HBVdb

Dataset for nucleotide sequence Genomes of genotype B

[Download (right click)] [Alignment] [Repertoires]

1755 sequence(s)

>gnl|hbvnuc|AB073825_FT00000_P-B Feature FT:source AB073825_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi51). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaacgcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccargtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacaaaaaatcaaaacatgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggccttcc
tccgtaaacagtatctgaacctttaccccgttgctcggcaacggactggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgttccgaccatccac
ggggcgcacctctctttacgaggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttgcataacaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgcatcgggaggccttagagtctcccgaacattgtacagctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacctgtcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgcatatagaccagcaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactcctgcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggaggctaaaattaattatgc
ctgctaggttttatcccaatgttacaaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagaccacacatag
cgcctcattctgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgcaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcactcctccccatggaggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcngtcaggaaggcagcctacgcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB073835_FT00000_P-B Feature FT:source AB073835_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Vi29). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
tagtaaaccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattggtagttggggttccttgccacaggaacatattgtacaaaaaatcaaattatgttttaggaaacttcct
gtaaacaggcctattgatgggaaagtatgtcaacgaattgtgggtcttctggggttcgctgccccttttacacaatgtgg
atatcccgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaattctgtcgtgctgtcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttacggagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctgttcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgca
ggaagacattgttgataggtgtaagcaatttgtaggacccctaacagtaaatgaaatcaggagactaaaattaataatgc
ctgctagattttatcccaaggttaccaaatacttgcccttagataaaggaatcaaaccctattatcccgagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagwcaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacttcaatccacacaaggacaattggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB073843_FT00000_P-B Feature FT:source AB073843_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Iw27). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagcaagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagacttgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcaagacctgcaccactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaartctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattatacaaaaaatcaaagtatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgctgccccttttacgcaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattctgtagtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgtttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgcccaaggtcttgyataagaggactcttggacttttagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtcggtgcgagacctcctagataccg
ctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacatcaccacacagcactcaggcaagctattctg
tgctggggggaattaacgactctaggtacctgggtgggtaataatttacaagatccagcgtccagggatctagtagtcaa
ttatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtatcccttggactcataaggtgggaaac
tttacggggctctattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttccagacattcatttaca
ggaggacattgttgatagatgtaagcaatttgtgggacccctcacagtaaatgaaaacaggagactaaaattaataatgc
ctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatccagataatgtagtt
aatcattacttccagacgagacattatttgcatactctttggaaggcgggtatcttatataaaagagagtcaacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgaccatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacatctgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttgtctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB205122_FT00000_P-B Feature FT:source AB205122_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-VH69-1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcagaaa
cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtttcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcccgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctcctggtatacatttaaaccctcacaaaacaaaaagatggggatattctcttaatttcatgg
gatatgtaattgggggttggggttccttgccacaggaacatattgtacaaaaaatcaaattgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaagactcttc
tgagtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
acacatcgtttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacggccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
acctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctacggagttactctcttttttaccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtggtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttgttgaatatttggtgtcttttggagtgtggattcgcactcctactccatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcacaaggtgggaaac
tttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgca
ggaagacattattgataggtgtcagcaatttgtgggacccctaacagtaaatgaaatcaggagattaaaattaattatgc
ctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatcccgagcatgtagtg
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgaccatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccacacaaggacaattggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagggacactcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|AB287315_FT00000_P-B Feature FT:source AB287315_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska419). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctccagttcaggag
cagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggcacattacctcaagaacacataatgtcaaaaatcaaacaatgttttagaaaacttcct
gtaaaccgacccattgattggaaggtgtgtcaacgaattgtgggtcttttgggatttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttataaggcctttc
taaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggcacctttgtgtctcctctggcgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaacctcatcgggactgacaattcggttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaatgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctctttcttgccttctgacttctttccgtcggttcgagatctcctagacaccg
cagctgctttgtatcgggaagccttagagtctcctgaacattgctctcctcaccatacagcactcaggcaagctattttg
tgctggggggaattaatgactctagctacctgggtgggtaataatttagaagatccagcatccagagacctagtagttaa
ttatgttaacactaacatgggactaaagatcaggcaattattgtggtttcacatttcctgtcttacctttggaagagaaa
ctgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctctattcttctacggtacctatctttaatcctgaatggcaaactccttcttttcctaacatacatttgca
ggagaacattattgataggtgtaaacaatttgtgggacccctcacagtaaatgaaaacaggagactaaaattgatcatgc
ctgctaggttttatcctaatactactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagaaacaacgcgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
caacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagcgggagcattcgggc
cgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatactcacatctctgccagcagct
cctcctcctacctccaccaatcggcaggtaggaaggcagcctactcccctttctccacctctaagagacactcatcctca
agccatgcagtggaa
>gnl|hbvnuc|AB287319_FT00000_P-B Feature FT:source AB287319_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AlaskaG23). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggag
cagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggcacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtccacaaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaatcctcataaaacaaaacgttgggggtactcccttcactttatgg
gatatgtaattggaagttggggcacattacctcaagaacacatcgtgtcaaaaatcaaacaatgttttagaaaacttcct
gtaaacaggcctattgattggaaggtgtgtcaacgcattgtgggtcttttgggatttgctgccccttttacacaatgtgg
gtatccagctttaatgcctttatatgcatgtatacaagctaaacaggcttttacgttctcgccaacttataaggcctttc
taaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttttgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattcggttgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcatctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaatgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctctttcttgccttctgacttctttccgtcggtgcgagatctcctagacaccg
cctctgctctgtatcgggaagccttagagtctcctgaacattgctcgcctcaccatacagcaatcaggcaagctattttg
tgctggggggaattaatgactctagctacctgggtgggtagtaatttagacgatccagcatccagagacctagtagtcaa
ttatgtcaacattaacatgggactaaagatcaggcaattattgtggtttcacctttcctgtattacctttgggagagata
ctgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccgtggactcataaggtgggaaac
tttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttccaaacatacatttgca
ggaaaacattattgataggtgtaaacaatttgtgggacccctcacagcaaatgaaaacaggagactaaaattaatcatgc
ctgctaggttttatcctaatactactaaatattttcctttagataaaggaattaaaccttattatccagagcaagtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataagagagaaacaacgcgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttccaaaccacgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgccttcaaagccaactc
cgacaatccagactgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatactcacatctctgccagcagct
cctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctttctccacctctaagagacactcatcctca
agccatgcagtggaa
>gnl|hbvnuc|AB287320_FT00000_P-B Feature FT:source AB287320_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcgacgactggggaccctgtaccgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatctgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggtgcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataagacaaaacgttggggttactcccttaacttcatgg
gatatgtaattggcagttggggcacattacctcaagaacacatcgtatcaaaaatcaaacaatgttttagaaaacttcct
gtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttgggatttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctttatatgcatgtatacaggctaaacaggcttttactttctcaccaacttataaggcctttc
tgaacaaacaatatctgaccctttaccccgttgctcggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatgggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgacaattcggttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgcccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcacctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccgaggtcttacataagaggactcttggactttcagcaa
tgtcaatgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacttataa
agaatttggagcttctgtggagttactctctttcctgccttctgacttctttccgtcggttcgagatctcctagacaccg
ccactgctttgtatcgggaagccttagagtctcctgaacattgctcggctcaccatacagcactcaggcaagctattgtg
tgctggggggaattaacgaccctaggtacctgggtgggtaataatttacaagatccagcatccagagaccaagtagtcaa
ttatgttaacactaacatgggactaaagattagacaattattgtggtttcatatttcctgtattacctttggaagagaaa
ctgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttccaaacatacatttgca
ggagaacattattgataggtgtaaacaatttgtgggacccctcacagtaaatgaaaacaggagactaaaattgatcatgc
ctgctaggttttatcctaatactactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcaggtatcttatataaaagagaaactacacgtag
tgcctcattctgtgggtcaccctattcgtgggaacaagagctacatcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatccagattgggacctcaacccacacaaggacaactggccagacgccaacaaggtgggagtgggagcattcgggc
cgggattcactcctccccacgggggattattggggtggagcccccaggctcagggcatactgacatctttgccagcagct
cctcctcctgcctccaccaatcggcaggtggggaggcggcctacgcccatttctccacctctaagagacactcatcctca
agccatgcagtggaa
>gnl|hbvnuc|AB287321_FT00000_P-B Feature FT:source AB287321_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagtttaggaa
cagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
aaatctccaatcactcaccaacctgttgtcctccaatctgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtaggtctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaagccctttataccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctcataaaacaaaacgttggggttactcccttaacttcatgg
gatatgaaattggcagttggggtacattacctcaagaacacatcgtgtcaaaaatcaaacaatgttttagaaaacttcct
gtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggatttgctgcaccttttacacaatgtgg
gtatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcaccaacttataaggcctttc
taaacaaacagtatctgaacctttaccccgttgctcggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcgaaactcatcgggactgacaattcggttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccacttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcacctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccgaggtcttacataagaggactcttggactttcagcaa
tgtcaatgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctctttcttgcctgctgacttctatccgtcggttcgagatctcctagataccg
ccgctgctttgtatcgggaagccttagagtctcctgaacattgctcgccccatcatacagcactcaggcaagctatttta
tgctgggtggaattaatgactctagctacctgggtgggtaataatttagaagatccagcatccagagacctagtagtcaa
ttatgttaacactaacatgggactaaagatcagacaattattgtggtttcacatttcctgtcttacctttggaagagaga
ctgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactgctattattagacgacgaggcaggagccctagaagaagaactccctcgcctcgcagacccag
atctcaatcaccgcgtcgcagaagatctcaatctcggggaccccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcctaacattcatttgca
ggaggatattattgataggtgtacacaatttgtgggacccctcacaccaaatgagaacaggagactgaaaatgatcatgc
ctgctaggttttatcctaatgctactaaatatttgcccttggataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagaaactacgcgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtctgccaaacctcgaaaaggc
atggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatccagattgggacctcaacccacacaaggacaactggccagacgccaacaaggtgggagtgggagcattcgggc
cgggattcactcctccccatgggggattattggggtggagccctcaggctcagggcatactcacctctctgccagcagct
cctcctcctgcctccaccaatcggcaggtaggaaggctgcctactcccctttctccacctctaagagacactcatcctca
agccatgcagtggaa
>gnl|hbvnuc|AB368295_FT00000_P-B Feature FT:source AB368295_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatccccgagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctcacaaaacaaaacgatggggatattcccttaatttcatgg
gatatgtaattggtagttggggctccttgccacaggaacatattgtacaaaaaatcaaatcatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgtattgtgggtcttttggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
tgagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctccgctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagctaagctcatcgggaccgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctatcgtccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctattcgagatcttctcgacaccg
ccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctgttgtg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctacgtcaatgttaatatgggcctaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctaactttaattctgattggcaagctccttcctttcctgacattcatttgca
ggaggacattgttaataggtgtaagcaatttgtgggacccctaacaaaaaatgaaaacaggagactaaaattaattatgc
ctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcacgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccacacaaggacaattggccggacgccaacaaggtgggagtgggagcatttgggc
cagggttcattcctccccatgggggcctgttggggtggagccctcaggctcagggcatactcgcaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtccggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB642101_FT00000_P-B Feature FT:source AB642101_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BFJT2009-1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccataactttccaccaaactcttcaagatcccaaagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttcgaggggaagcacccgtgtgtcctggccaaaattcgcagtccc
aaatctccagtcactcactaacctgctgtccaccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttgggtcttctggactaccacggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaactaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtttgtcaacgaattgtgggtcttttggggtttgctgccccttttacgcaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatttgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacttcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtwccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagaygaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgaccattataa
agaatttggagcttctgtggagttactctcttttttgcctcaggacttctatccgtcggtgcgggatctcctcgataccg
ctgctgctctctatcgggaagccttagaatctcctgaacattgctcacctcaccacacagcactcaggcaagctattctg
tgctggggggaattaatgactctagctacctgggtgggtaataatttacaagatccagcatccagggatctagtagtcaa
ttatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctgtcttacttttggaagagata
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctagggaaccccaatgttagtatcccttggactcatagggtgggaaac
tttactgggctttattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcccgacattcatttgca
ggagaacattgttgatagatgtcagcaatttgtgggaccacttacagtaaatgaaaacaggagactaaaattaataatgc
ctgctagattttatcctaaggttaccaaatatttgccactagataaagggataaaaccgtattatccagagcatgtagtt
aatcattacttccagacgagacattatttgcatactctttggaaggcgggtatcttatataagagagagtcaacacatag
cgcctcattttatgggtcaccatattcttgggaacaagatctacagcatgggaggttcgtattccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctaaatccgcacaaggacaactggccggacgcccacaaggtgggagtgggagcatttgggc
cagggttcacccctccccatgggggactggtggggtggagccctcaggctcagggcatactcacatcggtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcggtggaa
>gnl|hbvnuc|AB713527_FT00000_P-B Feature FT:source AB713527_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv30). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatccccgagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagattggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcatggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
tacccattttcttttgtctttgggtatacatctaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatgtaattggaagttggggcaccttgccccaggaacatattgtgttgaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttaggatttgctgctcctttcacacaatgtgg
ttatcctgctttgatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttattgggactgacaattcccttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaacgtgtgcacttcgcttcacttctgc
acgtcgcaaggagaacaccgtgaacgcccaccggaacttgccccaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatctagctacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctagctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttaataggtgtaaacaatttgtgggacccctcacagtgaatgaaaacaggagactaaaattgattatgc
ctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacaagacattatttacatactctttggaaggcgggtattttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtccgccaaacctcgacaaggc
atggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagtgggagcattcgggc
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcaggtaggaaggaagcctactcccctctctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB900105_FT00000_P-B Feature FT:source AB900105_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctccagttcagaaa
cagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcgacgactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtgcc
aaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcrctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggatcatattgtacaaaaaatcaaactatgttttagaaaacttcct
gtaaacaggcctattgattggaaagtttgtcaacgaattgtgggtcttttggggtttgctgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgcatacaagcaaaacaggcttttactttttcgccaacttacaaggcctttc
taagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtccccgctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacagcatttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgttgagttactctcttttttgcctgctgacttctttccgtcggtgcgagacctcctagataccg
ctgctgctctgtatcgggaagccttagaatctcctgaacattgctcagctcaccatacagcaatcaggcaagctattctg
tgctggggagaattaatgactctagcttcctgggtgggtaataatttacaagatccagcgtccagggatctagtagtcaa
ttatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctgtattacttttggaagagata
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtatcccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttccagacattcatttgca
ggaagacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagactaaaattaataatgc
ctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacaagacattatttgcatactctttggaaggcgggtatcttatataaaagagaatcaacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggaataggagcattcggac
ccgggttcacccctccccatgggggactattggggtggagccctcaggctcagggcatactcacatctgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttatctccacctctaagggacacccatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY167101_FT00000_P-B Feature FT:source AY167101_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vb). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttctctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattggctgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaactccct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacgggcttttactttctcgcccacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctctcgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatagggaggccttagagtctccggaacattgttcagctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctggaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccctgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacactatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcaaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattctttcccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY766463_FT00000_P-B Feature FT:source AY766463_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggcactatactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctcc
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcaccttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
cgtctggctttcagttatatggatgatgtggttttggggaccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taggtaaacagtatatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccaaccgaccac
ggggcgcacctctccttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcacaagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgcgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcatgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctcacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaagttaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaggggatcaaaccatattatccagagcatgtagtt
aatcattacttccagacaagacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcaaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
tagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcgggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ448624_FT00000_P-B Feature FT:source DQ448624_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-QSA). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctttcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
attccatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
catctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaat
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ448626_FT00000_P-B Feature FT:source DQ448626_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-XLB). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgcgttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tcagtaaacagtatctaaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggggaattgatgaatctagccacctgggtgggaagtaatttggaagatccatcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctgggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaaatgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ448627_FT00000_P-B Feature FT:source DQ448627_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-ZFL). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagtaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattatacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatacgcatgtatacaagccaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttatttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaatgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaactcgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggccaactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ993701_FT00000_P-B Feature FT:source DQ993701_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JMY-0210-ETCvs3TC-Brack). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttgtgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtctcttggggtttgccgcccctttcacgcaatgtgg
atatcctgcattaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgcaaacagtatctgcacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
acacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgacaac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatatgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctcggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttgggaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggatctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ993708_FT00000_P-B Feature FT:source DQ993708_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6136-1228-Naive). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggggttggggcacattgccacaggaacacattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgcgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaccaatatctgaacctttaccccgttgttcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccaaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattccagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggcccctgacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttaccaaatatttccccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgaaaggttggtcttccaaacctcgaaaaggc
atggggacaaatctgtctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcagcccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
caggattcacccctccccatgggggcctgttggggtggaaccctcaggctcagggcctactcccaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcagaaaggcaacctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU306699_FT00000_P-B Feature FT:source EU306699_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcatcaacaaccagcaccggaccatgcagaaccagcacaactcttgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcggtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctcccagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctcacaaaacaaaaagatggggatattccctcaacttcatgg
gatatgtaattgggagttggggcacattaccacaagaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcacctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagccaaacaggcttttactttctcgccaacgtacaaggcctttc
taagtaaacagtatctgaacctgtaccccgttgcacggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgcccgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacttgcccaaggtctggcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatactttaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atcacatgttcatgtcctactgttcaagcctccaagctgtgcctggggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatttcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgtgttgatgaatctagccacctgggtgggaagtaatttggaaaatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU881998_FT00000_P-B Feature FT:source EU881998_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient18). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaacaggcctattgattggaaagtctgtcaacgaatcgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacaatatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgcccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaatgaccgaccttgaggcatacttcaaagactgtgtgtttacggagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaacttttttacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgatattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaagccggagactaaaattaattatgc
ctgctaggttctatcccaatcttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
gatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggacttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgccgccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU919173_FT00000_P-B Feature FT:source EU919173_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient30). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcactaacctgttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctcacaaaacaaaaagatggggttattcccttaacttcatgg
gatatgtaatcgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgctttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcctgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcattcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctatggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgagaagccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctgttctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcctttggagtgtggattcgcactccttctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccttatctccacctctaagggacactcatcctca
ggccatacagtggaa
>gnl|hbvnuc|EU919176_FT00000_P-B Feature FT:source EU919176_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient34). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttgtcctct
aattccaggatcttcgacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccccaggaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaacctcatcgggactgacaattctgtcgtgctctcacgcaagt
atacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgacccctggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgaatgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctactattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacggcaatcaggcaagctattctc
tgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaatattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgaa
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaaagttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacgcgtag
cgcctcattttacgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctgtctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU939673_FT00000_P-B Feature FT:source EU939673_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C219). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggccctgtattttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaagacatgcacatctcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacaatatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtactctcccgcaagt
atacgtcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactgtcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttacgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccgaacgccaacaaggtgggagtgggagcattcgggc
cagggttcaccccgccccatgggggactgttggggtggagccctcaggctcaaggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ358137_FT00000_P-B Feature FT:source GQ358137_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LBY001). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtacttccctgctggtggctccagttcaggaa
cagtgaaccctgttcagaccactgcctcttccatatcgacaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
tacccattttcttttgtctctgggtatacatttaaacccgcataaaacaaaacgttggggctactcccttaacttcatgg
ggtatgtaattggaagttggggtaccttaccccaagaacatattgcattgaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctctaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttataaggcctttc
taaacaaacaatatctgaacctttaccccgttgcgcggcaacggccaggtctatgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgacaactctgttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcccctctgcctaaac
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggccttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacacag
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagaagaag
gtatcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctcgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacatcgttaataggtgtaaacaatttgtgggacccctcacagtgaatgaaactaggagactaaaattgatcatgc
ctgcaaggttttatcctaatgttactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtggtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcgaaaaggc
atggggacaaatctttcagtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagtgggagcattcgggc
cgggattcactcccccccatgggggactgttggggtggagccctcaagctcagggcatactcacaactgtgccaacagct
cctcctcctgcctctaccaatcggcagttaggaaggaagcctactcccctgtctccacctctaagagacactcaccctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ358152_FT00000_P-B Feature FT:source GQ358152_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAN037). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagaccccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaaaccctgttcagaacactgcatcttccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
gatatgtaattggaagttggggcacattaccccaggaacatattgtgtcaaaaatcaaacaatgtttcaggaaacttcct
gcaaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctttaatgccgttatatgcatgtatacaagctaaacaggcgtttaccttctcgccaacttacaaggcctttc
taaacaaacagtatctgaacctttaccccgttgctcgacaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggactgacaattctgtcgtcctttcccgtaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgttctaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagaccttctcgacaccg
cctcagctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaga
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctgactttaatcctaagtggcaaactccttctttccctgacattcatttgca
ggaggacattgttgatagatgtaaacaatttgtgggacccctcacagtaaatgaaaacaggagactaaaattgatcatgc
ctgctagattctatcctaatgttactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcaaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggatcctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagtgggagcattcggga
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatgctcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggaaggcagcctactcccctgtctccacctctaagagactctcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377525_FT00000_P-B Feature FT:source GQ377525_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J24). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaagccaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcctgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcac
tgtcaacgaccgatcttgaggcatacttcaaagactgtgtgtatactgagtgggacgagttgggggaggaggttaggtta
atgatctatgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatcttctcgacaccg
cctctgctctccatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcccgcatccagggaattagtagttag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttccggacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacctgcacaaggacaactggccagacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccctatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ924610_FT00000_P-B Feature FT:source GQ924610_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M19). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaagaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcagaact
tctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtagtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccggtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccctcttttcctaacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ924634_FT00000_P-B Feature FT:source GQ924634_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M57). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaatatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccgggccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgcctcaggaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgacttgtggggcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctctaatgcctttatatgcaagtatacaagcaaaacaggcttttactttttcgccaacttacaaggcctttc
tacgcaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggctataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagagaactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattttg
tgttggggtgaattgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaacttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgaccatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccgaacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggaaccctcaggctcagggcatgctcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ924635_FT00000_P-B Feature FT:source GQ924635_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M67). Complete genome. [Hepadnaviridae] (length=3197 residues).
