcacctctgcctaatc
atctcttgtycatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctactgacttctttcctkctgtacgagatctgctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgtwcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcagccagggaattagtagtcaa
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgycttacttttggragacaaa
ctgtccttgaatatttggtctcttttggagtgtggattcgcactcctcctccatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagaggaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttaatattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgawtggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtrmgcaatttgtggggccccttacagtaaatgaaaccaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattcctccccacgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
agccatgaagtggaa
>gnl|hbvnuc|EU939672_FT00000_P-B Feature FT:source EU939672_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagaccccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctaggggaaacactcgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tcagtaaacagtatctgaccctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgtccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggaggtcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttaccttctgacttctttccttctgttcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgta
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ccatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgtcgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcctagtgttactaaatatttacccttggataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttacgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggt
tagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963834_FT00000_P-B Feature FT:source KU963834_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3_7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttctgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctgtgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggtagttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctcccgaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatctagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggggtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
agaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatatacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB642094_FT00000_P-B Feature FT:source AB642094_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BFJT1999-2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacractactgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgcctcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgacttgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgcgctaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgcaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctccactgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgacg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggggtgtggattcgcactcctactgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaactggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ccgctaggttttatcccaatgttactaaatatttgccattagataaagggatcaaatcttattatccagagcatgtagtt
aatcattacttccagacgagrcattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttcccggatcatcagttggatcctgcattcaaagccaactc
agaaaatccagattgggacttcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK534676_FT00000_P-B Feature FT:source MK534676_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D529). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccacatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggaacatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagctggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttagggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcacaacaggcttttactttctcgccaacttacaaggccttcc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtttgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcacgtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgcgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgtcgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaagctcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgaa
agaggatattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439542_FT00000_P-B Feature FT:source MZ439542_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TF006-2019-Quasi-5). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
ccgtgagccctgctcagactactgcctcagccatatcgtcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaaaacccgtgtgtcctggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcgaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttatgtctttgggcatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggctccttgccacaggaacatattgtacaaaaaatcaaattatgttttagaaagcttcct
gtaaacaggcctattgattggaaagtgtgtcaacgaattgtaggtcttttggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtacacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgcggaacctttgtgtctccgctgcctatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaccttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgcttctccgcctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagtcgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcctgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccgtataa
agaatttggagcctctgcggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaagccttagagtctccggaacattgtacatatcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
atatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaag
ttgttctcgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgctagtattccttgcactcatagagtgggaaac
tttacggggctttattcttctactgtacctcactttaatcctgattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgataggtgtgagcaatttgtgggacccctaacagtaaatgaaaaaagaagattaaaattaattatgc
ctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatccagagcacgtagtt
aatcattacttccagacgagacattatttacatattctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctcccaacctcgaaaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccatacaaggacaactggccggatgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacacgcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148357_FT00000_P-B Feature FT:source KP148357_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D93-3-2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgccaatctcatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctca
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcggcgcatgcgtggaacctttgtgtctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagccggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtctgtttaatgagtgggaggagttgggggaagaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctatcctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagacaaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctccttttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactaacaaatgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881860_FT00000_P-B Feature FT:source KY881860_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient-04). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacgaaaaatcacaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggccttcc
tacgtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaagccaccgtgaacgcccaccggaacctgcccaaggccttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggtgttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtgtgctcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgtacacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaag
ttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccgtggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtacgcaatttgtggggccccttaccgtaaatgaaaccaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtgtcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaagtccagattgggacctcaacccgcacaaggacaactggccggacgccaggaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|MZ439544_FT00000_P-B Feature FT:source MZ439544_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TF006-2019-Quasi-7). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
ccgtgagccctgctcagactactgcctctgccatatcgtcaaccttctcgacgactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcataatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcctggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcgaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggctccttgccacaggaacatattgtacaaaaaatcaaattatgttttaggaagcttcct
gtaaacaggcctattgattggaaagtgtgtcaacgaattgtaggtcttttggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgctaacttacaaggcctttc
tacgtacacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgcggaacctttgtgtctccgctgcctatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgcttctccgcctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagtcgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcctgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccgtataa
agaatttggagcctctgcggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaagccttagagtctccggaacattgtacatatcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
atatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaag
ttgttctcgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggactctcaatgttgatattccttgcactcatagagtgggaaac
tttacggggctttattcttctactgtacctatctttaatcctgattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgataggtgtgagcaatttgtgggacccctaacagtaaatgaaaaaagaagattaaaattaattatgc
ctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatccagagcacgtagtt
aatcattacttccagacgagacattatttacatattctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctcccaacctcgaaaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccatacaaggacaactggccggatgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcttgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacacgcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|AB287328_FT00000_P-B Feature FT:source AB287328_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Ba 51). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacttttcaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttgtcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccgtcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctatacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacgttgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcacgacaggcttttactttctcgccaacttacaaggcctttt
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctataccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataaaaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcatatttcctgtcttacttttgggagagaaa
ctgttcttgaatacttggtgtcttttggagtgtggattcgcactcctcctgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaagctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963972_FT00000_P-B Feature FT:source KU963972_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 12_13). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
tacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcacctttcacgcaatgtgg
atatcctgccttaatgcctttatatgcatgcatacaagcaaaacaggctttcactttctcgccaacttacaaggcctttc
taagtcaacagtatttgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggtgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagcaacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaacatgggcctaaaaatcagacaactattgtggtttcatatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccctgctttaatcctaaatggcaaactccttcttttcccgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacacctggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcgcaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881723_FT00000_P-B Feature FT:source KY881723_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate control-01). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaattctgtctcggccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaacaaccagcaccggaccatgcaaaacatgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcactttgccacaggaacatattgtacaaaaaatcaaattgtgttttaagaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcacggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgccaaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttaccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactccccccgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctacatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaatcatgc
ctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgaggcattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacacgatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattccgccccatgggggactgttggggtggagccctcaggctcagggcatacttacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AF461360_FT00000_P-B Feature FT:source AF461360_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FH14-2). Complete genome. [Hepadnaviridae] (length=3194 residues).
ctccaccactttccaccaaactctgcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatctgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggggttggggaacattgccacaggaacatattgtacacaaaatcaaaatgtgttttaggaaacttcct
gtgaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctctccaacttacaaggcctttc
tacgtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgaatgggaggagttgggggaggagaataggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaacctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactccttcagcatatagaccacaaaatgcccctatctta
tcaacgcttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgaa
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaacgaaaacaggagacttaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacaaacctcgaaaaggcatggggacaaatctttctgtc
cccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactcagaaaatcccgattgggacct
caacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggccagggttcacccctccccatg
ggggactgttggggtggaaccctcaggctcagggcatactcacaactgtgccagcagctcctcctcctgcctccaccaat
cggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctcaggtcatgcagtggaa
>gnl|hbvnuc|KJ173372_FT00000_P-B Feature FT:source KJ173372_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P009-M2(B137)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccgggccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtcgggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
ggtatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgcattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttttcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttatgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcctctgtggagttactcccttttttgccttctgacttctttccttctattcgagaactcctccacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgccttacctttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagacctccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttagtattccttggactcataaggtggggaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatattcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963949_FT00000_P-B Feature FT:source KU963949_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 11_5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
accatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctttgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaacccacacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagcaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaacactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaaccctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggaagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB073843_FT00000_P-B Feature FT:source AB073843_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Iw27). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagcaagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagacttgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcaagacctgcaccactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaartctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattatacaaaaaatcaaagtatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgctgccccttttacgcaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattctgtagtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgtttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgcccaaggtcttgyataagaggactcttggacttttagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtcggtgcgagacctcctagataccg
ctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacatcaccacacagcactcaggcaagctattctg
tgctggggggaattaacgactctaggtacctgggtgggtaataatttacaagatccagcgtccagggatctagtagtcaa
ttatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtatcccttggactcataaggtgggaaac
tttacggggctctattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttccagacattcatttaca
ggaggacattgttgatagatgtaagcaatttgtgggacccctcacagtaaatgaaaacaggagactaaaattaataatgc
ctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatccagataatgtagtt
aatcattacttccagacgagacattatttgcatactctttggaaggcgggtatcttatataaaagagagtcaacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgaccatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacatctgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttgtctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148419_FT00000_P-B Feature FT:source KP148419_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-65). Complete genome. [Hepadnaviridae] (length=3209 residues).
ctccaccaagttccaacaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaatatggag
aacatcgcatcaggactcctcggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaatttgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctttgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatattattggaagttggggcaccttaccccaggaacatattgtattgaaaatcaaacaatgttttagaaaacttcct
gtaaacagacctattgattggaaggtgtgtcaacgaattgtgggacttttgggattcgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttataaggcctttc
tgaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctttgccgatccatacggcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcgaaacttatcgggactgacaattctgttgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgactcctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttgggatgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgcatggcaaactccttcttttcctgacattcatttaca
ggaggacattgttaataggtgtgaacaatttgtgggacccctcacagtgaatgaaaaaaggagactaaaattgatcatgc
ctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgtggtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggattccaacaaggtgggagtgggagcattcgggc
cgggactcgctccaccccatgggggactgttggggtggagtcctcaggctcagggcatactcacaactgtgccagcagct
cctgcctccaccaatcggcagttaggacggcagcctactcccctatctccacctctaagagacactcatcctcaggccat
gcattggaa
>gnl|hbvnuc|LC349869_FT00000_P-B Feature FT:source LC349869_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcccccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaatcctcagaaaacaaaaagatggggctactcccttaatttcatgg
ggtatgtaattggaagttggggcaccttaccccaagaacatattgtgttgaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctattgactggaaagtgtgtcaacgaattgtgggtcttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctttgatgcctttatatgcatgtatacaagctaaacaggcttttactttttcgccaacgtataaggcctttc
taaacaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggactgacaattctgtcgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccatcggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagaacaggtta
atggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatcttctcgacaccg
cctctgctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagaccaagcctcccgggacttagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcttgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactgctgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctagctttaatcctcaatggcaaactccttcctttcctgacattcatttgca
ggaggacatcattaataggtgtgaacaatttgtgggaccccttacagtgaatgaaaacaggagactaaaattgattatgc
ctgctaggttctatcccaatgttactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctcaaaacctcgacaaggc
atggggacaaatctttccgtccccaatcctctgggattcttccccgagcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagtgggagcattcgggc
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaactgtgccaacagct
cctcctcctgcctccaccaatcggcagttaggaaggaagcctactcccctgtctccacctctaagagacactcatcctca
ggcagtgaagtggaa
>gnl|hbvnuc|KX276823_FT00000_P-B Feature FT:source KX276823_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcctggccaaaattcgcagtccc
aaatctccagtcactyaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccatttatgccgctgt
taccaattttcttttrtctttgggtatacatttaaaccctcagaaaacaaaaagatggggctactcccttaacttcatgg
ggtatgtaattggaagttggggcaccttaccccaagaacatattgtgttgaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacacgctaaacaagcttttactttttcgccaacgtataaggcctttc
tacacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggactgacaattctgtcgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctwccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccattggaacctgcccaaggtcttgcataagaggactcttggacttycagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagaycaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctaytgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttytttccttctattcgagatcttctcgacaccg
ccwctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccatcctcacgggamttagtagtcag
ctatgtcaatgttaatatgggcctaaaamtcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ytgttcttgaatatttggtgtcttttggagtgtggattcgyacacctcctgsatatagaccacaaaatgcccctatcttr
tcaacacttccggaaactgctgttgttagacracgatgcaggkcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctagctttaatcctcaatggcaaactccttcctttcctgacattcatttgca
ggaggacatcattaataggtgtaaacaattygtgggaccccttacagtaaatgaaaacaggagactaaaattgattatgc
ctgctaggttctatcccaaggttactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcgacaaggc
atggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagtgggagcattcgggc
cgggattcactccaccccatggrggactgttggggtggagccctcaagctcagggcatactcacaactgtgccaacagct
cctcctcctgcctccaccaatcggcagttaggaaggaagcctactcccctgtctccacctctaagagacactcatcctca
ggcaatgcagtggaa
>gnl|hbvnuc|MN689119_FT00000_P-B Feature FT:source MN689119_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YNMA7_10). Complete genome. [Riboviria] (length=3215 residues).
ctccaccacgttccaacaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctctcccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatatcattggaagttggggcaccttaccccaggatcatattgtattgaaaatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaggtatgtcaacgaatagtgggtcttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggctttcactttctcgccaacttataaggcctttc
tgagcaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcctgcgtggaaactttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacctcatcgggactgacaattctgtcgttctttcccggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgaaaccctgcccaaggtcttacataagaggactattggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgcgcagttactctcttttttgcctcaggacttctttccttctatgcgagatcttctcgacaccg
cctctgctctgtatagggaggccttagagtctccggaacattgttcacctcaccatacggcaattaggcaagctattctg
tgttggggtgagttgatgaatcttgctacctgggtgggaagtaatttggacgatccagcatccagggaattagtagttag
ctttgtcaatgttaatatgggcctaaaattcagacaattattgtggtttcacatttcctgtcttacttttggaagagaca
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcttatagaccaccaaatgcccctatctta
tcaatgcttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctccatctcgggactctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctacggtacctgtctttaatcctgaatggcaaaccccttcttttcctgacattcatttgca
ggaggacattgttaataggtgtaaacaatttgtaggccccctcacagtaaatgaaaacaggagactaaaattgatcatgc
ctgctaggttctatcctaacgttactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattactttcagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagaaacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattccttcccgatcaccagttggaccctgcattcaaagccaactc
agacaatcccgattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagctttcgggc
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaactgtgccaacagct
ccacctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctccacctctaagagacacccatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MT426101_FT00000_P-B Feature FT:source MT426101_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIPC140 transfection clone). Complete genome. [Riboviria] (length=3215 residues).
ctccacaactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgcctcggccatatcgtcaaccttctcgacgactggggaccctgtactgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggtaacacccgtgtgtcctggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggctgttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattggggaccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggggttggggctccttgccacaggaacatattgtacacaaaatcaaatcatgttttcggaaacttcct
gtaaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttt
tacgtaaccagtatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaacttatcgggactgacaattctgtcgtgctgtcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataa
agaatttggagcttcttcggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtttcgggatgccttagagtctccggaacattgctcacatcaccacacggcactcaggcaagctgttctg
tgttgggttgagttgatgaatttagccacctgggtgggaggtaatttggaagacccagcatccagggaagcagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacatttggaagagatc
tcgttcttgaatatttggtgtcttttggagtgtggattcgcacccctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccgtggactcataaggtgggaaac
tttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcctaacattcatttgca
ggaggacattgttgataggtgtaagcaatttgtgggacccctaacaataaatgaaaacaggagactaaaattaattatgc
ctgccagattttatcccaatgtaaccaaatacttgcccttagataaaggaatcaaaccctattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtgtcttatacaaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctaccgcatgggaggttcgtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattcctccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccacacaaggacacttggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacacacatcctca
ggtcatgcagtggaa
>gnl|hbvnuc|FJ562253_FT00000_P-B Feature FT:source FJ562253_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I86). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggttttccttgttgataaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaaccaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattaccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tgagtaaacagtatttgaacctttaccccgttgctcggcaacggactggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctactcgacaccg
cctcagctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaactccgacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
gatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggcggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaaccaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcaact
cctcctcctgcttccaccaatcggaagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963984_FT00000_P-B Feature FT:source KU963984_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 13_9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccgacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgtatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggtctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagattaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
tagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcggct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK534573_FT00000_P-B Feature FT:source MK534573_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 477). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcctaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgttcaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaattcgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttaccaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaagacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctcagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU939665_FT00000_P-B Feature FT:source EU939665_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C129). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctrccatatcgtcaatcttatygaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattggaagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttacgttctcgccaacttacaaggcctttc
tamgtaaccagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatmgggactgacaattctgtcgtgctctcccgcaagt
atacatcmtttccatggctgctaggstgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacsggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggrcatggacattgacmcgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggagttagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggtgtgtggattcgcactcctcctccatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagaagaaggggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacaaaaaatgaaaacaggagactaaaattaattatgc
ctgttaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttacgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccacgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagccagggaggcagcctactcccttatctccacctctaagggacacgcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815664_FT00000_P-B Feature FT:source GU815664_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaagaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtattcaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgcgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacacgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MT757454_FT00000_P-B Feature FT:source MT757454_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1_P16). Complete genome. [Riboviria] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgacttctgctcaaggaacctctatgcttccct
cctgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctcataaaacaaaacgatggggctattcccttaacttcatgg
gatatgtaattggaagttggggcactttaccccaggaacatattgtattgaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtgtgtcaacgaattgtaggtcttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgcccacttacaaggcttttc
taaacaaacagtatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagctgcctgttttgctcgcagcaggtctggagcgaaacttatcgggaccgacaattctgtcgtcctgtcccgtaaat
atacatcgtttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcg
ctgaatcctgcggacgacccctcccggggccgcttggggctctatcgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcctaaggtcttgcataagaggactcttggacttttagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccactataa
agaatttggcgcttctgtggagttactctcttttttgcctcctgacttctttccttctattcgagatcttctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacactgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccgggctttaatcctgaatggcaaactccttcttttcctgacattcatttgca
ggaggatattgttgataggtgtaaacaatttgtgggacccctcacagtaaatgaaaacaggagactaaaattgatcatgc
ctgctaggttctatcctaaggttaccaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacaagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgtccccaatccgctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggactactggccggactccaacaaggtgggagtgggagcattcgggc
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcaggtagcaaggccgcctactcccctgtctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ032342_FT00000_P-B Feature FT:source FJ032342_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S659-2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggcactgtactttcctgctggtggctccagttcaggaa
cactgagccctgctcagaacactgtctctaccacatcgtcaatctcatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcgtggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaaactcttcgttaccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcccttcatgccgctgt
taccaattttcttgtgtctttgggtatacatctaaaccctcacaaaacaaaaagatggggatattcccttaactttatgg
gatatgtaattgggagttggggcacattgccacaagaacatattgtacacaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttactgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaaacctttc
tgcgtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggcacctttgtgtctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgatcgcccaccggaacttgcccaaggtcttgcatcagaggactcttggactttctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtgtgctcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccgtataa
agaatttggagcctctgcggagttaatctcttttttgccttctgacttctttcctaatattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaacctagccacctgggtgggaggtaatttgcaagatcaagcatccagggatttagtagtcaa
ctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttgggagagata
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcagcacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgaatggcaaactccttcttttcctgacattcatttgaa
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaataggagactaaaattaattatgc
ctgctaggttttatccaaatgttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccggattgggaccgcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccacatgggggactgttggggtggagccctcaggctcagagcatattcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggaaggcagcctactcccgtaactccacctctaagggacactcatcctca
ggccacgcagtggaa
>gnl|hbvnuc|GQ924606_FT00000_P-B Feature FT:source GQ924606_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggwtattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaagaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtaaccagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
tctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggcctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaatctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgntctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacggcactcaggcaagctattstg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatccgaaatggcaaactccttcttttcctgacattcacttgca
ggaggaccttgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatcttgctgtccccaatcccctgggattcttccccgatcatcagttggacccttttttcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggccwactctcaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774398_FT00000_P-B Feature FT:source KC774398_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa1202). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggccctatactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgttattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgctgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacttttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacctcatcgggactgacaattctgtcgtgctttcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacatgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgctactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatattatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggacccagcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccacgggggactgttggggtggagccctcaggctcagggcctattcacaactgtgccagcagct
cctcctcctgccgccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173341_FT00000_P-B Feature FT:source KJ173341_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX003C(e204)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctccgaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggccttcc
taagtaaacagtatctgcacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggagccttcgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcttgttgtaccgaccgactac
ggggcgcacctctctctacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattgaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccttattatcctgagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtctacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaaaccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatattcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX276784_FT00000_P-B Feature FT:source KX276784_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccaccttccaccaaactcttcaagatcccagagtcagggctctatactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgacgactgggggccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactactgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaaaactgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattatacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccctcgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccgtctgacttctttccttctgttcgagatctcctcgacaccg
cttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttgggttgagttaatgaatctagccacctgggtgggaggtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgataatatgggcctaaaaaccagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccascaaatgcccctatctta
tcaacacttccggaaactactgttgttagaggaaggagcagggcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttctttccctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagacttaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagcatgtagtt
gatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacctgcacaaggacaactggccggacgccaaccaggtgggagtgggagcattcgggc
cagggttcacycctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881956_FT00000_P-B Feature FT:source KY881956_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient-08). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccaagttccaccaaactcttcaagatccaagggtcagggctctgtaccttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctctgccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggcgaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaatcctcataaaacaaaacgatggggctactcccttaacttcatgg
gatatgtaattggtagttggggcaccttaccccaggaacatattgtgttgaaaatcaaacaatgttttaggaaacttcct
gtaaacagacctattgattggaaggtgtgtcaacgaattgtgggtcttttggggtttgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagcgagacaggctttcactttctcgccaacttacaaggcctttc
taaacaaacagtatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggctatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatacagcggaact
cctagctgcctgttttgctcgcagccggtctggagcgaaacttatcgggactgacaattctgtcgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttttagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctatccgagaccttctcgacaccg
cctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagcaattctc
tgttgggatgagttaatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactattgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctacggtacctggctttaatcctgaatggcaaactccttcttttcctgacattcatttgca
tgaggacattgttaataggtgtgaacaatttgtgggacccctcacagtaaatgaaaataggagactaaaattgattatgc
ctgctaggttctatcctaaggttactaaatatttgcccttagataaaggaattaaaccttattatccagaacatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatattatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcaaaacctcgaaaaggc
atggggacgaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggatctcaacccacacaaggacaactggccggactccaacaaggtgggagtgggagcattcgggc
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggaaggcagcctactcccctgtctccgcctctaagagacactcatcctca
ggccatgcactggaa
>gnl|hbvnuc|DQ993683_FT00000_P-B Feature FT:source DQ993683_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 82). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
tagtaaaccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctgtgggtatacatttaaaccctcacaaaacaaaaagatggggttattcccttaatttcatgg
gatatgtaattgggagttggggctccttgccacaggaacatattgtacaaaaaatcaaattatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggttcgctgccccttttacacaatgtgg
atatcctgcattaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgtccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgsccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagawtaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgcatca
agaatttggatcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccaggatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacgtttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactccacctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgca
ggaagaccttgttgataggtgtaagcaatttgtgggacccctaacagtaaatgaaaacaggagaataaaattaattatgc
ctgccagattttatcccagtgttaccaaatacttgcccttagataaaggaatcaacccctattatccagagcgtgtggta
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagwcaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacttcaatccacacaaggacaattggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963964_FT00000_P-B Feature FT:source KU963964_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 12_5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
tacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcacctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgcatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtcaacagtatttgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagcaacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaacatgggcctaaaaatcagacaactattgtggtttcatatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggatttattcttctacggtaccctgctttaatcctaaatggcaaactccttcttttcccgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacacctggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcgcaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagccgactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964092_FT00000_P-B Feature FT:source KU964092_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 20_14). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatataattgggagttggggcacattgccacaggaacatattgtaacaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatacggcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaacactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcgctcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgaagaggcaggccccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgagaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
gatcattacttccagacacgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattctgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggaaccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AF121243_FT00000_P-B Feature FT:source AF121243_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/14611). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttt
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtactctcccgcaagt
atacagcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctataccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaraccaccgtgaacgcccccgggaacctgcccaaggtcttgcataagaggactcttggactttcagtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccatattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttgggaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ803801_FT00000_P-B Feature FT:source KJ803801_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY035746). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactctgctagatcccagagtcagggccctgtactttcctgctggtggctccagttccggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaatacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggcaactgcacctgtattcccatcccatcatctttggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaatccgcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgcctcaggaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctctaatgcctttgtatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagcaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtactctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctataccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgctagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgcacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggacattatcaacagatgtcaacaatatgtgggtcctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctagattttatcccaatgttactaaatatttgcccttagataaagggatcaaagcttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacccgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgaccatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagctttcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MG571352_FT00000_P-B Feature FT:source MG571352_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 25179). Complete genome. [Hepadnaviridae] (length=3215 residues).
cgccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
cagtgagccctgctcagaatactgtctctgtcatatcgtcaaccttatcgacgactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgccttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttggggtttcgcaaaattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatattgatgatatggtattggggaccaaatctgtacaacatcttgagtccgtttctgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggggttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtaaccagtatctgaacctttaccccgttgctcggcaacggtctggcctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacctcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctcccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagtcgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacacgtataa
agaatttggagcttctgtggagttgctctcttttttgcctgctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctcctgaacattgtacagctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtaggaagcaatttggaagatccaggatccagggaattagtagtcac
ctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaag
ttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttattagacgaagaagcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctccatgttaatattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaaaaggagactaaaattaattatgc
ctgctaggttttaccccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacaagacattatttacatactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttcggggatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaagacaactggccggacgcccacaaggtgggagtgggagcattcgggc
cagggttcacccctccccat