ctccaccacgttccaccaaactcttcaagatccaagagtcagagctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatattgtcaatcttgtcgaagactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccatttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttcacttcatgg
gatatgtaattggaagttggggcaccttaccccaggaacatattgtgatgaaaatcaaacaatgttttaggaaacttcct
gtaaacagacctattgattggaaggtgtgtcaacgaattgtaggtcttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcttttt
tgagcaaacagtatctgcacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggactgacaattctgtcgtactttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgaatgggaggagctgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccaacaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttccgtggagttactctcttttttgcctactgacttctttccttctgttcgagatctgctcgacaccg
cctctgctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagaccccgcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcataaaactcagacaactattgtggtttcacatttcctgtattacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcaggcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacaaggaagcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatttcaatgtcgggaatgtcaatgttagtattctttggagacataaggggcgaaac
tttacggggctttattcttctacggtacctatctttaatcctgaatggcaaactccttcttttcctgacatccatttgca
ggaggacattgttgatagatgtaaacaatttgtgggacccctcacagtaaatgaaaacaggagactaaaattgatcatgc
cctccaggttctatcccaaagttactaaatatttgcccttagataaaggtattaaaccttattatccagagcacgtagtt
aatcattacttccagaccagacattatttacatactctttggaaggcaggtatcttatataaaagagagacaacgcgtag
cgcctcattctgcgggtcaccatattcttgggaacaggagatacagcaaaactcgaaaaggcatggggacaaatctttct
gtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaacaccgacaatcccgattggga
tctcaacccacacaaggacaactggccggactccaacaaggtgggagcgggagcattcgggtcgggattcactccacccc
atgggggactgttggggtggagccctcaagctcagggcatactcacaactgtgccagcagctcctcctcctgcctccacc
aatcggcaggtaggaaggcagcctactcccctgtctctacctctaagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ924637_FT00000_P-B Feature FT:source GQ924637_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M69). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccaagttccaccaaactcttcaagatcctcgagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctctcccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccctgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
tacccattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
gatatgtaattggaagttggggcaccttaccccaggaacatattgtgtcaaaaatcaaacaatgttttcggaaacttcct
gtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttggggtttgctgctcctttcacacaatgtgg
ttatcctgctctgatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttataaggcctttc
taaacgaacaatatctgaacctttaccccgttgcacggcaacggtctggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggtcatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgacaattccgttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgcggtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaccttgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgatcgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacatctataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatcttcttgacaccg
cctccgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatactgcgctcaggcaagctattgtg
tgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagacccagcatccagggatttagtagtcag
ctatgtcaatgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctgtattacttttggaagagaaa
ttgttcttgaatatttggtctctttcggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacgcttccggaaactgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctagctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacatcattaataggtgtaaacaatttgtgggacccctcacagtgaatgaaaacaggagactaaaattgattatgc
ctgctagattctatcctaatgttactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtattttatataaaagagagacaacacgtag
cgcttcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcgaaaaggc
atggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cgggattcactccaccacatgggggactgttggggtggagccctcaagctcagggcatactcacacctgtgccagcagct
cctcctcctgcctccaccaatcggcaggtaggaaggaagcctactcccctgactccacctctaagagacacccatcctct
ggccatgcagtggaa
>gnl|hbvnuc|GU357842_FT00000_P-B Feature FT:source GU357842_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C4371). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatattatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaaactctacgtttccct
catgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttctgttgtctttgggtatacagttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggggttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgctttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacaatatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgtggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttcgacggtaccttgctttaatactaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaaaaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgaaacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atgaggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggatcctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggaaccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggagggcagcctactcccttatctccaccgctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815567_FT00000_P-B Feature FT:source GU815567_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggccccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacagcaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctacttacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815613_FT00000_P-B Feature FT:source GU815613_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccaatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttccggatattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcctttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacaagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccttgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtaggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815680_FT00000_P-B Feature FT:source GU815680_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagttgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatattatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcaaggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815683_FT00000_P-B Feature FT:source GU815683_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggtctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaacaccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatattatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcaaggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815702_FT00000_P-B Feature FT:source GU815702_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttatctttgggtatccatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaactgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatattatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcaaggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815704_FT00000_P-B Feature FT:source GU815704_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagataaggtca
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatattatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcaaggcatactcacaactgtaccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815715_FT00000_P-B Feature FT:source GU815715_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctagggcccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgcctcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcgtttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgctactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815718_FT00000_P-B Feature FT:source GU815718_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggaccatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgcctcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgctactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815723_FT00000_P-B Feature FT:source GU815723_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccagaatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgcctcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacgggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccgaaacctgcccaaggtcttgcatcagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgctactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815761_FT00000_P-B Feature FT:source GU815761_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggccttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgttgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctctattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctaacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcaaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattcctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815772_FT00000_P-B Feature FT:source GU815772_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggacacctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggtctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggggttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaacggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctctattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctaacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcaaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattcctccccatgggggactgttggggtggagccctcaggctcagggcacactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccgtatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815780_FT00000_P-B Feature FT:source GU815780_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggggttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgcgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaacggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccatcaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctctattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctaacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcctttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcaaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattcctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815781_FT00000_P-B Feature FT:source GU815781_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggacacctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaatcgggggttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaacggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctctattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctaacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcaaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattcctccccatgggggactgttggggtggagccctcaggctcagggcacactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccgtatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HM011483_FT00000_P-B Feature FT:source HM011483_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgccctggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttggggrccaagtctgtacaacatcttgagtccstttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggggttggggtacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtaggtcttttggggtttgccgcccctttyacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tamgtmaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttacggagtgggaggagttgggggaggaggktaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgcctyttgayttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacatcaccatacggcactcaggcaagccattctg
tgttggggtgagttaatgaatctagccacctgggtgggargtaatttgcaagatcmascatccagggamtyagtagtcaa
ctatgtcaacgttaatatgggcmtaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggmrakmaa
ctgttcttgaatwtttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacmaaatgcccctatctta
tcaacacttccggaaactgctgttgttagacgaagakgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgytagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctamatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaaggttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccccgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccgracgccaacaaggtgggagtgggagcattcgggc
ccgggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcaccctca
ggycatgcagtggaa
>gnl|hbvnuc|JQ027325_FT00000_P-B Feature FT:source JQ027325_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccwaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtragccctgctcagartactgtctctgccacatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatckcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagacttgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccct
catgttgctgtacgaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggagcctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacatcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtggttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccccgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgyggagttactctcttttttgccttctgacttttttccttccattcgagatctcctcgacaccg
ccactgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaggtaatttggaagatcaagcatccagggacttagtagtcgg
ctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttgggaargaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaaggttactaaatatttgcccttagataaagggatcaaaccatattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcagggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggtgtgtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgcgtggaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcggct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatacagtggaa
>gnl|hbvnuc|JQ040170_FT00000_P-B Feature FT:source JQ040170_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G238). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaawataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaagaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggcaatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctctcgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactkwcaccaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagtwgggggaggaggttaggtwa
aaggtcttkgtrctaggaggctgtatgcatawattggtgtgtwcaccascaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaggccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JX504543_FT00000_P-B Feature FT:source JX504543_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-NNJ-19). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccatcactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcataatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacccgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcgtcatgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgcagcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcctgtatacaggcgaaacaggctttcactttctcgccaacttacaaggcctttc
tgcgtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgccttgcgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctaatattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatcccgggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatttttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcgacacttccggaaactactgttattagacgaagaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtgccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttacgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggacccggcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcatttgggc
caggattcacccctccccatgggggactgttggggtggagccctcaagctcagggcctactcacaactatgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
tgccatgcaggggat
>gnl|hbvnuc|JX661483_FT00000_P-B Feature FT:source JX661483_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1205-B3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacgttgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacgtacaaggccttcc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcgtgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtagtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccacttctccgcctgttgtaccgaccgactac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagatgaggtta
aaggtctgtgtactaggaggctgctgctatgaacgggtctgttcaccagcaccatgcaactttttcacgttagcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JX661484_FT00000_P-B Feature FT:source JX661484_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1206-B4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccagactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtaccgaatatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaacccacacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtgattgggagctggggtacattgccacaagaacatattgtgcaaaaaatcaaactgtgttttagaaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaacctcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgtacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggcgaccaccgtgaacgcccaccgaaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagcttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagctccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttaccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
ttcacggggctttattcttctacggtacctggctttaatcctaaatggcaaactccttctttccctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggcccctcacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggattgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774373_FT00000_P-B Feature FT:source KC774373_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bur1044). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctctaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agacaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatggggggctgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774377_FT00000_P-B Feature FT:source KC774377_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bur1064). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggggttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgcagcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacaatatctgaacctttaccccgttgttcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcctgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttacataagaggactcttggactttcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgccttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactaaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaataggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatcccgagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccacgggggactgttggggtggggccctcaggctcagggcctacttacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttttctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774388_FT00000_P-B Feature FT:source KC774388_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bww1116). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacttttcaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacgaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcgaaacgggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcatctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgatattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacagaagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774396_FT00000_P-B Feature FT:source KC774396_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa1182). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccagactcttcaagatcccagagtcagggccctatattttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaacccgcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaaacaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcatcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaagatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtcagcaatttgtggggccccttacagtaaatgaaaaaaggagacttaaattaattatgc
ctgctaggttttatccaaatgttactaaatatttgcccttagataaagggataaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttgggttggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774401_FT00000_P-B Feature FT:source KC774401_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa1663). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaactttatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgcgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcggcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccgccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgccattagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaagacaactggccggacgccaacaaggtgggagtgggagcattcggga
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagagacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173356_FT00000_P-B Feature FT:source KJ173356_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX032M(e248n)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggccttcc
taagtaaacagtatctgcacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggagccttcgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcttgttgtaccgaccgactac
ggggcgcacctctctctacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcgcctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
aaaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcaaggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173359_FT00000_P-B Feature FT:source KJ173359_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate NB161C(m162)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtattttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatmggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgagcaatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgccattagataaaggaatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagcccgcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173402_FT00000_P-B Feature FT:source KJ173402_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N09-C(3733B)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtatcggccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccacaagcaccgggccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaatcctcataaaacaaaaagatggggctactctctcaacttcatgg
gatatgtaattggaagttggggcaccttaccccaagaacatattgtgttgaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctttgatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
tacacaaacagtatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcggcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagctgcctgttttgctcgcagcaggtctggagcaacacttatcggaaccgacaattctgtcgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcagacgatccctcccggggccgcttggggctctaccgaccgcttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccgcggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagcaattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
cggttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctacggtacctggctttaatcctgaatggcaaactccttcttttcccgacattcatttgca
ggaggacattgttaataggtgtaaacaatttgtgggacccctcacagtaaatgaaaacaggagactaaaattgatcatgc
ctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaattaaaccgtattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagggagtcaacacgtag
cgcctcattctgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctctctgtccccaatcccctgggattcttccccgatcatcagttggatcctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacacctggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173405_FT00000_P-B Feature FT:source KJ173405_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N11-M(6642A)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagctggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
gctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgttgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcttgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggatctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
caggattcacccccccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173409_FT00000_P-B Feature FT:source KJ173409_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N14-M(6692A)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacacaaaatcaaaatgtgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgttaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgatattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173416_FT00000_P-B Feature FT:source KJ173416_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N201M(e401)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactctgcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaccatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgctgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaaatcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccggcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcctctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgtgaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgataaatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacttcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggtctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ803786_FT00000_P-B Feature FT:source KJ803786_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY846440). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggccctatactttcctgctggtggctccagttcaggaa
cagtaaaccctgttcagaacactgcctctcccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggcgaagactgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcagaaaacaaaaagatggggctactcccttaacttcatgg
ggtatgtaattggaagttggggcaccttaccccaagaacatattctgttgaaaatcaaacaatgttttagaaaacttcct
gaaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttttcgccaacgtacaaggcctttc
tgaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggactgacaattctgtcgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccattggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagttcaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagttgtgccttgggtggctttagggcatggacattgacccgtataa
ggaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccaggatccagggaattagtagtcaa
ctatgtcaacgttaatatgggcctaaaaatgagacaactattgtggtttcacatttcctgttttacttttggaagagaga
ctgttctggagtatttggtgtcttttggagtgtggattcgcacacccactgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctagctttaatcctaaatggcaaactccttcctttcctgacattcatttgca
ggaggacatcattgataggtgtaaacaatttgtgggaccccttacagtgaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttacccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggctggcattcggtataagagagaaactacacgcag
cgcttcatttggggtttctctctattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcgaaaaggc
atggggacaaatctttccgtccccaatcctctgggattctttcccgagcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggactccgacaaggtgggagtgggagcattcgggc
cgggagtcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaactgtgccaacagct
cctcctcctgcctccaccaatcggcagttaggaaggaagcctacgcccctgtctccacctctaagagacactcatcctca
ggcaatgcagtggaa
>gnl|hbvnuc|KJ803805_FT00000_P-B Feature FT:source KJ803805_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY491666). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctctcccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttcgaggggtcccacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagccccggaccatgcaaaacctgcacaactcctgctcaaggaacctctacgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattccctaaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaactgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttttcgccaacttacaaggcctttc
tgagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggagggggatgagtta
atgatctttgtactaggaggctgtaggcataaagtggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctatggacttaatctcttttttgccttctgacttctttcctaatattcgagatctcctcgacaccg
cttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaacctagcaacctgggtgggaagtaatttggacgatcaagcatccagggacttagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tcaacacttccggaaacttgtgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
cagctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgaccatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcggct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148326_FT00000_P-B Feature FT:source KP148326_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-27). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccacatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aatatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctttgccgatccataccgcggaact
cctagccgcttgttttgctcgcagccggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggggcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctatcctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaactggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagacaaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactaacaaatgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148347_FT00000_P-B Feature FT:source KP148347_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-24). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagctggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttagggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcacaacaggcttttactttctcgccaacttacaaggccttcc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgactac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaagcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148377_FT00000_P-B Feature FT:source KP148377_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactacctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaatatggag
aacatcacatcaggactcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcgaccaccagcaccggaccatgcagaacctgcacgacccctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgcctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatattattggaagttggggcaccttaccccaggaacatattgtattgaaaatcaaacaatgttttagaaaacttcct
gtaaacagacctattgattggaaggtgtgtcaacgaattgtgggacttttgggattcgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttataaggcctttc
tgaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctttgccgatccatacggcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcgaaacttatcgggacagacaattctgttgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttcaccgtctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattttg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgcatggcaaactccttcttttcctgacattcatttaca
ggaggacattgttaataggtgtaaacaatttgtgggacccctcacagtgaatgaaaacaggagactaaaattgatcatgc
ctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgtggtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatatagaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggattccaacaaggtgggagtgggagcattcgggc
cgggattcgctccaccccatgggggactgttggggtggagtcctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggacggccgcctactcccctatctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148582_FT00000_P-B Feature FT:source KP148582_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Y300-18). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctcggccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcttcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaagcaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacagaaaatcaaaatatgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgctgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggccttcc
tgagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctaccgatccatactgcggaact
cctggccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattattcacctcaccatacggcactcgggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatacgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactcctccttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP659253_FT00000_P-B Feature FT:source KP659253_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Canada-NU817). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgtttcaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggga
cagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggcttccgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctttatgccgctgt
taccaattttctkttgtctttgggtatacatttaaaccctcataaaacaaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggcacattacctcaagaacacatcgtgtctaaaatcaaacactgtttccgaaaacttcct
gtaaacagacctattgattggaaagtgtgtcaacgaattgtgggtcttttgggatttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctttatatgcatgtatccaagctaaacaggcttttactttctcgccaacgtataaggcctttc
taaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgtttcgctcgcagccggtctggagcgaaactcatcgggactgacaattcggttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcmcctctgc
acgtcgcatggagaccaccgtgaacscccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaatgaccgaccttgaggcatacttcaaagactgtgtatttactgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcwtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggarttactctctttcttgcctactgacttctttccgtcggttcgagatctcctagacaccg
cctctgctttgtatcgggaagccttagagtctcctgaacattgctctcctcaccatacagcaatcaggcaagctattttg
tgctggggggaattaatgactctagctaactgggtcggcaataatttacaagatccagcatcaagagacctagtagtcaa
ttatgttaacaataacatgggactaaagatcaggcaattattgtggtttcacatttcctgtcttacctttgggagagaaa
ctgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaatgcttccggaaactgctgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttccactgtacctgtctttaatcctgaatggcaaactccttcttttcctaacatacatttgca
ggaaaacattattaataggtgtgaacaatttgtgggacccctcacrgtaaatgaaaacagaagactaaaattgatcatgc
ctgctaggttttatcctaatactactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctctggaaggcgggtatcttatataaaagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatactcacatctctgccagcagct
cctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctttctccacctctaagagatactcatcctca
agccatgcagtggaa
>gnl|hbvnuc|KT749820_FT00000_P-B Feature FT:source KT749820_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FL22). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccacatcgtcaatctcatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaagaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgtcgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggtcatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacacccactggaacctgcccaaggtcttgtataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagatgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctatccttctattcgagatctcctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacatttttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttaatgaatctagccacctgggtgggcagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaag
ttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatataggccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttaatattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaccaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
gatcattacttccagacgcgacattatttacacattctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttacgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattctttcccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggaaaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcagcctcaaggcctacacacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccgtgcagcggaa
>gnl|hbvnuc|KU963803_FT00000_P-B Feature FT:source KU963803_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1_5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacacgcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggcaattggccatcagcgcatgcgtggcacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
catctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgcg
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattatttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
caggattcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963815_FT00000_P-B Feature FT:source KU963815_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2_2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggcactgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cannnnnnnnnnnnnnncaaccagtaccggaccatgcaaaacctgcacaactcctgttcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttacatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggccttcc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccatccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtctcacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963831_FT00000_P-B Feature FT:source KU963831_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3_4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttctgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctgtgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggtagttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctcccgaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatctagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggggtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
agaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963851_FT00000_P-B Feature FT:source KU963851_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 4_10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcacggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcaccgcaccatacggcactcaggcaagctattctg
tgttggggggagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattggtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccaaacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaattc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963953_FT00000_P-B Feature FT:source KU963953_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 11_9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
accatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaacccacacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagcaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaacactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaaccctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
caggggtcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963954_FT00000_P-B Feature FT:source KU963954_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 11_10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
accatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaacccacacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagcaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaacactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaaccctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964100_FT00000_P-B Feature FT:source KU964100_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 21_8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgaactttcctgctggtggctccagttcaggaa
cagtgatccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatctccttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacaatatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctttcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttatccgcctgttgtaccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacagaaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaagttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacttcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964105_FT00000_P-B Feature FT:source KU964105_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 21_13). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgaactttcctgctggtggctccagttcaggaa
cagtgatccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatctccttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taactaaacaatatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctttcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttatccgcctgttgtaccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacagaaacctgcccaaggtcttgcataaaaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaagttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctaacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacttcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964142_FT00000_P-B Feature FT:source KU964142_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 24_5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcgacgactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaaccctaacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttggggaccaaatctgtacaacaccttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggggttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccgtctgacttctttcctaatattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacatcaccatacggcactcaggcaagctattgtg
tgttggggtgagttaatgagtctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatttttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccgccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggcccctcacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagaaaaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccaaacgcgacattatttacacactctttggaaggcggggatcttatataaaagagaatccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttgggatggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964158_FT00000_P-B Feature FT:source KU964158_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 25_6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcatcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggacacctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcataatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctaccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactgggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctactgacttctttccttccattcgagacctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagttag
ctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
agaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaacgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgtcactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagaatccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964258_FT00000_P-B Feature FT:source KU964258_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 33_2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
tgcctctgcatcctgctgctatgcctcatctgcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgttaccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcacccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
ataccctgctttaatgcctttatatgcatgtatacaagcaaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttctaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccacaggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagcatccagggatttagtagtcgg
ctatgtcaacgttaatatgggcctaaaacttagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaaggggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaaacaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaaggttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgagacattatttacacactctgtggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttacgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964289_FT00000_P-B Feature FT:source KU964289_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 35_3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaacccttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctaggggggacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggctatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggacgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttcacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttt
tacgtaaccagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaacttatcgggactgacaattctgtcgtactctcccgcaagt
acacctcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgccaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtattaggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ccaatgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggacacataaggtgggaaac
ttcgcggggctttattcttctacggtaccttgctttaatcctaactggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtctacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
caggggtcacccccccacatgggggactgttggggtggagcccccaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX276774_FT00000_P-B Feature FT:source KX276774_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3212 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcgcaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgagtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtrtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacmtgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccawmatcttgggstttmgsaaaatyccta
tgggagtgggsctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttayatggatgatstggttttgggggcyaagtctgyrcaacatcttgagtccctttrtaccgctgt
taycaattttctttygtctttggrtatacatttaaacccycacaaaacgaaaagatggggatattcccttaacttcatgg
gayatgtrattgggagttggggcacattgccacaggaacatawtgtacaaaaaatcaaaatgtgttttcggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttamtrcctttatatgcatgtatacargccaaacaggcttttactttctcsccaacttacaaggcctttc
tacgtcamcaatatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggytggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaacy
cctagccgcttgttttgctcgcagcaggyctggrgcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctrctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctccmggggmcgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcac
tgtcaacgaccgrccttgaggcatacwtcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgcgttcaccagcaccctgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgagtggctttgggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctkctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggawgatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcmtaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcgtttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactgctgttgttagaccaagaggcaggtccattagaagaagaactccctcgcctcgcagacgaag
gactcaatcgccgcgtcgcagaagatcttcatctcgggaacctcaatgctagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatccggactggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagattaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttacggggcaccatattcttgggaacaagatctacagcatgggaggttggacttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agatccagattgggatctcaatccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggccag
ggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagctcct
cctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacacacatcctcaagc
catgcagtggaa
>gnl|hbvnuc|KX276783_FT00000_P-B Feature FT:source KX276783_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacmrctttccaccaractcytcaagaycccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggas
aacatcrcatcaggactcctarracccctgctcgtgtyacaggcggggtwtttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactyacyaacctgtygtcctccaatttgtcctggttatcgctggatgtrtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggytcttctggactatcaaggtatgttgcccgtttgtcctct
amttccaggatcaycgacraccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaasctctwtgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaartctgtrcaacaycttgagtcmctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaacccncacaaaacraaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgcctcaggaacatattgtacaaaagatcaaaatgtgttttagraaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctctaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagcaaacagtatatgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacwtcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctsttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccrtgaacgccmactggaacctgcccaaggtcttgcataagaggactcttggacttttagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgcctactgacttctwtccttctgttcgagatctcctcgacaccg
ccactgctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagcaacctgggtgggargtaatttggaagatccagcatccagggamgcagtagtcag
ctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagaagcaggggcaggaccyctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacacataaggtgggaaac
tttacgggactttattcttctacggtaccttgctttaatccyaattggcaaactcctycttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacrggrgactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatayttwcccttagataaagggatcaaagcttattatccagagmakgtagtt
amtcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgaccatcagttggaccctgcattcaaagccaactc
agaaaatccagaytgggacctcaatccgcacaaggacaactggccggactccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatacwcacaactgtgccagcagcg
cmtcctcctgcctccaccaatcggcagtcaggaaggcaacctactcccatatctccacctctaagggacactcatcctca
rgccatgcagtggaa
>gnl|hbvnuc|KX276820_FT00000_P-B Feature FT:source KX276820_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcccccacgttccaccaaactcttcaagatcctcgagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaaaacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttattgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgyaaaatyccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgyagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccatttatgccgctgt
tacccattttcttttgtctttgggtatacatttaaaccctcataaaacaaaacgatggggctactcccttaacttcatgg
gatatgtaattggaggttggggyaccttaccccaggaacatattgtgttgaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctctgatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttataaggcctttc
tacacaaacaatatctgaacctttaccccgttgcgcggcaacggtcaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggtcatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgacaattccgttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgcrgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatkaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagcygtgccttgggtggctttaggrcatggacattgacccgtataa
agaatttggagcttctatggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctccgctctgyatcgggaggccttagagtctccggaacattgtwcasctcaccatacggcactcaggcaagccattctg
tgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagasaaa
ytgttcttgaatatttggtctctttcggagtgtggattcgcactcctcctccatatagaccacaaaatgcccctatctta
tcaacacttccggaaactgctgttgttagaccacgrggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaayctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctadctttaatcctaaatggcaaactccttcttttcctgacattcatttgsa
ggaggacatcattaatagatgtgaacaatttgtgggacccctcacagtgaatgaaaaaaggagactaaaattgattatgc
ctgctagattttatcctaatgttactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtattttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcgacaaggc
atggggacaaatctttcygtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacamctgkccggacgmcaacaaggtgggagtgggagcattcgggc
cgggattcactccaacccatgggggactgttggggtggagcccgcaagctcagggcatactcacacctgtgccagcagct
cctcctcctgcctccaccaatcggcaggtaggaaggaagcctactcccctrtctccacctctaagagacactcatcctca
ggccayaaagtggaa
>gnl|hbvnuc|KX276821_FT00000_P-B Feature FT:source KX276821_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatccgagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaaaccctgttcagaatactgcctctcccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcarttttctaggggaaacacccgtgtgtcktggccaaaattcgcagtccc
aaatctccagtcactcactaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcraccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctwtgtttccct
catgttgctgtacaaaacctacggacrgaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtgcaacatcttgagtccatttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcagaaaacaaaaagatggggytactcccttaacttcatgg
ggtatgtaattggaagttggggcacmttaccccaagaacatattctgttgaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctatygattggaaagtgtgtcaacgaattgtgggtcttttgggatttgctgctcctttcacgcaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttttcgccaacgtataaggcctttc
taaacaaccaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcraracttatcgggactgacaattctgtcgtcctttcccgaaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccscttctccgtctgycgtwccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccmccgtgaacgcccrttggaacctgcccaaggtcttgcataagaggactcttggactttcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccacgcaactttttcacctctgcctaatc
atctcmtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggrcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctwtccttctattcgagatcttctcgacaccg
cctctgctttgtwtcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctrttctg
tgttggggwgagttgatgmatctagccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcmtaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggggtgtggatycgcacacctcaggggtatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagaggacgaagcagggtccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctagctttaatcctaaatggcaaactccttcctttcctgacattcatttrca
ggaggacatcattgataggtgtgaacaatttgtgggaccccttacagtgaatgaaamcaggagactaaaattgattatgc
ctgctaggttctatcccaatgttactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtgtcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcgacaaggc
atggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
agacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagtgggagcattcgggc
cgggattcactccaccccatgggggamtgttggggtggagccctcaagctcagggcatactcacaactgtgccaacagct
cctcstcctgcctccaccaatcggcagktaggaaggaagcctactcccctgtctccacctytaagagacactcatcctca
ggcaatgaagtggaa
>gnl|hbvnuc|KX276822_FT00000_P-B Feature FT:source KX276822_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctaggggaaatacccgtgtgtcatggccaarattcgcagtccc
aaayctccagtcactcaccaacttgttgtcctccaacttgtcctggttatcgctggatgtgtcwgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgyaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgyagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaartctgtgcaacaycttgagkccatttatrccgctgt
ttccaattttctkttgtctttgggyatrcatttaaacccycacaaaacaaaaagatggggctactcccttaacttcatgg
gatatgtaattggaagttggggcaccttaccccargaacatattgtgttraaaatcaaacaatgttttagaaaacttcct
gtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttgggattcgctgctcctttcacacartgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacrtataaggcctttc
tacacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
acgggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaagcttatcgggactgacaattctgtcgtcctttcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcmcggggccgcttgggcmtctaccgcccgcttctccgcctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttaatctcttttttgccttctgacttctttccttctattcgagaccttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacatkkttcacmtcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaagacccarcatccagggaagcagtagtcgg
ctatgttaatgttaatatgggcctaaaactcagacaattattgtggtttcacrtttcctgtcttacgtttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggrayctcaatgttagtataccctggactcataaggtgggaaac
tttacggggctttattcttctacggtacctagctttaatcctaaatggcaaactccttcttttcctgacattcatttgma
ggaggacatcattgataggtgtaaacaatttgtgggacccctcacagcgaatgaaaacaggagactaaaattgatcatgc
ctgctaggttctatcctaatgttaccaaatatttgcccttagataaaggaattaaaccttattatccagaacaggtagtt
aatcattactttcagacgagacattatttacatacgctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcgacaaggc
atggggacaaatctttcmgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggayctcaacccacacaaggacaattggccggactccaacaaggtgggagtgggagcattcgggc
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcattctcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggaaggaagcctactcccctgtctccacckctgagagacactcatcctca
rgccatgcagtggaa
>gnl|hbvnuc|KY881734_FT00000_P-B Feature FT:source KY881734_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate control-01). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaattctgtctcggccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaacaaccagcaccggaccatgcaaaacatgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcactttgccacaggaacatattgtacaaaaaatcaaattgtgttttaagaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcacggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgccaaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttaccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactccccccgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctacatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaatcatgc
ctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgaggcattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacacgatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattccgccccatgggggactgttggggtggagccctcaggctcagggcatacttacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881828_FT00000_P-B Feature FT:source KY881828_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient-03). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacttttcaccaaactcttcaagatcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggacacctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactactgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcaccaacttacaaggcctttc
tacgtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaaat
atacatcctttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
atggtctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctgctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagcaattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccagcaaatgcccctatctta
tcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacgcataaggtgggaaac
tttacggggctttattcttctacggtaccatgctttaatcctaactggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ccgctaggttttatcccaaggttaccaaatatttagccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcctgggaacacaatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggt
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KY881831_FT00000_P-B Feature FT:source KY881831_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient-03). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggacacctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactactgctcaaggaacctctatgtttccct
catgttgccgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaaat
atacatcctttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggaattgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctgctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagcaattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccagcaaatgcccctatctta
tcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacgcataaggtgggaaac
tctacggggctttattcttctacggtaccatgctttaatcctaactggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ccgctaggttttatcccaaggttactaaatattcgcccttagataaagggatcaaaccttattatccagcgcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcctgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|KY881865_FT00000_P-B Feature FT:source KY881865_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient-04). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcccccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagactactgtctcgtccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcccct
aattccaggatcatcaacaaccagcaccggaccgtgcaaaacctgcacaactcccgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaaccaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacacaaaatcaaaatgtgttttcggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tcagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcagaact
cctagccgcttgttttactcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcttttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcagacaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcatatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccatcaaatgcccctatctta
tcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaccaggagactaaacttaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
gatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcaccagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
tagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagcg
cctcctcctgcctccaccaatcggcagtctggaaggcagcctactcccttaactccacctctaagggacactcatcctca
ggccatgaagtggaa
>gnl|hbvnuc|KY881958_FT00000_P-B Feature FT:source KY881958_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient-08). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccaagttccaccaaactcttcaagatccaagggtcagggctctgtaccttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctctgccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggcgaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaatcctcataaaacaaaacgatggggctactcccttaacttcatgg
gatatgtaattggtagttggggcaccttaccccaggaacatattgtgttgaaaatcaaacaatgttttaggaaacttcct
gtaaacagacctattgattggaaggtgtgtcaacgaattgtgggtcttttggggtttgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagcgagacaggctttcactttctcgccaacttacaaggcctttc
taaccaaacagtatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggctatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatacagcggaact
cctagctgcctgttttgctcgcagccggtctggagcgaaacttatcgggactgacaattctgtcgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttttagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagaccttctcgacaccg
cctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagcaattctc
tgttgggatgagttaatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactattgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctacggtaccttgctttaatcctgaatggcaaactccttcttttcctgacattcatttgca
tgaggacattgttaataggtgtaaacaatttgtgggacccctcacagtaaatgaaaataggagactaaaattgattatgc
ctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaattaaaccttattatccagaacatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatattatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcaaaacctcgaaaaggc
atggggacgaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggatctcaacccacacaaggacaactggccggactccaacaaggtgggagtgggagcattcgggc
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggaaggcagcctactcccctgtctccgcctctaagagacactcatcctca
ggccatgcactggaa
>gnl|hbvnuc|LC349877_FT00000_P-B Feature FT:source LC349877_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctctgccacgttccaccaaactcttcaagatccccgagtcagggctctgtaccttcctgctggtggctccagttcaggag
cagtgagccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggcttccgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
tacccattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatgtaattggaagttggggcaccttaccccaggaacatattgtgttgaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctattgattggaaggtgtgtcaacgcattgtgggtcttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctctgatgcctttatatgcatgtatacaagcgaagcaagcttttactttctcgccaacttataaggcctttc
taaacaaacaatatctgaacctttaccccgttgcacggcaacggtcaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggtcatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggactgacaattccgttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcacggggccgcttggggctctaccgcccgcttctccgtctgcagtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctccgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
cggttcttgaatatttggtctctttcggagtgtggattcgcactcctactgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctagctttaatcctaaatggcaaactccttcttttcctgacattcatttaca
ggaggacatcattaataggtgtgaacaatttgtgggacccctcacagtgaatgaaaacaggagactaaaattgattatgc
ctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtattttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcgacaaggc
atggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagtgggagcattcgggc
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcaggtaggaaggaagcctactcccctgtctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674395_FT00000_P-B Feature FT:source MF674395_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV040026). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggttccttgccacaggaacatattgtacaaaaaatcaaattatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggcacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgacaattctgtcgtgctatcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgctcctctgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgaccaaggtcttacataagaggactcttggactttcagtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcacaaggtgggaaac
tttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgca
ggaagacattgttgataggtgtaagcaatttgtgggacccctaacagtaaatgaaatcaggagactaaaattaattatgc
ctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatcccgagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccacacaaggacaattggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674423_FT00000_P-B Feature FT:source MF674423_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV040078). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
tagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctat
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattggaagttggggttccttgccacaggaacatattgtacaaaaaatcaaattatgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctgggattcgctgcccctttcacacagtgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaagcagtatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggacatcagcgcatgcgcggcacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaattctgtcgtgctatcccgcaagt
atacttcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctatggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctcactttaatcctgattggcaaactccttcttttcctaacattcatttgca
ggaagacattgttgataggtgcaagcaatttgtgggacctctaacagcaaatgaaatcaggagattaaaattaattatgc
ctgctagattttaccccaatgttaccaaatacttgcctttagataaaggaatcaaaccctattatcccgagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccacacaaggacaattggccggacgccaacaaggtgggagtgggagcatttgggc
cagggttcacccctccccatgggggcctgttggggtggagccctcaggcccagggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674473_FT00000_P-B Feature FT:source MF674473_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBVVZ0514). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcagactcttcaagataccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccacaagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
tacccattttcttttgtctctgggtatacatttaaaccctcacaaaacaaaacgatggggatattcccttaatttcatgg
gatatgtaattggtagttggggctccttgccacaggaacatattgtacaaaaactcaaatcatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacgggcttttactttctcgcaaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgaggaacctttttgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggaccgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctcccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaagtagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcctttcctgacattcatttgca
ggaggacattgttgataggtgtaagcaatttgtgggacccctaacaataaatgaaaacaggagactaaaattaattatgc
ctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatccagagcatgtggtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccacacaaggacaattggcaggacgccaacaaggtgggagtgggagcatttgggc
cagggttcattcctccccatgggggcctgttggggtggagccctcaggctcagggcatactcgcaactgtgccagcagca
cctcctcccgcctccaccaatcggcagtccggaaggcagcctactcccttatctccacctctaagggactctcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674500_FT00000_P-B Feature FT:source MF674500_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VN05T0168). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggttccttgccacaggaacatattgtacaaaaaatcaaatcatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctggggtttgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttt
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccctaggccatcagcgcatgcgcggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaccttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcagacgatccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctaactttaatcctgagtggcaaactccttcttttcctgacattcatttgca
ggaagacattgttgataggtgtaagcaatttgtgggacccctaacagtaaatgaaatcaggagactaaaattaattatgc
ctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatcccgagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccacacaaggacacttggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggagcctgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MG372436_FT00000_P-B Feature FT:source MG372436_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/08116). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cattgaaccctgctcagaatactgtctctgccatatcgtcaatcttatcaacgactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttccagaggggacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccatttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaactaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggatttgccgctcctttcacacagtgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttt
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcgtgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacagaaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatactttaaagactgtgtgtttgctgagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ccgctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagcaatttggaagatccagcatccagggaagcagtagtcag
ctatgtcaacgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttgggagagaca
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacgtcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgatattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggaaactaaaattaattatgc
ctgctaggttttatcccaaggccactaaatatttgcccttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccactcgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaggccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaaccaggtgggagtgggagcattcgggc
cagggttcactcctccccatgggggaatgatggggtggagccctcaggcccagggcctactcacagctgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MG571364_FT00000_P-B Feature FT:source MG571364_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 30737). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaacgatggggatattcccttaacttcatgg
gctatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgacccctcccggggccgcttggggctctaccgcccacttctccgcctgttgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcctttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MG571372_FT00000_P-B Feature FT:source MG571372_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 31789). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaaaacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcacggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacataaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaatctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctatcctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcatatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctyaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattattgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccgtattatccagagtatgtagtt
gatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgwag
cgcctcattttatgggtcaccatattcttgggaacacgatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctacttacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatacagtggac
>gnl|hbvnuc|AB073822_FT00000_P-B Feature FT:source AB073822_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi32). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgcagcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccaaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacstataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgtcgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccctattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB073828_FT00000_P-B Feature FT:source AB073828_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HK37). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgttcaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgtaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccgggrccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgccattagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcggatcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacttcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB073848_FT00000_P-B Feature FT:source AB073848_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HUS). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacgcccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaattatgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttagggtttgctgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggctttcactttctcgccaacttataaggcctttc
taagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgtccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccgtcggtgcgagacctcctagataccg
ctgctgctctgtatcgggaagctttagaatctcctgaacattgctcacctcaccacacagcactcaggcaagctattctg
tgctggggggaattaatgactctagctacctgggtgggaaataatttagaagatccagcatccagggatctagtagtcaa
ttatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttacggggctctattcttctacagtacctgtctttaattctgaatggcaaactccttcttttccagacattcatttaca
ggaggatattgttgatagatgtaagcaatttgtaggaccccttacagtaaatgaaaacaggagactaaaattaataatgc
ctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattactttcagacaagacattatttgcataccctttggaaggcgggtatcttatataaaagagagtctacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agcaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacatctgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB073852_FT00000_P-B Feature FT:source AB073852_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctctaccacatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagagggaccacccgtgtgtcctggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaatcgggagttgggggacattgccacaggaacatattgtacaaaaaatcaaacaatgtttcaggaaacttcct
gtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttggggtttgcagccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttt
tacgtaaccagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggagcctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagatgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttaatctcttttttgccttctgacttctttccgtcggtgcgagacctcctagataccg
cgactgctctgtatcgggacgccttagaatctcctgaacattgcacacctcaccacacagcactcaggcaagctgttctg
tgttggggggaattaatgactctagctacctgggtgggtaataatttacaagatccagcgtccagggatctagtagtcaa
ttatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctgtcttacttttggaagagaca
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttaatatcccttggactcataaggtgggaaat
ttcacggggctttattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttccagacattcatttgaa
ggaggacattgttgatagatgtgagcaatttgtgggaccccttacagtaaatgaaaaaaggagattaaaattaataatgc
ctgctagattttttcctaagggtaccaaatatttgcccttagataaagggatcaaaccttattatccagagcaggtagtt
aatcattactttcagacgagacattatttgcatactctttggaaggcgggtatcttatataaaagagagtcaacacatag
cgcctcatttttcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctgtctgtccccaatcccctgggattctttcccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccgcaaggtgggagtgggagcattcgggc
cagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcatactcacatctgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacacgcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB195933_FT00000_P-B Feature FT:source AB195933_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacggattgtgggtcttttggggtttgccgccccgttcacgcaatgtgg
atatcctgcattaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcaccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccctgtggctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaacgagtgggaggagtcgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatattatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgcaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacacctccccatgggggactgttggggtggagccctcaggctcagggactactcacaacggtgccagcagtt
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB246343_FT00000_P-B Feature FT:source AB246343_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccattttccaccaaactcttcaggatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcgacgactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggttgacttctctcagttttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcaccttgccacaggaacatattgtacaaaaaatcaaactatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtttgtcaacgaattgtgggtcttttggggtttgctgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacatacaaggcctttc
taagcaaacagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgctcctccgcctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcaccaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggaactgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggtataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccgtcggtgcgagacctcctagataccg
ctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcaccacacagcactcaggcaagctattctg
tgctgggtggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacgtttcctgccttatgtttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttacgggtctctattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttccagacattcatttgca
cgaggatattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagactaaaattaataatgc
ctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccaaacaagacattatttgcatactctttggaaggcgggtatcttatataaaagagagtcaacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattccaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacatctgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB365445_FT00000_P-B Feature FT:source AB365445_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BOL1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacaactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaacgcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggtgcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacaccttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacacattatacaaaaaatcaaaatgtgttttagraaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgtattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttataaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatacggcggaact
cctggccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggaccgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccccaggaacctgcccaaggtcttgcataagaggactcttggactttcaacaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttg
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaggcaatttggaagatcaaggatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaactcagacagctattgtggtttcacatttcctgtcttatgtttgggagagaaa
ctgttctggaatatttggtgtcttttggagtgtggattcgcactcctgctgcatatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaccaggagactaaaattagttatgc
ctgctaggttttatcccaaagttactaaatatttgcccttagataaagggattaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctaccgcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgtacaaggacaattggccggacgccaacaaggtgggagcgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagtcctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
agccatgcagtggaa
>gnl|hbvnuc|AB900106_FT00000_P-B Feature FT:source AB900106_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgttttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
tgcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcaagacctgcacagctcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
tacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaaggtggggatattcccttaacttcatgg
gatatgtgattgggagttggggcgcattgccacaggaacatattgtacaaaaaatcaaactatgttttagaaaacttcct
gtaaacaggcctattgattggaaagtttgtcaaagaattgtgggtcttttggggtttgctgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctataccgcccgcttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgaccattataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtcggtgcgagacctcctagataccg
cgactgctctgtatcgggaagccttagaatctcctgaacattgcacatctcaccacacagcactcaggcaagctattctg
tgctggggggaattaatgactctagctacctgggtgggcaataatttacaagatcccgcgtccagggatctagtagtcaa
ttatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcatgtcttacttttggaagagata
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactgctgttgttagacaacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttacggggctttattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttccagacattcatttaca
ggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagactaaaattaataatgc
ctgctagattttatcctaacgttaccaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttgcatactctgtggaaggcgggtatcttatataaaagagagtcaacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacatctgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttaactccaccgctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AF121249_FT00000_P-B Feature FT:source AF121249_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/4014). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
tacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaagcttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctctctatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattttg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattctttcccgatcatcagttggaccctgcattcaaagccaactc
agacaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttgtctccacctctaagggatactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AF282917_FT00000_P-B Feature FT:source AF282917_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-B1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagcactggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgttcggcaacggcctggtctgtgccaagtgtttcgtgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
tctagcagcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggccttgcataagaggactcttggactttccgcaa
cgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggttt
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcacccgtaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctactgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacatagttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctggccacctgggtgggtagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggccaaaatttcagacaactattgtggtttcacatttcctgtctcacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaagacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggattttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcagtctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY167097_FT00000_P-B Feature FT:source AY167097_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIIb). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
acttggtggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctgtctgtccccaatcccctgggattctttcccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccgaacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ448625_FT00000_P-B Feature FT:source DQ448625_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-TXB). Complete genome. [Hepadnaviridae] (length=3215 residues).
cttcaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttatttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccggccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcacctttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctatcctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacggcatgggagtttggccttcccaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU306697_FT00000_P-B Feature FT:source EU306697_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattaccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggccttcc
taagtaaacagtatctgaacctttaccctgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcgtgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggactgacaattctgtcgtgctttcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccaaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttactttcgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaccaggagactaaaattaattatgc
ctgctaggttttatcccaatgttaccaaatatctgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactaacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU439020_FT00000_P-B Feature FT:source EU439020_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccgctttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatacagtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcggttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggaggtactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
cggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccctgctttaatcctatatggcaaactccttcctttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgtcactaaatatttgcccttagataaagggatcaacccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtggaagtgggggcattcgggc
tagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaactgcgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU487256_FT00000_P-B Feature FT:source EU487256_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttcctccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactactgctcaaggaacctctttgtttccct
catgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacagctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gttatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgcgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggctttcactttctcgccaacttataaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctccaggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctatgctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttactttcgggagagaaa
ctgttcttgaatatttggtgtcttttggggtgtggattcgcactcctaccgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctaacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcctccaaaccgcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggacccagcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
caggggtcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctgagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU939559_FT00000_P-B Feature FT:source EU939559_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C67). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaagagatggggatactcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaacatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacaatatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcgtgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggtggagggtaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctattgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcagctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattaatagtcgg
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacaaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctaaggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaaaaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcagggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ023637_FT00000_P-B Feature FT:source FJ023637_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B5_M04-0013). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatccaagagtcagggcgctgtactttcctgctggtggctccagttcaggaa
cactgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcrcatcargactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctttgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatactcccttaacttcatgg
ggtatataattggaagttggggcaccttaccccaggaacatattgtattgaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctattgattggaaggtatgtcaacgaattgtgggtcttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagccaaacaggctttcactttctcgccgacttataaggcctttc
tamacaaacaatatctggacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggctataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattctgtcgttctttcccggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaccctgcccaaggtcttacataagaggactattggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagttgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtacagggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatcttgctacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaaggactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctmaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctacggtacctggctttaatcctgaatggcaaactccttcttttcctgacattcatttgcg
ggaggacattgttaataggtgtaaacaatttgtaggccccctcacagtaaatgagaacaggagactaaaattgatcatgc
ctgctaggttctatcctaacgttactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaargcgggtatcttatataaragagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattccttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaacygtgccaacasct
ccacctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ386668_FT00000_P-B Feature FT:source FJ386668_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S395). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
tacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctaccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgttccaaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcac
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggatgaggttaggtta
aggaactatgtactaggaggctgtagggataaattggtgtgttcaccagccccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagattaaaattaattatgc
ctgctaggttttatcccaaggttactaaatatttgcctttagataaagggatcaaaccgtattatccagagtatgtggtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacacctggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ358149_FT00000_P-B Feature FT:source GQ358149_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAN001). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagaccccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaaaccctgttcagaacactgcatcttccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
gatatgtaattggaagttggggcacattaccccaggaacatattgtgtcaaaaatcaaacaatgtttcaggaaacttcct
gtaaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggattcgctgctcctttcacacaatgtgg
ttatcctgctttaatgccgttatatgcatgtatacaagctaaaaaggcttttaccttctcgccaacttacaaggcctttc
taaacaaacagtatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaccttatcgggactgacaattctgtcgtcctttcccgtaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgcccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagaccttctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaga
ctgttcttgaatatttggtgtctttcggagtgtggattcgcactcctcctgcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctgactttaatcctaagtggcaaactccttctttccctgacattcatttgca
ggaggacattgttgatagatgtaaacaatttgtgggacccctcacagtaaatgaaaacaggagactaaaattgatcatgc
ctgctagattctatcctaatgttactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggatcctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagtgggagcattcggga
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatgctcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggaaggcagcctactcccctgtctccacctctaagagactctcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ924640_FT00000_P-B Feature FT:source GQ924640_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M72). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtacttccctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatactcccttaacttcatgg
gatatgtaattggaagttggggcaccttaccccaggaacatattgtattgaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctattgattggaaggtatgtcaacgaattgtgggtcttttaggatttgctgctcctttcacacaatgtgg
gtatcctgctttgatgcctttgtatgcatgtatacaagccaaacaggctttcactttctcgccaacttacaaggcctttc
tacacaaacagtatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcatgcgtggcacttttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaagcttatcgggaccgacaattctgtcgtcttgtcccgcaaat
atacatcgtttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcgatgaccgaccttgaggcatacttcaaagactgtgtgtttactgaatgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttggttggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctgctcgacaccg
cctctgctctgtatcgggaggccttagagtctccagaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggggagttaatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctctattcttctacggtacctggctttaatcctgaatggcaaactccttcctttcctgacattcatttaca
ggaggatattgttgataggtgtagacaatttgtgggacccctcaccgtaaatgaaaataggagactaaaattgatcatgc
ctgctagattctatcctaatgttaccaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccaaacaagacactatttacatactctttggaaggcgggtatcttatataaaagagagacaacgcgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaattc
cgacaatccggattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagcgggagcattcgggc
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttagggaggccgcctactcccctctctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815596_FT00000_P-B Feature FT:source GU815596_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgtctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttacgttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccaatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttccggatattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcctttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacaagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccttgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtaggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815626_FT00000_P-B Feature FT:source GU815626_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctttgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaagaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacatccatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacacgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815685_FT00000_P-B Feature FT:source GU815685_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatccttcccatggctgctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatattatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcaaggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815687_FT00000_P-B Feature FT:source GU815687_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacaatatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatattatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcaaggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815688_FT00000_P-B Feature FT:source GU815688_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaaccttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatattatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcaaggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815694_FT00000_P-B Feature FT:source GU815694_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-4). Complete genome. [Hepadnaviridae] (length=3203 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggacgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccatttttcacctctgcctaatcatctcatgttca
tgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataaagaatttggagc
ttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgt
atcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctgtgttggggtgag
ttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcagctatgtcaacgt
taatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaactgttcttgaat
atttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatcttatcaacacttccg
gaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgcc
gcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaactttacggggctt
tattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgcaggaggacattgt
tgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgcctgctaggtttt
atcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagttaatcattacttc
cagacgagacattatttacacactctttggaaggcgggtatattatataaaagagagtccacacgtagcgcctcattttg
cgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggcatggggacaaat
ctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactcagaaaatccaga
ttgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggccagggttcatcc
ctccccatgggggactgttggggtggagccctcaggctcaaggcatactcacaactgtgccagcagctcctcctcctgcc
tccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctcaggccatgcagtg
gaa
>gnl|hbvnuc|GU815719_FT00000_P-B Feature FT:source GU815719_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgcctcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaacaccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgctactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815735_FT00000_P-B Feature FT:source GU815735_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgacttctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagttcctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgcctcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccgaaacctgcccaaggtcttgcatcagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcgtttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgctactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815743_FT00000_P-B Feature FT:source GU815743_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggccttagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggggttggggcacattgcctcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcacctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccgaaacctgcccaaggtcttgcatcagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcgtttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaagttaattatgc
ctgctaggttttatcccaatgctactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815747_FT00000_P-B Feature FT:source GU815747_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctcc
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcatcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaataggggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctctattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctaacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcaaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattcctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815755_FT00000_P-B Feature FT:source GU815755_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtctttcggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacgtcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctctattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctaacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcaaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattcctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815766_FT00000_P-B Feature FT:source GU815766_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctctattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctaacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcaaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattcctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815771_FT00000_P-B Feature FT:source GU815771_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctctattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctaacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcaaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattcctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HM011473_FT00000_P-B Feature FT:source HM011473_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
cwccaccackttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcarttttctaggggaaacacccgtgtgtcytggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacmaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaacgatggggatattcccttaacttcatgg
gatatgtaattgggggttggggcacrttgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcraaacaggcttttactttctcgccaacttacaaggcctttc
tgagtaaacagtatctgmacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcycggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctyccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgtccaccagcaccaygcractttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctymtgacttctntccttctgttcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgkg
tgttggggtgaggtaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgataatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactrctgttattagacmaagaggcaggwcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaayctcaatgttaatattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctraatggcaaactccttcttttccygacattcatttgca
ggaggacattgttgatagatgtcagcaatttgtggggccccttacartaaatgaaaamaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttkcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacragacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtac
cgcctcattttkcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
ggaaaatccagattgggacctcaacccgcacaaagacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggcmatgcagtggaa
>gnl|hbvnuc|JQ027312_FT00000_P-B Feature FT:source JQ027312_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3239 residues).
cwccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcagraa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaactcccgtgtgtcttggccaaaattcgcagtccc
aaacctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaracctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttyagttatatggatgatgtggttttgggggccaagtctgtacamcaccttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggagcatattgtacaaaaactcaaaatgtgttttagaaaacttcct
gtaaacaggcctattgattggaaggtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcraaactyatcgggactgacaattctgtcgtactctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccacgggaacctgcccaaggtcttgcataagaggactcttggactcttgcata
agaggactcttggactttcagcaatgtyaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggag
gagttggrggaggagatcaggttaaaggtctttgtactgggaggctgtaggcataaattggtgtgttcaccagcaccatg
caactttttcacctctgcctaatcatctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggcttta
gggcatggacattgayccgtataaagaatttggagcttctgtggagttamtctcttttttgcctactgacttctttccta
rtgttcgagatcttctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgtacacctcaccac
acggcactcaggcaagttattttgtgttggggtgagttaatgaatttagccacctgggtgggaagcaatttggacgatcm
aacatccagggaagcagtagtcaactatgtcaacgttaatatgggcctaaaaaccagacaactrttatggtttcacattt
cctgtcttacttttgggagagaaactgttcttgaatatttrgtgtcttttggagtgtggattcgcactcctccygsatat
agaccacmaaatgcccctatcttatcaacacttccggaaactgctgttgttagacraagakgcaggtccyctagaagaag
aactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaayctcaatgttagtatt
ccytggacacataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaactggcaaactcc
ttcttttcctgacattcatttgmaggaggacattgttgatagatgtsagcaatttgtggggccccttacagtaaatgaaa
acaggagactwaaattaattatgcctgctaggttttatcccaatgttactaaatayttgcccttagataaagggatcaaa
ccgtattatccagaghatrtagttaatcattacttccagacgcgacattatttacacactctttggaaggckgggatctt
atataaaagagagtccacacgtagcgcctcattttkcgggwcaccatattcttgggaacaagatctacagcatgggaggt
tggwcttccaaacctcgaaaaggcatggggacaaatctktctgtccccaatcccctgggattcttccccgatcatcagtt
ggacccygcattcaaagccaactcagaaaatccagattgggacytcaacccgcacaaggacrgctggccggacgccraca
aggtgggagtgggagcattcgggccagggttcacccctccmcatgggggactgttggggtggagccctcaggcgcagggc
ctactcacaactgtgccagcggctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctcc
acctctaagggacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ027331_FT00000_P-B Feature FT:source JQ027331_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactytccaccaaactcttcaagatcccagagtcagggcccwgaactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctcwgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacactgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaataggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcctttactttctcgccaacttacaaggcctttc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtcctctcccgcaagt
atacatcctttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccrgaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagtctgtgtgtttattgagtgggaggagctgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcwtgttcatgtcctactgttcaagcctccgagctgtgccttgggtggctttagggcatggacattgaccastataa
agaatttggagcttctgtggagttactctcatttttgccgtctgacttctttccttctrttcgagatctcctcgayaccg
cctctgctctgtatcgggaggctttagagtctccggaacatgtttcacctcaccatacrgcmctcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccggcatccagggaattagtagtcrg
ctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctgtattacttttggragagaaa
ytgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagacctcaaaatgcccctatctta
tcaacacttccggaaactactgttgttagaccaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgcttcaatcctaaatggcaaactccttcttttcctgacattcatttgaa
ggaggacattgttgatagatgtaatcaatttgtggggccccttacagtaaatgaaaacaggagactgaaattaattatgc
ctgctaggttttaccccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggktcatccctccacatgggggactgttgggatggagccctcaggctcagggcatacktacaamcgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttawctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ040125_FT00000_P-B Feature FT:source JQ040125_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgttaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcatcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccaaacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaratctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctaaacccgcacaaggacaactggccggacgccaacaaggtgggaataggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ040157_FT00000_P-B Feature FT:source JQ040157_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G187). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctmacaatacc
ayagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgwcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggawcatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttcmct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagytatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
tctagccgcctgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgayttctttccttctattcgagatctcctcgacaccg
mcwctgctctgtatcgggaggccttagagwctccggaacattgttcacctcaccatacrgcactcaggcaagctattgtg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgatattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcaccagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ707740_FT00000_P-B Feature FT:source JQ707740_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_18). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatctcatcaggactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggatatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccagaatcatcaaccaccagcaccggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcatcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatattgatgatatggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaaccaaaagatggggatattcccttaattttatgg
gatatgtaattgggagttggggatccttgccacaggaacatattgtacaaaaaatcaaattatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacaatatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctcctttgccgatccatactgcagaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgccgtatcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccactggaacctgcccaaggtcttacataaaaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtttatgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgaccactataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
ccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgaa
ggaggacattgttgataggtgtaagcaatttgtgggacccctaacagtaaatgaaaccaggagattaaaattaattatgc
ctgctagattttatcccaccgttaccaaatacttgcccttagataaaggaatcaaaccctattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacgacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccatacaaggacaactggccggatgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcttgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctccttctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ707745_FT00000_P-B Feature FT:source JQ707745_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_23). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtattttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatctcatcaggactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacaggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatattgatgatattgtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttttctttgggtatacatttaaaccctcacaaaaccaaaagatggggatattcccttaattttatgg
gatatgtaattgggagttggggatccttgccacaggaacatattgtacaaaaaatcaaattatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacaatatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgccgtatcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccactggaacctgcccaaggtcttacataaaaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtttatgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgaccactataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
ccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgaa
ggaggacattgttgataggtgtaagcaatttgtgggacccctaacagtaaatgaaaccaggagattaaaattaattatgc
ctgctagattttatcccaccgttaccaaatacttgcccttagataaaggaatcaaaccctattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacgacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccatacaaggacaactggccggatgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcttgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctccttctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ801471_FT00000_P-B Feature FT:source JQ801471_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AIDS7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctatggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttcggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaagacctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattgaccatcagcgcgtgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgttaacgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccatattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctgtggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctctctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ801494_FT00000_P-B Feature FT:source JQ801494_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CONTROL1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaagaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaaaaaccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccgtcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaatcgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacctacaaggcctttc
taagtaaacagtatcttaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccgagctgtgccttgggtggctttagggcatggacatcgacccgtataa
agaatttggagcttctgctgagttactctcttttttgccttctgacttttttccttctattcgagatctccttgacacca
tctccgctctgcatcgggaggccttagagtctcctgaacattgtacacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttgcaagatccaacatccagggaagcagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacctttcctgtattacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgttttaatcctcaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaaaaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
gatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggtctactcacaactgggccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JX661471_FT00000_P-B Feature FT:source JX661471_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1202-B1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggatcatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttgatgcctttatatacatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacgtcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagacccccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcctctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JX869998_FT00000_P-B Feature FT:source JX869998_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 317). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagattggggaccctgtaccgaacatggag
aacaccgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattatacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcagtgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagtttatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgtaaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcacccctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattctgctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagactgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggccaactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC510644_FT00000_P-B Feature FT:source KC510644_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tatgtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggcaataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtctgcg
ctgaatcccgcggacgacccctcccggggccgcttagggctctaccgcccgcttctccgccttttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaaccctcacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattgatgcgttcacgatgtccccgtgactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattttg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacggtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcatttgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC510646_FT00000_P-B Feature FT:source KC510646_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacgcaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggagcatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgctgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatttgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgccttgtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcacccaccgaccttgaggcatacttcaaagactgtgtgtttaaggagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgcgttcacgaggtccccgtggatttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagccattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattctttcccgatcatcagttgcaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccgggcgccaacaaggtgggagtgggagcattcgggc
caaggttcacccctccccatggggtactgttggggtggagccctcaggctcagggcctactcacaactatgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774410_FT00000_P-B Feature FT:source KC774410_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxa2018). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggcactgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatccacaaccagcaccggaccatgcaaaacctgcacaactcctgctcacggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaactttatgg
gatatgtaattgggagttggggcacattgccacaagaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaactccc
actggttggggcttggccataggccatcagcgcctgcgtggaaccttcgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcctctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccatcaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaataggagactaaaattaattatgc
ctgctaggttttatcccaaggttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagagcatattcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173376_FT00000_P-B Feature FT:source KJ173376_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YY004M(e108)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgttcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttatgccgctgt
tacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaagaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggccttcc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtactctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccatccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttccgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgcag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173401_FT00000_P-B Feature FT:source KJ173401_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N09-M(6720A)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtatcggccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccacaagcaccgggccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaatcctcataaaacaaaaagatggggctactctctcaacttcatgg
gatatgtaattggaagttggggcaccttaccccaagaacatattgtgttgaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctttgatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
tacacaaacagtatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcggcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagctgcctgttttgctcgcagcaggtctggagcaacacttatcggaaccgacaattctgtcgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcagacgatccctcccggggccgcttggggctctaccgaccgcttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccgcggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagcaattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
cggttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctacggtacctggctttaatcctgaatggcaaactccttcttttcccgacattcatttgca
ggaggacattgttaataggtgtaaacaatttgtgggacccctcacagtaaatgaaaacaggagactaaaattgatcatgc
ctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaattaaaccgtattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagggagtcaacacgtag
cgcctcattctgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctctctgtccccaatcccctgggattcttccccgatcatcagttggatcctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacacctggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173420_FT00000_P-B Feature FT:source KJ173420_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N203M(e405)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatctttggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaactgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgactac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagctacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148335_FT00000_P-B Feature FT:source KP148335_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-130). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagccggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtctgtttaatgagtgggaggagttgggggaggaggttaggtta
caggtctttgtactaggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccctgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctatcctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttctggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagacaaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcgcaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactaacaaatgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148341_FT00000_P-B Feature FT:source KP148341_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagctggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttagggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcacaacaggcttttactttctcgccaacttacaaggccttcc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgtggaact
cctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgactac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcgcttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactaccgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgtcagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcgggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148346_FT00000_P-B Feature FT:source KP148346_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-22). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagctggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttagggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcacaacaggcttttactttctcgccaacttacaaggccttcc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgactac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtcggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148365_FT00000_P-B Feature FT:source KP148365_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D93-3-106). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagccggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctatcctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagacaaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttctccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactaacaaatgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148375_FT00000_P-B Feature FT:source KP148375_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactacctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaatatggag
aacatcgcatcaggactcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatattattggaagttggggcaccttaccccaggaacatattgtattgaaaatcaaacaatgttttagaaaacttcct
gtaaacagacctattgattggaaggtgtgtcaacgaattgtgggacttttgggattcgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcgtgtatacaagctaaacaggcttttactttctcgccaacttataaggcctttc
tgaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctttgccgatccatacggcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcgaaacttatcgggactgacaattctgttgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattttg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgcatggcaaactccttcttttcctgacattcatttaca
ggaggacattgttaataggtgtaaacaatttgtgggacccctcacagtgaatgaaaacaggagactaaaattgatcatgc
ctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgtggtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggattccaacaaggtgggagtgggagcattcgggc
cgggattcgctccaccccatgggggactgttggggtggagtcctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggacggcagcctactcccctatctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148410_FT00000_P-B Feature FT:source KP148410_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-29). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccaagttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaatatggag
aacatcgcatcaggactcctcggacccctgctcgcgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatattattggaagttggggcaccttaccccaggaacatattgtattgaaaatcaaacaatgttttagaaaacttcct
gtaaacagacctattgattggaaggtgtgtcaacgaattgtgggacttttgggattcgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttataaggcctttc
tgaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctttgccgatccatacggcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcgaaacttatcgggactgacaattctgttgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttgggatgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagcagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgcatggcaaactccttcttttcctgacattcatttaca
ggaggacattgttaataggtgtaaacaatttgtgggacccctcacagtgaatgaaaacaggagactaaaattgatcatgc
ctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgtggtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacggcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacgactggccggattccaacaaggtgggagtgggagcattcgggc
cgggattcgctccaccccatgggggactgttggggtggagtcctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggacggcagcctactcccctatctccacctctaagagacactcatcctca
ggccatgcattggaa
>gnl|hbvnuc|KP148430_FT00000_P-B Feature FT:source KP148430_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H54-2-105). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccaagttccaacaaactcttcaagatctaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcattcttatcgaagactggggaccctgtaccgaatatggag
aacatcgcatcaggactcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatattattggaagttgggacaccttaccccaggaacatattgtattgaaaatcaaacaatgttttagaaaacttcct
gtaaacagacctattgattggaaggtgtgtcaacgaattgtgggacttttgggattcgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttataaggcctttc
tgaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctttgccgatccatacggcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcgaaacttatcgggactgacaattctgttgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactctccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggacttttggactttctgcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtagacataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttgggatgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgcatggcaaactccttcttttcctgacattcatttaca
ggaggacattgttaataggtgtgaacaatttgtgggacccctcacagtgaatgaaaaaaggagactaaaattgatcatgc
ctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgtggtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggattccaacaaggtgggagtgggagcattcgggc
cgggattcgctccaccccatgggggactgttggggtggagtcctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggacggcagcctactcccctatctccacctctaagagacactcatcctca
ggccatgcattggaa
>gnl|hbvnuc|KP148458_FT00000_P-B Feature FT:source KP148458_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Y165-3-6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatccaagagtcagagctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgtctcttccatatcgtcaatcttatcgaagactggggaccccgcaccgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctctgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaacaccagcaccggaccatgcagaacctgcacgactactgctcaaggaacctctttgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttctgttgtctctgggcatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatataattggaggttggggcaccttaccccaggaacatattgtattgaaaatcaaacaatgttttagaaaacttcct
gtaaacaggcctattgattggaaaatatgtcaacgcattgtgggtcttttgggattcgctgctcctttcacacaatgtgg
ttaccctgctttaatgcctttatatgcatgtatacaagctaaacaggctttcactttctcgccaacttataaggcctttc
taaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtgtctccgctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattctgtcgttctttcccgaaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctgcgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcatggggctctaccgcccgcttctccgtctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttttcacctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctcaccggaccctgcccaaggtcttacataagaggactattggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgaccactataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagctacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ttatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctctattcttctacggtacctaactttaatcctgaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttaataggtgtacacaatttgtaggccccctcacagtaaatgaaaaaaggagactaaaattgatcatgc
cggctaggttctatcctaacgttactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactccttggaaggcgggtatcttatataaaagagaaacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattccttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaactgtgccaacagct
cctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctcaacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR152339_FT00000_P-B Feature FT:source KR152339_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactctgcaagatcccagagtcagggccctgtattttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaactaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattccctgaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtggggcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttacccagttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctttcccgcaagt
atacatcatttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaacctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcgtatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
agaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactcaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacaagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963820_FT00000_P-B Feature FT:source KU963820_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2_7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggcactgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagtaccggaccatgcaaaacctgcacaactcctgttcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttacatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggccttcc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccatccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtctcacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963848_FT00000_P-B Feature FT:source KU963848_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 4_7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcacggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcaccgcaccatacggcactcaggcaagctattctg
tgttggggggagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattggtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccaaacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaattc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963946_FT00000_P-B Feature FT:source KU963946_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 11_2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
accatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcgacaaccagcaccggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaacccacacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagcaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaacactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaaccctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagggacactcatccgca
ggccatgcagtggaa
>gnl|hbvnuc|KU963948_FT00000_P-B Feature FT:source KU963948_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 11_4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcgaagactggggaccctgtaccgaacatggag
accatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaacccacacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagcaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaacactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtgttaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaaccctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggacccttttttcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963964_FT00000_P-B Feature FT:source KU963964_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 12_5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
tacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcacctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgcatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtcaacagtatttgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagcaacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaacatgggcctaaaaatcagacaactattgtggtttcatatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggatttattcttctacggtaccctgctttaatcctaaatggcaaactccttcttttcccgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacacctggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcgcaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagccgactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963986_FT00000_P-B Feature FT:source KU963986_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 13_11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgagtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccgacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgtatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggtctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagattaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
tagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcggct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964090_FT00000_P-B Feature FT:source KU964090_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 20_12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcccaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatataattgggagttggggcacattgccacaggaacatattgtaacaaaaatcaaaacgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgtgtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatacggcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaacactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcgctcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgaagaggcaggccccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgagaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
gatcattacttccagacacgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattctgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggaaccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964124_FT00000_P-B Feature FT:source KU964124_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 23_2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaacgcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaatagtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcttgtatacaaacaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaagaggtcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctactcgacaccg
cctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcatatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaactggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcggcc
cagggttcacccctccccatgggggactgttggggtggagccctcacgctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964125_FT00000_P-B Feature FT:source KU964125_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 23_3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaacgcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaatagtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcttgtatacaaacaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggtgttgggggaagaggtcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctaacttctttccttctattcgagatctactcgacaccg
cctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcatatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgacgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaactggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcggcc
cagggttcacccctccccatgggggactgttggggtggagccctcacgctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964144_FT00000_P-B Feature FT:source KU964144_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 24_7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcgacgactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaaccctaacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttggggaccaaatctgtacaacaccttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggggttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccgtctgacttctttcctaatattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacatcaccatacggcactcaggcaagctattgtg
tgttggggtgagttaatgagtctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatttttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccgccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggcccctcacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagaaaaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccaaacgcgacattatttacacactctttggaaggcggggatcttatataaaagagaatccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttgggatggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964287_FT00000_P-B Feature FT:source KU964287_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 35_1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaacccttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctaggggggacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggctatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggacgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttcacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtaaccagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaacttatcgggactgacaattctgtcgtactctcccgcaagt
acacctcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgccaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtattaggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ccaatgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggacacataaggtgggaaac
ttcgcggggctttattcttctacggtaccttgctttaatcctaactggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtctacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
caggggtcacccccccacatgggggactgttggggtggagcccccaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964299_FT00000_P-B Feature FT:source KU964299_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 35_13). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaacccttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctaggggggacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggctatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggacgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttcacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttt
tacgtaaccagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaacttatcgggactgacaattctgtcgtactctcccgcaagt
acacctcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgccaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtattaggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ccaatgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggacacataaggtgggaaac
ttcgcggggctttattcttctacggtaccttgctttaatcctaactggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtctacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
caggggtcacccccccacatgggggactgttggggtggagcccccaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctcaaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964300_FT00000_P-B Feature FT:source KU964300_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 35_14). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaacccttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctaggggggacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggctatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggacgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttcacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgagtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttt
tacgtaaccagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaacttatcgggactgacaattctgtcgtactctcccgcaagt
acacctcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgccaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtattaggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ccaatgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggacacataaggtgggaaac
ttcgcggggctttattcttctacggtaccttgctttaatcctaactggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtctacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
caggggtcacccccccacatgggggactgttggggtggagcccccaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX276779_FT00000_P-B Feature FT:source KX276779_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaaycttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctcmaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatm
ttcctytgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggttttgggggccaartctgtacaacaycttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatatwcccttaacttcatgg
gatatgtaattggragttggggcacattgccacaagamcatattgtacaaaaaatcaaaatgtgttttmggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaamgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtmamcagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcgtgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
tctagcagcttgttttgctcgcagcmggtctggggcaaacctcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctmggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggmcgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccmcgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagrwtaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccakcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctkctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtwtcgggaggccttagagtctccggaacattgtwcacctcaycatacggcamtcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggamgatccagcatccagggamkyagtagtarg
ctatgtcaacgttaatatgggcmtaaaaatcagacaactaytgtggtttcacrtttcctgtcttwcttttggragagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctggatatagaccacaaaatgcccctatctta
tcaacacttccggaaactrctgttrttagaysaagakgcaggtccactagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaactggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtrgggccccttacagtaaatgaaaacaggagactaaaattaattatgc
cygctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtcyacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaagracaactggccagacgccaacaaggtgggagtgggagcattcgggm
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagrgacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX276781_FT00000_P-B Feature FT:source KX276781_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaatacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttatctttgggtatmcatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgttggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgggtctcctctgccgatccatactgcggaact
tctagccgcttgttttgctcgcagcaggactggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggktaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccrtataa
agaatttggagcttctgtggagttactctcttttttgcctcatgacttctttccttctattcgagatctactcgacaccg
cctctgctctgcagcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgaggtaatgaatctagccacctgggtgggaagtaatttggacgatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctgaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagama
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactgctgttgttagaccaagaggcaggtcctctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgatattcatttgca
ggaagacattgttgatagatgtcagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccrtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctgtggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX276803_FT00000_P-B Feature FT:source KX276803_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctcmaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattggatgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaccctttatcccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctccactgccaatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcattcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctrccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggamgatcaagcatccagggaattaatagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaca
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacgcttccggaaactactgttgttagacaaagaggcaggtccactagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctacatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgataaatgtgagcaatttgtggggccccttacagtaaatgaaaaaaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX276804_FT00000_P-B Feature FT:source KX276804_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagacttgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatctgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
mattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagkccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttyatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttmggaaacttcct
gtraacaggcctattgattggaaagtrtgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtacacagtatctgcacctttaccccgttgctcggcaacggcctggwctrtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggycatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcgtttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggkctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagrttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacctataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttgsamgatccagsakccagkgaattagttgtcgg
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagarmta
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccagcaaatgcccctatctta
tcaacgcttccggaaactactgttgttagasvaagasgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacrgggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtgggrccccttacartaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatattatataaaagagagtccacacgtag
cgcctcattttgygggtcaccatattcttgggaacaagatctacakcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatcttgctgtccccaatcccctgggattcttccccgatcatcagttggaccctgccttcaragccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcactcctccccatgggggactgttggggtggagccctcaggctcagggccaactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
tgccatgcagtggaa
>gnl|hbvnuc|KX276830_FT00000_P-B Feature FT:source KX276830_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcccccacgttccaccaaactctgcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaaaccctgttcagaacactgcctcttccatatcgtcaaccttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctactcgtgttacaggcggggtttttcttgttaacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgayttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctttgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcgtgagtccgtttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcagaaaacaaaaagatggggctactcccttaacttcatgg
gttatgtaattggaagttggggcaccttaccccaagaacatattgtattgaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttttcgccaacgtataaggcctttc
tacrcaaacaatatctgcacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacatttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgacaattctgtcgtcctgtcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggacgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcayctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgaatggagaccaccgtgaacgcccatyggaacctgcccaaggtcttrcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccattcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctacagagttactctcttttttgccttctgacttttttccttctatacgggatcttctcgacaccg
cttctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtatcttttggagtgtggattcgcacacctcctccatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctctattcttctacggtacctagctttaatcctaattggcaaactccttcctttcctgacattcatttgca
ggaggacatcattgataggtgtaaacaatttgtgggaccccttacagtaaatgaaaacaggagactaaaattgattatgc
ctgctaggttctatcccaatgttaccaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcgacaaggc
atggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaattc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagtgggagcattcgggc
caggattcactcccccccatgggggaatgttggggtggagccctcaagctcagggcatactcacaactgtgccaacaact
cctcctcctgcctccaccaatcggcagttaggaaggaagcctactcccctgtctccacctctaagagacactcatcctca
ggcaatgcggtggaa
>gnl|hbvnuc|KX276858_FT00000_P-B Feature FT:source KX276858_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccmccacgttccaccawactcttcargatcccagagtcagggctctgtacyttcctgctggtggctccagttcmgraa
cagtgaaccctgttcagaacactgcctytwccatatcgtcaatctyatcgaagactggggaccctgtgctgagcatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctygttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcarttttctaggggraacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgayttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttktgggggccaagtctgtrcavcatcttgagkccstwtatgycgctgt
ttccmattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatgtaattggaagttggggcaccttaccccaggaacatattgtgttgaaaatcaaacaatgttttagaaaacttcct
gtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttgggattcgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttrtatgcatgtrtacaagcgaaacaggcttttactttctcgccaacgtataaggcctttc
traacaaacaatatttgracctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttattgggactgacaattctgtcgtyctktcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgycgtwccrgccgaccac
gggkcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggrccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccmtgcaactttttcacctctgcctaatc
atctcwtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttrggrcatggacattgacccgtataa
agaatttggagctwctgyggagttrmtctcttttttgccttctgacttctttccttctattcgagaccttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacatwkttcabmtcaccatacggcrstcaggcaagctattctg
tgttggggtgagttgrtgaatctagccacctgggtgggargtaatttggamgaccmagcatccagggaakyagtagtcrg
ctatgtyaatgkyaatatgggcctaaaratcaggcawctattgtggtttcacatttcctgtcttacttttggaaragava
ctgttcttgaatatttggtrtcttttggagtgtggattcgcactcctcctccatatagaccrccaaatgcccctatctta
tcaacacttccggaaaytrctgttrttagacracgrsgcaggwcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggratcymamtgttagtataccctggackcayaaggtgggaaac
tttacggggctttattcttctacggtacctagctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacatcattgataggtgtaaacaatttgtgggacccctcacagtgaatgaaaacaggagactaaaattgatcatgc
ctgcwaggttctatcctaatgttaccaaatatttgcccttagakaaaggaattaaaccgtattatccagagcatgtagtw
aatcattacttycagacragacattatttacatactctttggaaggcgggtrtcttatataaaagagagacaacacrtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggtysgtcctccaaacctcgacacggc
atggggacaaatctttcagtccccaatcctctgggattcyttcccgatcaccagttggaccctgcattcaaagccaactc
mgacaatccmgattgggatctcaacycacacaaggacawctggccgractccaacaaggtgggagtgggagcattcgggc
cgggattcactccaccccatgggggactgttggggtggagccctcaagcycagggcattctcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcrgdyaggaaggmagcctactcccctgwctccacctctaagagacactcatcctca
sgycatrcrgtggaa
>gnl|hbvnuc|KX765854_FT00000_P-B Feature FT:source KX765854_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PID:9149). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttcctccaaactcttcaagatcccagagtcagggctctatactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaaactctacgtttccct
catgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagwctatacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctcataaaacaaaaaggtggggctactcccttaacttcatgg
ggtatattattggaagttggggtaccttaccccaggaacatattgtattgaaaatcaaacagtgttttagaaaacttcct
gtaaacaggcctattgattggaaagtgtgtcaaagaattgtgggacttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctttgatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacgtataaggcctttc
tgaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtatgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgacaattctgttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgyctgcygtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccatcggaacytgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacgcgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctctatcgggaggcattagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttagaagatccagcttccagggaattagtagtcag
ctatgtcaatgttaacatgggcctaaaacttagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctgactttaatcctgattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgacaggtgtatacaatttgtgggacccctcacagtgaatgaaaaaaggagactaaaattgatcatgc
ctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgtagtt
aatcattacttccagacaagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggattccaacaaggtgggagtgggagcattcgggc
cgggatttactccacctcatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggacggcagcctactcccctgtctccgcctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY470960_FT00000_P-B Feature FT:source KY470960_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LYL-E11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgctgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgcattgtaggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacgaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggactgacaattctgtcgtgctttcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttctaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctcctgacttcttcccttccattcgagatctcctcgacaccg
cctctactctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggctctcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaat
tttacggggctttattcttctacggtaccttgctttaatcctcaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaaatggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881731_FT00000_P-B Feature FT:source KY881731_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate control-01). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaattctgtctcggccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaacaaccagcaccggaccatgcaaaacatgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcactttgccacaggaacatattgtacaaaaaatcaaattgtgttttaagaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcacggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgccaaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttaccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactccccccgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctacatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaatcatgc
ctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgaggcattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacacgatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattccgccccatgggggactgttggggtggagccctcaggctcagggcatacttacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881740_FT00000_P-B Feature FT:source KY881740_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate control-02). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaattctgtctcggccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaacaaccagcaccggaccatgcaaaacatgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcactttgccacaggaacatattgtacaaaaaatcaaattgtgttttaagaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcacggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgccaaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttaccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactccccccgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctacatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaatcatgc
ctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgaggcattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacacgatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattccgccccatgggggactgttggggtggagccctcaggctcagggcatacttacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881796_FT00000_P-B Feature FT:source KY881796_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient-01). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggatcatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttcacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tggcaacgaccgaccttgaggcatacttcaaagactgtgtgtttacggagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacaccgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctgctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcccgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttaccgtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttctatcccaatgttactaaatatttgcctttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaaccagcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881844_FT00000_P-B Feature FT:source KY881844_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient-04). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagaccccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacgaaaaatcacaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggccttcc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgacccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggtgttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtgtgctcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctacatcgggaggccttagagtctccggaacattgtacacctcaccatacagcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacacttcctgtcttacttttggaagagaag
ttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccgtggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtacgcaatttgtggggccccttaccgtaaatgaaaccaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtgtcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgacaggaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttgaggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctctaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccgtacagtggaa
>gnl|hbvnuc|KY881849_FT00000_P-B Feature FT:source KY881849_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient-04). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagactactgtctctcccacatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcgtggccaaaattcgcagtccc
aaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccagaccgtgcagaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttactgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaaccaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacacaaaatcaaaatgcgttttcggaaacttcct
gtaaacaggcctcttgattggaaagtatgtcaacgaattgtgggtcttttgggctttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tccgtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcttttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataagttggtgcgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcagacaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcatatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccatcaaatgcccctatctta
tcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttaatattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctctaatcctgaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaccaggagactaaacttaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttaaataaagggatcaaaccgtattatccagagtatgtagtt
gatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcaccagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
tagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagggacactcatcctca
ggccatgaagtggaa
>gnl|hbvnuc|LC279268_FT00000_P-B Feature FT:source LC279268_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ku_1st_child_serum). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaattatgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttagggtttgctgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttataaggcctttc
taagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatttgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccgtcggtgcgagacctcctagataccg
ctgctgctctgtatcgggaagctttagaatctcctgaacattgctcacctcaccacacagcactcaggcaagctattctg
tgctggggggaattaatgactctagctacctgggtgggaaataatttagaagatccagcatccagggatctagtagtcaa
ttatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttacggggctctattcttctacagtacctgtctttaattctgaatggcaaactccttcttttccagacattcatttaca
ggaggatattgttgatagatgtaagcaatttgtaggaccccttacagtaaatgaaaacaggagactaaaattaataatgc
ctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattactttcagacaagacattatttgcataccctttggaaggcgggtatcttatataaaagagagtctacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagtgggagcattcaggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacatctgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|LC279271_FT00000_P-B Feature FT:source LC279271_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ku_2nd_child_UC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaattatgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttagggtttgctgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttataaggcctttc
taagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatttgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccgtcggtgcgagacctcctagataccg
ctgctgctctgtatcgggaagctttagaatctcctgaacattgctcacctcaccacacagcactcaggcaagctattctg
tgctggggggaattaatgactctagctacctgggtgggaaataatttagaagatccagcatccagggatctagtagtcaa
ttatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttacggggctctattcttctacagtacctgtctttaattctgaatggcaaactccttcttttccagacattcatttaca
ggaggatattgttgatagatgtaagcaatttgtaggaccccttacagtaaatgaaaacaggagactaaaattaataatgc
ctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattactttcagacaagacattatttgcataccctttggaaggcgggtatcttatataaaagagagtctacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacatctgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|LC279273_FT00000_P-B Feature FT:source LC279273_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ku_mother_serum). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaattatgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttagggtttgctgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggctttcactttctcgccaacttataaggcctttc
taagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatttgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagctgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccgtcggtgcgagacctcctagataccg
ctgctgctctgtatcgggaagctttagaatctcctgaacattgctcacctcaccacacagcactcaggcaagctattctg
tgctggggggaattaatgactctagctacctgggtgggaaataatttagaagatccagcatccagggatctagtagtcaa
ttatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttacggggctctattcttctacagtacctgtctttaattctgaatggcaaactccttcttttccagacattcatttaca
ggaggatattgttgatagatgtaagcaatttgtaggaccccttacagtaaatgaaaacaggagactaaaattaataatgc
ctgctagattttatcctaatgttaccaaatatttgcccttagataaggggatcaaacattattatccagagcatgtagtt
aatcattactttcagacaagacattatttgcataccctttggaaggcgggtatcttatataaaagagagtctacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacatctgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF621878_FT00000_P-B Feature FT:source MF621878_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBVVZ0614). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtacagaacatggag
aacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcgtggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtatgaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggctccttgcctcaggaacacattgtacaaaaactcagatcatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggattcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtatttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctcctctgccgatccatactgcagaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggacggacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtttatgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcgctcaggcaagctattctg
tgttggggagagttaatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccatatagaccacaaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctaattttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgataggtgtaagcaatttgtgggacccctaacagtaaatgaaaacaggagattaaaattgattatgc
ctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaagccctattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagaccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccatacaaggacaactggccggatgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcttgttggggcgaagccctcaggctcagggcatactcacaacygtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674385_FT00000_P-B Feature FT:source MF674385_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV040009). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggga
cagtgagccctgctcagaatactgcctcagccacatcgtcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccgtttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggttccttgccacaggaacatattgtacaaaaaatcaaattatgttttcggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttctggggttcgctgccccttttacgcaatgtgg
atatcctgctttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctcctctgccgatccatactgcggaact
cctggcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaattctgtcgtgctatcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgtaccgaccatccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcaggaggccttagagtctccggaacattgttcagctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccatatagaccacaaaatgcccctatctta
tcaacacttccggaaactgctgttgttagacaacgatgcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgca
ggaagacattgttgataggtgtaagaaatttgtgggacccctaacagtaaatgaaatcaggagactaaaattaattatgc
ctgctagattttatcccaatgttaccaagtacttgcccttagataaaggaatcaaaccctattatcccgagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagatacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccacacaaggacaattggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacgacggtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674391_FT00000_P-B Feature FT:source MF674391_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV040022). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatatacccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaactgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttt
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatctttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgcccgcttctccgccttttgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctactcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactgttgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtctttcggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaaggaatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgagacattatttgcacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgtattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagttggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctctaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674397_FT00000_P-B Feature FT:source MF674397_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV040028). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggctccttaccacaggaacatattgtacaaaaaatcaaattatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtaggtcttttagggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtattcaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgccaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccacttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatatttcaaagactgtgtgtttactgagtgggaggagttaggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgca
ggaagacattgttgataggtgtaagcaatttgtgggacccctaacagtaaatgaaaacaggagattaaaattaattatgc
ctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacgacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccatacaaggacaactggccggatgccaacaaggtgggagtgggagccttcgggc
cagggtttacccctccccatgggggcttgttggggtggagccctcaggctcagggcattctcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcaacctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674405_FT00000_P-B Feature FT:source MF674405_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV040038). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggggttggggctccttgccacaggaacatattgtacagaaaatcaaatcatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttgtatgcatgtatacaagctaaacaagcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgacaattctgtcgtactatcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgtaccaaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgacaacggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtgggacccctaacaataaatgaaaacaggagactaaaattaattatgc
ctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccacacaaggacacttggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattcctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtccggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674431_FT00000_P-B Feature FT:source MF674431_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV040090). Complete genome. [Hepadnaviridae] (length=3194 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggctccttgccacaggaacatattgtacaaaaactcaaatcatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacaatatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgacaacggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggttgtactaggaggc
tgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcatgttcatgtcctact
gttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataaagaatttggagcttctgtgga
gttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccgcctctgctctgtatcgggagg
ccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctgtgttggggtgagttgatgaat
ctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcagctatgtcaatgttaatatggg
cctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaactgttcttgaatatttggtgt
cttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatcttatcaacacttccggaaactact
gttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcag
aagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaactttacggggctttattcttct
acggtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgcaggaggacattgttgataggtg
taagcaatttgtgggacccctaacaataaatgaaaacaggagactaaaattaattatgcctgctagattttatcccaatg
ttaccaaatacttgcccttagataaaggaatcaaaccctattacccagagcatgtagttaatcattacttccagacgaga
cattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtagcgcctcattttgcgggtcacc
atattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggcatggggacaaatctttctgtc
cccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactcagaaaatccagattgggacct
caatccacacaaggacaattggccggacgccaacaaggtgggagtgggagcattcgggccagggttcatccctccccatg
ggggcatgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagcacctcctcctgcctccaccaat
cggcagtccggaaggcagcctactcccttatctccacctctaagggacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MF674508_FT00000_P-B Feature FT:source MF674508_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VN05T0223). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
tagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactactgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgaatccctttatgccgctgt
taccaattttcttttgtctttgggtatacacttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggttccttgccacaggaacatattgtacaaaaaatcaaattttgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaattctgtcgtgctatcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttagggctctaccgcccgctcctccgtctgccgtaccggccaaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactgctgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctgtattcttctacggtacctaactttaatcctgattggcaaactccttcttttcctaacattcatttgca
ggaagacattgttgataggtgcaagcaatttgtgggacccctaacaacaaatgaaatcaggagactaaaattgattatgc
ctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatcccgagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggatcctgcattcaaagccaactc
agaaaatccagattgggacctcaatccacacaaggacaattggccgaacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674509_FT00000_P-B Feature FT:source MF674509_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VN05T0226). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaattctgcctctgccatatcgtcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggctccttgccacaggaacatattgtacaaaaaatcaaattatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtaggtcttttagggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtattcaggctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatttgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttatgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctaccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggcgaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttagaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatccgacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
cggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgcg
ggaggacattgttgataggtgtaagcaatttgtgggaccactaacagtaaatgaaaacaggagattaaaattaattatgc
ctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacgacacgtag
cgcctcattttgcgggtcaccttattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccatacaaggacaactggccggatgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcttgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MG571325_FT00000_P-B Feature FT:source MG571325_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 13536). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttccaggggggacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
cctgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtcattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaacaggcccattgattggaaagtatgtcaacgcattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgcacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgggtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgccaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataa
agaatttggagctcctgtggaattaatctcttttttgcctkctgacttctttccttctgctcgagatctymtcgacaccg
cctctgctctgtatcrggaggccttagagtctccggaacattgttcacatcaccatacggcactcaggcaagctattctg
tgttggggtgakttaatgaatctagccacctgggtgggaagtaatttggacgatccagcatccagggaattagtagtcaa
ctatgtcaacgktaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggmaagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcatatagaccacaaaatgcccctatctta
tcaacgcttccggaaactactgttgttagacaaagatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacaacaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgtcactaaatatttgcccttagacaaagggatcaaaccgtattatccagagtatgtagtt
gatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgtgggtcaccatattcgtgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggtcggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccacatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MG571352_FT00000_P-B Feature FT:source MG571352_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 25179). Complete genome. [Hepadnaviridae] (length=3215 residues).
cgccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcagaaa
cagtgagccctgctcagaatactgtctctgtcatatcgtcaaccttatcgacgactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgccttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttggggtttcgcaaaattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatattgatgatatggtattggggaccaaatctgtacaacatcttgagtccgtttctgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggggttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtaaccagtatctgaacctttaccccgttgctcggcaacggtctggcctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacctcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctcccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagtcgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacacgtataa
agaatttggagcttctgtggagttgctctcttttttgcctgctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctcctgaacattgtacagctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtaggaagcaatttggaagatccaggatccagggaattagtagtcac
ctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaag
ttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttattagacgaagaagcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctccatgttaatattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaaaaggagactaaaattaattatgc
ctgctaggttttaccccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacaagacattatttacatactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttcggggatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaagacaactggccggacgcccacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatacttacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagccaactcccttatctccacctctaagggacactcatcttca
gaccatgcaggggaa
>gnl|hbvnuc|MH061283_FT00000_P-B Feature FT:source MH061283_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate t4-2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttcacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tgagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgggtctcctctgccgatccatactgcggaact
tctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcgcctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatcttgctgtccccaatcccctgggattcttccccgagcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|X97851_FT00000_P-B Feature FT:source X97851_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctatgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtaagaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttcgtgacgcaaccccc
actggttggggcttgcctataggccatcagcgcatgcgtggaacctttgttgctcttctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagacagtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggtagtaatttgcaagatccagcatccagggaactagtagtcag
ttatgtcaacgctaatatgggcctaaagatcaggcaactattgtggtttcacatttcctgtctcacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggattttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcacgctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB014366_FT00000_P-B Feature FT:source AB014366_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 07D07HCC). Complete genome. [Hepadnaviridae] (length=3227 residues).
ttccaccactttccaccaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctccagttcaggaa
tagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgttttatcatc
tgcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaactatgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgctgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatccaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
tgagtaaacaatatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccggaacctgcccaaggtcttgcccaaggtcttgcataagaggactcttg
gactttcagcaatgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggag
gagattaggttaaaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcac
ctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacat
cgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccgtcggtgcgagatc
tcctagatactgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcaccacacagcaatcagg
caagctattctgtgctggggggaattaatgactctagcttcctgggtgggtaataatttacaagatccagcgtccaggga
tctagtagtcaattatgttaacactaacatgggcctaaagatcagacaattattgtggttccatatttcctgtcttactt
ttggaagaaccactgttctggaatatttggtgtcttttggagtgtggattcgcactcctcctccctacagaccaccaaat
gcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcc
tcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtatcccttggactcat
aaggtggggaactttacggggctttattcttctacagtacctgtctttaatcccgaatggcaaactccttcttttccaga
cattcatttgcaggaggacattgttgatagatgtaagcaatttgtgggaccccttacaataaatgaaaacaggagactaa
aattaataatgcctgctagattttatcctaaagttaccaaatatttgcccttagataaagggatcaaaccttattatcca
gagcatgtagttaatcattacttccagacgaggcattatttgcatactctttggaaggcgggtatcttatataaaagaga
gtctacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaa
cctcggaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcatt
caaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagtgg
gagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacatct
gtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaaggga
cactcatcctcagatcatgcagtggaa
>gnl|hbvnuc|AB073821_FT00000_P-B Feature FT:source AB073821_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi20). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgygtgtcytggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctcacaaaacaaaaagatggggatattcccttaactttatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaagataaaaatgtgttttcggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgcagcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaagacctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcccgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtatcgaccawccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaktaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctggggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagaygaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtatcccttggacwcayaaggtgggaaac
tttactgggctttattcttctackgtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctagattttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattctttcccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccacatgggggattgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB073833_FT00000_P-B Feature FT:source AB073833_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi59). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttttyctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcctggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggcgaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaatcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaaccttcgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctgatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaaatattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcttcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB073845_FT00000_P-B Feature FT:source AB073845_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ya16). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctctcccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaacccgcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaattaaactatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgctgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacaatatctgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctccaggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgcccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagctgggggaggagatgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtkgagttactctcttttttgccttctgacttctttccgtcggtgcgagacctactagataccg
ctgctgctctgtatcgggaagccttggaatctcctgaacattgctcacctcaccacacagcactcaggcaagctattctg
tgctgggtggaattaatgacgctagctacctgggtgggtaataatttagaagatccagcgtccagggatctagtagtcaa
ttatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctggaatatttggtgtcttttggagtgtggattcgcactcctcctccctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggactcataaggtgggaaac
tttacggggctctattcttctacagtgcctgtctttaatcctgaatggcaaactccttcttttccagacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagactaaaattaataatgc
ctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttgcatactctttggaaggcgggtatcttatataaaagagagtcaacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaacctttctgtccccaatccactgggattcttccccgatcatcagctggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacttctgtgccagcagct
cctcctcctgcctccaccaatcggcagtcagggaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB195935_FT00000_P-B Feature FT:source AB195935_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatattgatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacggattgtgggtcttttggggtttgccgccccgttcacgcaatgtgg
atatcctgcattaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccctgtggctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaacgagtgggaggagtcgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatattatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgcaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcgcacctccccatgggggactgttggggtggagccctcaggctcagggactactcacaacggtgccagcagtt
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB287328_FT00000_P-B Feature FT:source AB287328_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Ba 51). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacttttcaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttgtcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccgtcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctatacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacgttgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcacgacaggcttttactttctcgccaacttacaaggcctttt
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctataccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataaaaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcatatttcctgtcttacttttgggagagaaa
ctgttcttgaatacttggtgtcttttggagtgtggattcgcactcctcctgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaagctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY167094_FT00000_P-B Feature FT:source AY167094_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIb). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggnaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacanctcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcnccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcattcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgacaac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaggccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaggagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcntcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaagatccggcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgnggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacnaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctnaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgna
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacacgcacaaggacaactggccggacgccaacaaggtgggagccggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY220703_FT00000_P-B Feature FT:source AY220703_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcagaaa
tagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaagaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
acgggttggggcttggccattggccatcagcgcatgcgtgggacctttgtgtcaccactgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcggaactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggttg
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaacttagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactccttccgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgttttaatcctaactggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacaataaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccactcgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctatctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggaagccaacaaggtgggagtgggaacattcgggc
cagggttcacccctccccatggggggctgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggagactcatcctca
ggccatgaagtggaa
>gnl|hbvnuc|AY518556_FT00000_P-B Feature FT:source AY518556_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 57-1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagattggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaacgcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaagctcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagtaa
tgtcagcgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
catctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggaagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY800389_FT00000_P-B Feature FT:source AY800389_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ZY041024). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccccgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacaccagtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatattgatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttcacttcatgg
gatatgtaattgggggttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgtgtgcaaggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggacgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacccttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcgggaatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ463787_FT00000_P-B Feature FT:source DQ463787_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 928-9_1979). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgagtgtcttggccaaaattcgcagttcc
aaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctttgcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctttataccgctgt
taccaattttcttatgtctttgggtatacatttgaaccctcagaaaacaaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggcacattaccgcaagaacacatcgtgtcaaaaatcaaacaatgttttagaaaacttcct
gtaaacagacctattgattggaaggtatgtcaacgaattgtgggtcttttgggatttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctttatatgcatgtatacaatctaaacaggcttttactttctcgccaacttataaggcctttc
tacacaaacaatatttgaacctttaccccgttgctcggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattcggttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgttccgaccgaccac
ggggcgtacctctctttacgcggcctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttatataagaggactcttggactttcatcaa
tgtcaatgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctctttcttgcctgctgacttctttccgtcggttcgggatctcctagacaccg
cctctgctttgtatcgagaagccttagagtctcctgaacattgctcgcatcaccatacagcaatcaggcaagctgttttg
tgctggggggaattaatgactctagcttcctgggtgggtagtaatttagacgatccagcatccagagacctagtagtcaa
ttatgttaacattaacatgggactaaagatcaggcaattattgtggtttcacctttcctgtattacctttgggaaagaca
ctgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggactcataaggtggggaac
tttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcccaacatacatttgca
ggaggacattattaataggtgtcaacaatttgtgggacccctcacagtaaatgaaaaaaggagactaaaattgatcatgc
ctgctaggttttttcctaatactactaaatatttgcccttagataaaggaatcaaaccttattatcccgagcatgtagtt
aatcattatttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagaaacaacgcgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctgtctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcgttcaaagccaactc
cgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cgggattcactcctctccatgggggactattggggtggagccctcaggctcagggcatactcacatctctgccagcagct
cctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctccacctctaagagacactcatcctca
agccatgcagtggaa
>gnl|hbvnuc|EF134945_FT00000_P-B Feature FT:source EF134945_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G247-B3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccccgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaagaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatacgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tgagcaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttatttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttcggacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatacgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcagactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggcatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaaccgcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
caggtttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctctaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EF134946_FT00000_P-B Feature FT:source EF134946_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G247-B5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaagaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacctcatgg
gatacgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
ctatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tgagcaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacatcctttatttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttcggacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatacgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcagactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggcatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaaccgcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
caggtttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EF473972_FT00000_P-B Feature FT:source EF473972_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1839Java). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcagaaa
cagtaaaccctgttcagaacactgtctcttccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcagaaaacaaaaagatggggctactcccttaacttcatgg
ggtatgtaattggaagttggggcaccttaccccaagaacatattgtgttgaaaatcaaacaatgctttaggaaacttcct
gtaaacagacctattgattggaaggtgtgtcaacgaattgtgggtcttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaagcttttactttttcgccaacgtataaggcctttc
taaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgacaattctgttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctagtgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattttg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagaccctgcatcccgggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctagctttaatcctaaatggcaaactccttcctttcctgacattcatttgca
ggaggacatcattaataggtgtgaacaatttgtgggacccctcacagtgaatgaaaacaggagactaaaattgattatgc
ctgctaggttctatcccaatgttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaacgagagacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcctccaaacctcgacaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagtgggagcattcgggc
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaagtgtgccaacagct
cctcctcctgcctccaccaatcggcagttaggaaggaagcctactcccctgtctccgcctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EF473973_FT00000_P-B Feature FT:source EF473973_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH45AChinese). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctccgaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctgttgattggaaagtatgtcaacgtattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctctccaacttacaaggcctttc
taagtaaacagtatctaaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaaccttcgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgactcctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
ggttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgcccggtcgcagacgatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgattggcaaactccttcctttcctgacattcatttgca
ggaggacattgttgatagatgtgaacaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cgggattcactcctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagagacactcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|EU796067_FT00000_P-B Feature FT:source EU796067_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttattggagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggcttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccgacttataaggcctttc
taagtaaacagtatatgaacctttaccccgttgcctggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccttaggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactgggtcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagcggactcttggactttcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctactcgacaccg
cctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcatttgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU919175_FT00000_P-B Feature FT:source EU919175_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient34). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttgtcctct
aattccaggatcttcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccccaggaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaacctcatcgggactgacaattctgtcgtgctctcacgcaagt
atacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgacccctggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgaatgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctactattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacggcaatcaggcaagctattctc
tgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaatattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaagtggcaaactccttcttttcctgacattcatttgaa
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaaagttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacgcgtag
cgcctcattttacgggccaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctgtctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctataagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ032358_FT00000_P-B Feature FT:source FJ032358_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1607-10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcccccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttggcaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtggcccgtttgtcctct
aattccaggatcatcaacaaccagtaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcaatttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccacgtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttgtgtctttgggtatacatgtaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagctggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtacacagtatctgaacctttaccccgttgcacggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttcttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggccgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctatggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctgttctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaggtccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcgttcaaagccaattc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcggtggaa
>gnl|hbvnuc|FJ349236_FT00000_P-B Feature FT:source FJ349236_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C15). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaacgatggggatactcccttaatttcatgg
gatatgtaattggaagttggggctccttgccacaggaacatattgtacaaaaactcaaattatgttttaggaaacttcct
gtcaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggttcgctgccccttttactcaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaagctaaacaggcttttactttttcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttctgtctcctctaccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaacttatcgggactgacaattctgttgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctccaggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagacccccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgataggtgtaagcaatttgtgggacccttaacagtaaatgaaaacagaagattaaaattaattatgc
ctgctagattttttcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatccagagcatgtagtt
aatcattactttcagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacgacacgtag
cgcttcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccacacaaggacaactggccggatgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcttgttggggtggagccctctggctcagggcatactcacaactgtgccagcagca
cctccttctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ386655_FT00000_P-B Feature FT:source FJ386655_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S121). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaacccttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgctttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcgtgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tgagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccctcccggggccgcttggggctctatcgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgccttcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ562231_FT00000_P-B Feature FT:source FJ562231_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I44). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttgtcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacagaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagctggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttcggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcctgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtactgggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacacag
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaacttagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgtacttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttaatagatgtgagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattgattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
gatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggtttacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccatcaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ562237_FT00000_P-B Feature FT:source FJ562237_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I53). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaggcctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttagggtttgccgcccctttcacgcaatgtgg
ctatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccttaggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaraccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ctgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctgttctg
tgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgttttaatcctacatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattctttcccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaactcgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ562254_FT00000_P-B Feature FT:source FJ562254_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I87). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccgctttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaacgatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcaccttgccacaggaacatattgtacaaaaaatcaaattgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcctgttttgctcgcagcaggtctggggcaacactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccatcaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccgtggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377582_FT00000_P-B Feature FT:source GQ377582_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J131). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacttttcaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaactttatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacgaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgctgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggcacctttgtgtctccactgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcaaaaaaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctgctcgacaccg
ctactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggctctcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggtctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggttccttgctttaatcctacatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
gatcattacttccagacgcgacattatttacacaccctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
tagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
ccacctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377606_FT00000_P-B Feature FT:source GQ377606_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J171). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcacatcaggactcctaagacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattatacaaaaactcaaaatgtgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcgtgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaatgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattagatta
atgatctttgtactgggaggctgtaagcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactgaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagttag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
cggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctcgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaccaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttacgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgccttcaaagccaactc
agaaaatccagattgggacttcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatatttacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagggacactcatcctca
ggccatacagaggaa
>gnl|hbvnuc|GQ377644_FT00000_P-B Feature FT:source GQ377644_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J294). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgttgtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagttggcctcagcccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccctttatgccgctgt
tacccattttcttttgtctttgggcatacacttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gctatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttggggtttgccgcccctttcacgcagtgtgg
atatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtaaccagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggcacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaatctcatcgggactgacaattctgtcgtactctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctatcgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactctcggactgtcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggcggagggtaggtta
atgagctttgtactggtaagctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtcgagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacggcaatcaggcaatgtattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ttatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagaggaagacgcaggtcccctagaagaagaactccatcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgcg
ggaggacattgttgatagatgtaaacaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
tagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccaccgctaagggacactcaccctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ924611_FT00000_P-B Feature FT:source GQ924611_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M28). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaatcgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagccagacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattmtg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagaccaccaaatgcccctatctta
tcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactcctttttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815558_FT00000_P-B Feature FT:source GU815558_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacagcaacatattgtacaaaaaatcaaaatgtgttttcggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcgtggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctcctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggattaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctacttacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcggcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815581_FT00000_P-B Feature FT:source GU815581_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccaccttccaccaaactcttcaagattccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccaatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttccggatattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcctttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacaagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccttgggatttttccccgatcatcagttggaccctgcattcaaagccaactc
agcaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtaggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815595_FT00000_P-B Feature FT:source GU815595_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccaatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttccggatattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcctttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacaagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccttgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtaggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815644_FT00000_P-B Feature FT:source GU815644_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcacggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaagaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacacgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815656_FT00000_P-B Feature FT:source GU815656_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 11.D1.5-11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagcggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaagaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtattcaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaagctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacacgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815725_FT00000_P-B Feature FT:source GU815725_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgcctcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccaccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccgaaacctgcccaaggtcttgcatcagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgctactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815759_FT00000_P-B Feature FT:source GU815759_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctctattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctaacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaaggttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcaaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattcctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815765_FT00000_P-B Feature FT:source GU815765_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaaccccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctctattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctaacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcaaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattcctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU815767_FT00000_P-B Feature FT:source GU815767_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaacggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctctattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctaacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcaaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattcctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JN792897_FT00000_P-B Feature FT:source JN792897_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IT2009). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgcctctgccatatcgtcaatcttaccgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggagacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacaccttgagtccctttatgccgctgt
taccaattttcttctgtctttgggtatacatttgaaccctcagaaaacaaaacgttggggttactcccttaacttcatgg
gatatgtaattggragttggggcacattaccgcaagaacacatcgtgtcaaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgacttgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctttatatgcatgtatacactctaaacaggcttttactttctcgccaacttataaggcctttc
tcaacaaacaatattcgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattcggttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttatataagaggactcttggactttcagcaa
tgtcaatgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagtctaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctctttcttgccttctgacttctttccgtcggttcgggatctcctagacaccg
cctctgctctgtatagggatgccttggagtctccggaacattgctcgcctcaccatacagcaatcaggcaagctattttg
tgctggggcgaattaatgactctagctacctgggtgggtaataatttagacgatccagcatccagagacctagtagtcaa
ttatgttaacactcacatgggactaaagatcaggcaattattgtggtttcacatttcctgtattacctttgggagagata
ctgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagactccgacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggactcataaggtgggaaac
tttacggggctgtattcttctacggtacctgtctttaatcctgaatggcaaactccttctttccctaacatacatttgca
ggagaacattattgataggtgtaaacaatttgtgggacctctcacagtaaatgaaaacaggagactaaaattgatcatgc
ctgctaggttttttcctaatactactaaatatttgcccttagataaaggaatcaaaccttattatcccgagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagaaacaacacgtag
cgcctcattttgtgggacaccatattcttgggaacaagagctacatcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcgttcaaagccaactc
cgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatactcacatctctgccagcagct
cctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctttctccacctctaagagacactcatcctca
agcaatgcagtggaa
>gnl|hbvnuc|JN792898_FT00000_P-B Feature FT:source JN792898_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IT2004). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggagacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacaccttgagtccctttatgccgctgt
taccaattttcttctgtctttgggtatacatttgaaccctcagaaaacaaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggcacattaccgcaagaacacatcgtgtcaaaaatcaaacaatgttttagaaaacttcct
gtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctttatatgcatgtatacaatctaaacaggcttttactttctcgccaacttataaggcctttc
taaacaaacaatattcgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattcggttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttatataagaggactcttggactttcagcaa
tgtcaatgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagtctaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctctttcttgccttctgacttctttccgtcggttcgggatctcctagacaccg
cctctgctctgtatagggatgccttggagtctccggaacattgctcggctcaccatacagcaatcaggcaagctattttg
tgctggggcgaattaatgactctagctacctgggtgggtaataatttagacgatccagcatccagagacctagtagtcaa
ttatgttaacactcacatgggactaaagatcaggcaattattgtggtttcacatttcctgtattacctttgggagagata
ctgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagactccgacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggactcataaggtgggaaac
tttacggggctgtattcttctacggtacctgtctttaatcctgaatggcaaactccttctttccctaacatacatttgca
ggagaacattattgataggtgtaaacaatttgtgggacctctcacagtaaatgaaaacaggagactaaaattgatcatgc
ctgctaggttttttcctaatactactaaatatttgcccttagataaaggaatcaaaccttattatcccgagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagaaacaacgcgtag
cgcctcattttgtgggacaccatattcttgggaacaagagctacatcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcgttcaaagccaactc
cgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatactcacatctctgccagcagct
cctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctttctccacctctaagagacactcatcctca
agcaatgcagtggaa
>gnl|hbvnuc|JQ429081_FT00000_P-B Feature FT:source JQ429081_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 09.80.055). Complete genome. [Hepadnaviridae] (length=3218 residues).
ctccaccacgttccaccaaactcttcagatcgatcccagagtcagggctctgtaccttcctgctggtggctccagttcag
gaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgttccgaacatg
gagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaat
accacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagt
cccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatc
atcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcc
tctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttc
cctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatac
ctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccc
cactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgc
tgttaccaattttcttttgggtttgggcatacatttaaaccctcagaaaacaaaaagatggggctactcccttaacttca
tgggatatgtaattggaagttggggcaccttaccccaagaacatattgtgttgaaaatcaaacaatgttttagaaaactt
cctgtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggatttgctgctcctttcacacaatg
tggttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcatttactttttcgccaacgtataaggcct
ttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaacc
cccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcgga
actcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcggaactgacaactctgtcgtcctttcccgca
aatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcg
gcgctgaatcccgcggacgacccctcccggggccgcttagggctctaccgcccgcttctccgcctgccgtaccgaccgac
cacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctc
tgcacgtcgcatggagaccaccgtgaacgcccatcggaacctgcccaaggtcttgcataagaggactcttggactttcag
caatgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggtgaggagatcagg
ttaatgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgccta
atcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgta
taaagaatttggagcttctggagagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgaca
ccgcctctgctctctatcgggaggccttagagtctccggaacattgctcacctcaccatacggcactcaggcaagctatt
ctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcctcccgggaattagtagt
cagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagag
aaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgcatatagaccaccaaatgcccctatc
ttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacg
aaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcacaaggtggga
aattttacggggctttattcttctacggtacctagctttaatcctcaatggcaaactccttcctttcctgacattcattt
gcaggaggacatcattaataggtgtaaacaatttgtgggaccccttacagtgaatgaaaacaggagactaaaattgatta
tgcctgctaggttctatcccaatgttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgta
gttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacg
tagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcgacaa
ggcatggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaa
ctccgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagtgggagcattcg
ggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaactgtgccaaca
gctcctcctcctgcctccaccaatcggcagttaggaaggaagcctactcccctgtctccacctctaaaagacactcatcc
gcaggcagtgcagtggaa
>gnl|hbvnuc|JX661476_FT00000_P-B Feature FT:source JX661476_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1227-B14). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
tacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacacaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttggggtttgccgccccgttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcatactaggaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccctggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttccggacattcatttgca
ggaggatattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaactccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JX661480_FT00000_P-B Feature FT:source JX661480_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1210-B6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacttttcaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
tgcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaagaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctatggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccggcatccagggaattagtggtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattgattatgc
ccgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774417_FT00000_P-B Feature FT:source KC774417_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate bxn1028). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggtccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattggaagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctggtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
agaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatggtactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggagggcggggatcttatataaaagagagtccacacgtag
cgcctcatttttcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacatctggccggacgccaacaaggtgggagtgggagcattcggga
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactatgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173297_FT00000_P-B Feature FT:source KJ173297_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FH008C(e46n)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagactactgtctctgccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaagagcatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgacaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccatccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccctataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggtctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtgaacaatatgtgggccctctaacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacaccctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcaaagccaactc
agacaatccagattgggacctcaacccgcacaaggacaactggccggacgccaatcaggtcggagtgggagcattcgggc
cagggttcaaccctccccagggcgatctgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcgggaaggcaccctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173367_FT00000_P-B Feature FT:source KJ173367_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P006-C(B1)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
ggtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtgattgggggttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtaggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctctaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggaccgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaactaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
tgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaagctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacacacatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173408_FT00000_P-B Feature FT:source KJ173408_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate N13-C(4198B)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gttatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttttcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcacctgcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatacttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaggatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ803796_FT00000_P-B Feature FT:source KJ803796_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MY711763). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactgtccaccaaactcttctagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaaaccctgttcagaacactgcctctcccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccgtttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcagaaaacaaaaagatggggctattcccttaacttcatgg
ggtatgtaattggaagttggggcaccttaccccaagaacatattgtgttgaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggatttgctgctcctttcactcaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttttcggcaacgtataaggcctttc
taaacaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggactgacaattctgttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgtcttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattggggag
ttgggggatgttctaaggggatggaaggctaaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacggtaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggatagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctacggtacctagctttaatcctaagtggcaaactccttcctttcctgacattcatttgca
ggaggacctcattaataggtgtgaacaatttgtgggaccccttacagtgaatgaaaaaaggagactaaaattgattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccatattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcagggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccttgcattcaaagccaactc
agaaaatcccgattgggacctcaacccgcacaaggacaactggccggactccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacacgcatcctca
agccatgcagtggaa
>gnl|hbvnuc|KM213035_FT00000_P-B Feature FT:source KM213035_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MRG-k1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctcggacatatcgtcaatcttatcgacgactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctaggggggacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccctgcaagacctgcacagctcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccacgtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatataattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaagatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtaaccagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcagctcaccatacggcactcaggcaagctatcctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttgggagagaca
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcccactgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaactggcaaactccttctttccctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttaccaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggattttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacacctggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KM213036_FT00000_P-B Feature FT:source KM213036_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CSW-k1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccagactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaaaatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagacttgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttgctagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcctgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagagaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaacaccttctttccctgacattcatttgaa
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagacttaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatcccgagtatgtagtt
gatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattctgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatggggggctgttgggttggagccctcaagctcaaggcctattcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148327_FT00000_P-B Feature FT:source KP148327_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D243-3-41). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatgtgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagccggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccatcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctatcctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagacaaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactaacaaatgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148343_FT00000_P-B Feature FT:source KP148343_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D282-10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagctggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttagggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcacaacaggcttttactttctcgccaacttacaaggccttcc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccggccgactac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagactaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148374_FT00000_P-B Feature FT:source KP148374_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-20). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaatatggag
aacatcgcatcaggactcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcgtcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcaccggaccatgcagaacctgcacgacccctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatattattggaagttggggcaccttaccccaggaacatattgtattgaaaatcaaacaatgttttagaaaacttcct
gtaaacagacctattgattggaaggtgtgtcaacgaattgtgggacttttgggattcgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttataaggcctttc
tgaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctttgccgatccatacggcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcgaaacttatcgggactgacaattctgttgtcctttcccacaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccac
ggggcgcgcctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattttg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgcatggcaaactccttcttttcctgacattcatttaca
ggaggacattgttaataggtgtaaacaatttgtgggacccctcacagtgaatgaaaacaggagactaaaattgatcatgc
ctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgtggtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggattccaacaaggtgggagtgggagcattcgggc
cgggattcgctccaccccatgggggactgtcggggtggagtcctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggacggcagcctactcccctatctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148380_FT00000_P-B Feature FT:source KP148380_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H11-3-20). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaatatggag
aacatcgcatcaggactcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagacccgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgctcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacgacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatattattggaagttggggcaccttaccccaggaacatattgtattgaaaatcaaacaatgttttagaaaacttcct
gtaaccagacctattgattggaaggtgtgtcaacgaattgtgggacttttgggattcgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttataaggccttcc
tgatcaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggtttggccataggccatcagcgcatgcgtgggacctttgtgtctcctttgccgatccatacggcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcgaaacttatcgggactgacaattctgttgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattttg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgcatggcaaactccttcttttcctgacattcatttaca
ggaggacattgttaataggtgtaaacaatttgtgggacccctcacagtgaatgaaaacaggagactaaaattgatcatgc
ctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgtggtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggattccaacaaggtgggagtgggagcattcgggc
cgggattcgctccaccccatgggggactgttggggtggagtcctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggacggcagcctactcccctatctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148440_FT00000_P-B Feature FT:source KP148440_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H75-26). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccaagttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaatatggag
aacatcgcatcaggactcctcggacccctgctcgcgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttccggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatattattggaagttggggcaccttaccccaggaacatattgtattgaaaatcaaacaatgttttggaaaacttcct
gtaaacagacctattgattggaaggtgtgtcaacgaattgtgggacttttgggattcgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttataaggcctttc
tgaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctttgccgatccatacggcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcgaaacttatcgggactgacaattctgttgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccaccggaacttgcccaaggtcttgcataagaggactcttggactttctgcaa
tgtcaacaaccgaccttgaggcatgcttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttgggatgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgcatggcaaactccttcttttcctgacattcatttaca
ggaggacattgttaataggtgtaaacaatttgtgggacccctcacagtgaatgaaaacaggagactaaaattgatcatgc
ctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgtggtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggattccaacaaggtgggagtgggagcattcgagc
cgggattcgctccaccccatgggggactgttggggtggagtcctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggacggcagcctactcccctatctccacctctaagagacactcatcctca
ggccatgcattggaa
>gnl|hbvnuc|KP148455_FT00000_P-B Feature FT:source KP148455_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Y167-3-10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccagactcttcaagatccaagagtcagagctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgtctcttccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaacaccagcaccggaccatgcagaacctgcacgactactgctcaaggaacctctttgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttctgttgtctctgggcatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatataattggaggttggggcaccttaccccaggaacatattgtattgaaaatcaaacaatgttttagaaaacttcct
gtaaacaggcctattgattggaaaatatgtcaacgcattgtgggtcttttgggattcgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggctttcactttctcgccaacttataaggcctttc
taaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtgtctccgctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattctgtcgttctttcccgaaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcatggggctctaccgcccgcttctccgtctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctcaccggaccctgcccaaggtcttacataagaggactattggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagctacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctctattcttctacggtacctaactttaatcctgaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttaataggtgtacacaatttgtaggccccctcacagtaaatgaaaaaaggagactaaaattgatcatgc
ctgctaggttctatcctaacgttactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtggtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagaaacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattccttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaactgtgccaacagct
cctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctcaacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148581_FT00000_P-B Feature FT:source KP148581_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Y300-16). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctcggccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttctcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccttgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacagaaaatcaaaatatgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgctgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tgagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctaccgatccatactgcggaact
cctggccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatcttgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP659220_FT00000_P-B Feature FT:source KP659220_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska-9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggag
cagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggasacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggracctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaartctgyacaacatcttgagtccgtttatgccgctgt
taccaattttcttgtgtctttgggtatacatttaaaccctcataaaacaaaacgttgggggtactcccttcacttcatgg
gatatgtaattggwagttggggtacattgcctcaggaacacatygtggcaaaaatcaagcaatgttttagaaaactgcct
gtaaacagacctattgattggaaggtgtgtcaacgcattgtgggtcttttgggatttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttataaggcctttc
taaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattccgttgtcctttcccgcaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggcccgtgtgcacttcgattcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttatataagaggactcttggactttcagcaa
tgtcaatgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagactaggtta
atgctctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgmaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctctttcttgccttctgacttcttcccgtcggttcgagatctcctagacaccg
cctctgccttgtatcgggaagccttagagtctcctgaacattgctcggctcaccatacagcactcaggcaagctattttg
tgctggggggaattaacgactctaggtacctgggtgggtaataatttgcaagatccagcatccagagaccaagtagtcaa
ttatgtcaacactaatatgggactaaaaatcaggcaattattgtggtttcacatttcctgtcttacctttgggagagaca
ctgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagacctccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggactcataaggtgggaaac
tttacagggctttattcttctacggtacctatctttaatccggaatggcaaactccttcttttcccaacatacatttgca
ggaaaacattattgataggtgtacacaatttgtgggacccctcacagttaatgaaaccaggagactaaaattgatcatgc
ctgctaggttttatcctaatactactaaatatttgcccttagataaaggaattaaaccctattatccagagcacgtagtt
aatcattacttccagacaagacattatttacatactctttggaaggcgggtgtcttatataaaagagaaacaacgcgtag
cgcctcattttgtggatccccatattcttgggaacaagagctacatcatgggaggttggtcttccaagcctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
caggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatactcacaactctgccagcagct
cctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctccacctctaagagacactcatcctca
agccatgcagtggaa
>gnl|hbvnuc|KP659245_FT00000_P-B Feature FT:source KP659245_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Canada-0B-571_2012). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtacttccctgctggtggctccagttccggga
cagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatagcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagartctagactcgtggtggacttctctcaattttctagggggaayacccgagtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtccyct
aattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcaatggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggcacattacctcaagaacacatcgtgtcaaaaatcaaacaatgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgcattgtgggtcttttgggatttgctgccccttttacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatccaagctaaacaggcttttactttctcgccaacttataaggcctttc
taaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattcggttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccagaacctgcccaaggtcttacataagaggactcttggactttcagcga
tgtcaatgaccgaccttgaggcatacttcaaagactgtgtatttactgagtgggaggagtcgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctctttcttgcctattgacttctatccgtcggttcgagatctcctagacaccg
ccgctgctttgtatcgggaagccttagagtctcctgaacattgctcgcctcaycatacagcactcaggcaagccattttg
tgctggggggaattaatgactctagctacctgggtgggtaataatttacaagatccagcatccagagacctagtagtcaa
ttatgttaacactaacatgggactaaagatcaggcaattattgtggtttcacatttcctgtcttacctttgggagagaaa
cagttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatccta
tcaacacttccggaaactrctattattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagaccaag
atctcaatcaccgcgtcgcagaagaactcgatctcgggattcccaatgttgatattccttggactcataaggtgggaaac
tttacggggctttactcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctagcatacatttgca
ggaaaacattattgataggtgtgaacaatttgtgggacccctcacagtaaatgaaaaaaggagactgaaaatgatcatgc
ctgctaggttttttcctaatactactaaatatttgcccttagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagaaacaacacgcag
cgcctcattttgtggatcaccatattcttgggaacaagagctacatcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatactcacatctctgccagcagct
cctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctttctccacctctaagagacactcatcctca
agccatgcagtggaa
>gnl|hbvnuc|KU234318_FT00000_P-B Feature FT:source KU234318_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaactctcacaaaacaaaaaggtggggatattcccttaatttcatgg
gatatgtaattgggagttggggctccttgccacaggaacatattgtacaaaaactcaaatcatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggttcgctgccccttttacacaatgtgg
atatcctgctttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacaatatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgaccacggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagaccgtgtgtttactgagtgggaggagttgggggaggagtttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagttag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgataggtgtaagcaatttgtgggacccctaacaataaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatggcaaagtggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatccacacaaggacaattggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagca
cctcctcctgcctccaccaatcggcagtccggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963822_FT00000_P-B Feature FT:source KU963822_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2_9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggcactgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagtaccggaccatgcaaaacctgcacaactcctgttcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttacatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggccttcc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccatccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtctcacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963830_FT00000_P-B Feature FT:source KU963830_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3_3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttctgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctgtgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggtagttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctcccgaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatctagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggggtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
agaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963832_FT00000_P-B Feature FT:source KU963832_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3_5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttctgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctgtgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggtagttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctcccgaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatctagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggggtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
agaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963833_FT00000_P-B Feature FT:source KU963833_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3_6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgttgtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttctgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctgtgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggtagttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctcccgaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatctagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggggtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
agaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963836_FT00000_P-B Feature FT:source KU963836_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3_9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttctgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctgtgggtatacatttaaaccctcataaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggtagttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctcccgaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatctagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggggtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
agaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963846_FT00000_P-B Feature FT:source KU963846_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 4_5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcacggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcaccgcaccatacggcactcaggcaagctattctg
tgttggggggagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattggtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccaaacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaattc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963950_FT00000_P-B Feature FT:source KU963950_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 11_6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
accatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaacccacacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagcaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaacactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaaccctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964081_FT00000_P-B Feature FT:source KU964081_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 20_3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcccaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatataattgggagttggggcacattgccacaggaacatattgtaacaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatacggcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaacactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacctataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgaagaggcaggccccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgagaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
gatcattacttccagacacgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggaatcctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964086_FT00000_P-B Feature FT:source KU964086_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 20_8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcccaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatataattgggagttggggcacattgccacaggaacatattgtaacaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatacggcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaacactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctattgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacctataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgaagaggcaggccccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgagaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
gatcattacttccagacacgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggaaccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964102_FT00000_P-B Feature FT:source KU964102_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 21_10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgatccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacaatatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctttcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttatccgcctgttgtaccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacagaaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaagtcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctaacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacttcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964146_FT00000_P-B Feature FT:source KU964146_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 24_9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttactgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcgacgactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaaccctaacaatacc
acagagtctagacttgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttggggaccaaatctgtacaacaccttgagtccctttataccgctgt
ttccaattttcttttgtctttgggtatacatttgaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggggttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccgtctgacttctttcctaatattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacatcaccatacggcactcaggcaagctattgtg
tgttggggtgagttaatgagtctagccacctgggtgggaagtaatttggaagatccatcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatttttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccgccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggcccctcacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagaaaaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccaaacgcgacattatttacacactctttggaaggcggggatcttatataaaagagaatccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttgggatggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964151_FT00000_P-B Feature FT:source KU964151_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 24_14). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcgacgactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaaccctaacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttggggaccaaatctgtacaacaccttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggggttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcaccaacttacaaggcctttc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcagaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccgtctgacttctttcctaatattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacatcaccatacggcactcaggcaagctattgtg
tgttggggtgagttaatgagtctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatttttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccgccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggcccctcacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagaaaaagggatcaaaccgtattatccagagtatgtagtt
aatcattactttcaaacgcgacattatttacacactctttggaaggcggggatcttatataaaagagaatccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttgggatggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964154_FT00000_P-B Feature FT:source KU964154_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 25_2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcatcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggacacctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctaccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactgggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctgctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagttag
ctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcttgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
agaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaacgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgtcactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagaatccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964163_FT00000_P-B Feature FT:source KU964163_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 25_11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcatcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggacacctaggacccctgctcgtgttacagggggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctaccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactgggaggctgtaggcataaattggtgtgtccaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagttag
ctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcttgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccatcttttcctgacattcatttgca
agaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaacgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgtcactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagaatccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964263_FT00000_P-B Feature FT:source KU964263_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 33_7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcata
tccctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacgaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctgttgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
ataccctgctttaatgcctttatatgcatgtatacaagcaaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttctaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccacaggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctggggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagcatccagggatttagtagtcgg
ctatgtcaacgttaatatgggcctaaaacttagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaaggggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaaacaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaaggttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964264_FT00000_P-B Feature FT:source KU964264_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 33_8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcata
tccctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacgaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctgttgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
ataccctgctttaatgcctttatatgcatgtatacaagcaaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttctaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccacaggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagggtaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctgatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctggggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagcatccagggatttagtagtcgg
ctatgtcaacgttaatatgggcctaaaacttagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaaggggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaaacaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaaggttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcccaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964265_FT00000_P-B Feature FT:source KU964265_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 33_9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcgaagactggggaccctgtaccgaacatggag
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
tccctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttctct
catgttgctgtacgaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacaattaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagctggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctgttgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
ataccctgctttaatgcctttatatgcatgtatacaagcaaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttctaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccacaggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctggggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagcatccagggatttagtagtcgg
ctatgtcaacgttaatatgggcctaaaacttagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaaggggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaaacaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaaggttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964275_FT00000_P-B Feature FT:source KU964275_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 34_4). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccaccaagttccaccaaacgcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatccgaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtaaacagtatctggacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatgggaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagtctaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgctcaccaataccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcaatcaggcaagctattctg
tgttggggtgatttgatgaatctagccacctgggtgggaagtaatgtggatgatccagcatccagggatttaatagtcgg
ctatgtcaacatgaatatgggactaaaattcagacaactattatggtttcacatttcctgtcttacttttgggagagacg
ttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctgctccatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagaggaaggggaagaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtg
ggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattca
tttgcaggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaaaaggagactaaaattaa
ttatgcctgctaggttttatccccatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagaatat
gtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccac
acatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttcgtcttccaaacctcga
aaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagc
caactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcat
tcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgcca
gcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcctctatctccacctctaagggacactca
tcctcaggcnnngcagtggaa
>gnl|hbvnuc|KX276773_FT00000_P-B Feature FT:source KX276773_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggcacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatwtaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtcattggaagttggggtacactgccacaggaacatattgtacaaaaaatccacatgtgttttmggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgctgcccctttcacgcaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagcaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtcctctcccgcaagt
atacatcayttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaycgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcag
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctacttttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccgtctgacttctttccttctgttcgagatctcctcgacaccg
cctytgctctgtatcgggaggctttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagacctccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgcttcaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaatcaatttgtggggccccttacagtaaatgaaaaaaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctctctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatacttgcaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX276799_FT00000_P-B Feature FT:source KX276799_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
maatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtrtctgcggcgttttatcatc
tkcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacractcctgctcaaggaacctctaygtttccct
catgttgctgtacmaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtmgggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaartctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaatttcatgg
gatatgtaattgggagttggggcactttgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctatcgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaaacctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcraaactcatcgggactgacaattctgtcgtgctctcccgcaart
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatgggaacctgcccaaggtcttgtataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcwtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgcctwctgacttctttccttctgttcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacrgcactcaggcaagctattctr
tgttggggtgagttaatgaayctagccacctgggtgggaggtaatttggaagatccagcatccagggaactagtagtcag
ctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcacrtttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaamtggcaaactccttcttttcctracattcatttgca
ggaggacattrttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctagrttttatcccaacgttactaaatatttgcccttagataaagggatcaaaccrtattatccagagtatgtagtt
aatcattacttccaaacgcracattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccrcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcagrctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggmagcctactcccytmtctscacctctragggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881752_FT00000_P-B Feature FT:source KY881752_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate control-02). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaattctgtctcggccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaacaaccagcaccggaccatgcaaaacatgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcactttgccacaggaacatattgtacaaaaaatcaaattgtgttttaagaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcacggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgccaaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttaccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactccccccgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctacatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaatcatgc
ctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgaggcattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacacgatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcattccgccccatgggggactgttggggtggagccctcaggctcagggcatacttacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881784_FT00000_P-B Feature FT:source KY881784_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient-01). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
tagtgagccctgctcagaatactgtctcgtccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggatcatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaacccacacaaaacaaaaagatggggatattcccttcacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctccgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcaccgggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tggcaacgaccgaccttgaggcatacttcaaagactgtgtgtttacggagtggaaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctgctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactgctgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcccgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttaccgtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttctatcccaatgttactaaatatttgcctttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagatacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacttcaaccagcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881790_FT00000_P-B Feature FT:source KY881790_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient-01). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
tagtgagccctgctcagaatactgtctctcccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggatcatgcaaaacctgcacgactcctgctcaaggaacctctatgttcccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttcacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tggcaacgaccgaccttgaggcatacttcaaagactgtgtgtttacggagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgctcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctgctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactgctgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttctttccctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttaccgtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttctatcccaatgttactaaatatttgcctttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagatacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacttcaaccagcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881826_FT00000_P-B Feature FT:source KY881826_FT00000_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient-03). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacttttcaccaaactcttcaagatcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggacacctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttatgccgctgt
taccaattttcttttgtctttgtgtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatatcgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaaat
atacatcctttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggaattgggggaggagattaggtta
gtgatctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagtcactctcttttttgccttctgacttctttccttctattcgagatctgctcgacaccg
cctctgctctgcgtcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagcaattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacgcataaggtgggaaac
tttacggggctttattcttctacggtaccatgctttaatcctaactggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ccgctaggttttatcccaaggttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggcgacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctc