HBVdb

Dataset for nucleotide sequence C of genotype B

[Download (right click)] [Alignment] [Repertoires]

3070 sequence(s)

>gnl|hbvcds|AB010289_C_P-B Feature FT:CDS AB010289_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccgtcggt
gcgagacctcctagataccgccgctgctctgtatcgggaagcattagaatctcctgaacattgctcacctcaccacacag
cactaaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaagatccagca
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatacttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB010290_C_P-B Feature FT:CDS AB010290_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctacggagttaatctcttttttgcctgctgacttctttccgtcggt
gcgagaccttctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacatcaccacacag
cactcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttacaagatccagcc
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB010291_C_P-B Feature FT:CDS AB010291_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactacggagttaatctcttttttgcctgctgacttctttccgtcggt
gcgagacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacatcaccacacag
cactcaggcaagctactctgtgctggggggaattaatgactctagctacctgggtgggtaataatttacaagatccagcc
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB010292_C_P-B Feature FT:CDS AB010292_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-4). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactactgagttactctcttttttgccttctgacttctttccgtcggt
gcgagacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcaccacacag
cactcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttacaagatccagcc
tccagggatctagtagtcaattatgttaacactaccacgggcctaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgttag
>gnl|hbvcds|AB014366_C_P-B Feature FT:CDS AB014366_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 07D07HCC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccgtcggt
gcgagatctcctagatactgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcaccacacag
caatcaggcaagctattctgtgctggggggaattaatgactctagcttcctgggtgggtaataatttacaagatccagcg
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcagacaattattgtggttccatatttcctg
tcttacttttggaagaaccactgttctggaatatttggtgtcttttggagtgtggattcgcactcctcctccctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB023663_C_P-B Feature FT:CDS AB023663_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate case 12). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttatttgacttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggccacaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AB023667_C_P-B Feature FT:CDS AB023667_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate case 72). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctactgacttctttccttccat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgctggggtgagttgatgaatctagccacctgggtgggaggtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaacttagacaactattgtggtttcacatttcctg
ccttacttttggaagagaagttgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagatcccgaggcagggcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB023677_C_P-B Feature FT:CDS AB023677_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate case 23). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctctttttggccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcttttctctgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB023682_C_P-B Feature FT:CDS AB023682_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate case 78). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccatttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagatccagca
tcccgggaattagtagtcggctatgtcaatgttaatatgggcctgaaactcagacaactattgtggtttcacatttcctg
tcttatgtttggaagagacactgtacttgagtttttggtgtcttttggagtgtggattcgcactcctcaagcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcggagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB031261_C_P-B Feature FT:CDS AB031261_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV VietA-2). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB031263_C_P-B Feature FT:CDS AB031263_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV VietA-5). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB031264_C_P-B Feature FT:CDS AB031264_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV VietF-1). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacatggttcagctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaagttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB031266_C_P-B Feature FT:CDS AB031266_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV VietF-3). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
acgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB031267_C_P-B Feature FT:CDS AB031267_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV VietF-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcttctgctctgtatcgggaggccttagagtctccggaacatatttcacctcaccatacgg
cactcaggcaagctattctatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggggtgtggattcgcactccttctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB031268_C_P-B Feature FT:CDS AB031268_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV VietF-7). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB033554_C_P-B Feature FT:CDS AB033554_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate RTB299). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcc
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctccagcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|AB033555_C_P-B Feature FT:CDS AB033555_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAD744). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcc
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccccgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB048705_C_P-B Feature FT:CDS AB048705_C_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
tcgagatctcctcgacaccgcctccgccctgtatcgggaggccttagagtctccggaacattgctcacctcaccataccg
cactcaggcaagctatactgtgttggggggagttaatgaatctggcaacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctctcgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB073821_C_P-B Feature FT:CDS AB073821_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi20). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagaygaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|AB073822_C_P-B Feature FT:CDS AB073822_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi32). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacstataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB073823_C_P-B Feature FT:CDS AB073823_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi35). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cagcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|AB073824_C_P-B Feature FT:CDS AB073824_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttaatctcttttttgcctgctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacgg
cactcaggcaagctattctgtgttggggggagttaatgaatctagccacctgggtgggaagtaatttggatgatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagcaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cgcaaaatgcccctatcttatcaacacttccggaaactactgttgttagaccacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB073825_C_P-B Feature FT:CDS AB073825_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi51). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctcccgaacattgtacagctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacctgtcctg
tcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgcatatagac
cagcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB073826_C_P-B Feature FT:CDS AB073826_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi89). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB073827_C_P-B Feature FT:CDS AB073827_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HK11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB073828_C_P-B Feature FT:CDS AB073828_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HK37). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB073829_C_P-B Feature FT:CDS AB073829_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HK38). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB073830_C_P-B Feature FT:CDS AB073830_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TH57). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttctgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcrgctatgtcaacgttaatatgggcctaaaamtcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacrcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|AB073831_C_P-B Feature FT:CDS AB073831_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TH61). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcatcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctactgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB073832_C_P-B Feature FT:CDS AB073832_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Th65). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctactgacttctttcctkctgt
acgagatctgctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtwcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
gccagggaattagtagtcaactatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
ycttacttttggragacaaactgtccttgaatatttggtctcttttggagtgtggattcgcactcctcctccatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagaggaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttaa
>gnl|hbvcds|AB073833_C_P-B Feature FT:CDS AB073833_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi59). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaaatattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB073834_C_P-B Feature FT:CDS AB073834_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Vi16). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattggtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB073835_C_P-B Feature FT:CDS AB073835_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Vi29). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctgt
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB073836_C_P-B Feature FT:CDS AB073836_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw25). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacatgtttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaacctagccacctgggtgggaggtaatttgaacgatcaagca
tccagggaagcagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacgtttcctg
tcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB073837_C_P-B Feature FT:CDS AB073837_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ku1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctggagagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgctggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgttaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB073838_C_P-B Feature FT:CDS AB073838_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ho7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccgtcggt
gcgagacctcctagataccgctgctgccctgtatcgggaagcattagaatctcctgaacattgctcagctcaccacacag
cactcaggcaagctrttctgtgctggggggaattaacgactctagstacctgggtgggcaataatttagaagatccagca
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctccgccctacagac
caccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacaacgaygcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctaaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB073839_C_P-B Feature FT:CDS AB073839_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw174). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggatttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgtacacctcaccatacag
cactcaggcaagcgattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacgtttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatacagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AB073840_C_P-B Feature FT:CDS AB073840_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw36). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctggatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaagataagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB073841_C_P-B Feature FT:CDS AB073841_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw30). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctacggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggaataaaactaagacaattattgtggtttcacctttcctg
tcttatgtttggaagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB073842_C_P-B Feature FT:CDS AB073842_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Iw11). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccgtcggt
gcgagatctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcaccacacag
cactcaggcaagctattgtgtgctggggggaattaatgactctagctacctgggtgggtaataatttacaagatccagcg
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgttag
>gnl|hbvcds|AB073843_C_P-B Feature FT:CDS AB073843_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Iw27). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtcggt
gcgagacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacatcaccacacag
cactcaggcaagctattctgtgctggggggaattaacgactctaggtacctgggtgggtaataatttacaagatccagcg
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB073844_C_P-B Feature FT:CDS AB073844_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-T11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccgtcggt
gcgagacctcctmgataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcaccacacag
ctctcaggcaagctattctgtgctgggtggaattaatgactctagctacctgggtgggtaataatttacaagatccagca
tccagggatctagtagtcaattatgttaacactaacatgggcttaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgctag
>gnl|hbvcds|AB073845_C_P-B Feature FT:CDS AB073845_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ya16). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtkgagttactctcttttttgccttctgacttctttccgtcggt
gcgagacctactagataccgctgctgctctgtatcgggaagccttggaatctcctgaacattgctcacctcaccacacag
cactcaggcaagctattctgtgctgggtggaattaatgacgctagctacctgggtgggtaataatttagaagatccagcg
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctggaatatttggtgtcttttggagtgtggattcgcactcctcctccctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB073846_C_P-B Feature FT:CDS AB073846_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry565). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccgtcggt
gcgggacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcaccacacag
cactcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaagatccagcg
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccacgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB073847_C_P-B Feature FT:CDS AB073847_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Fu53). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgctgagttactctcttttttgccttctgacttctttccgtcgat
acgagacctcctagataccactgctgctctgtatcgggaagccttagaatctcctgaacattgctcagctcaccacacag
caatcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtagtaatttacaagatcaagcg
tccagggatctagtagtcaattatgttaacattaacatgggcctaaagttcaggcaattattgtggtttcacatgtcctg
tattacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB073848_C_P-B Feature FT:CDS AB073848_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HUS). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccgtcggt
gcgagacctcctagataccgctgctgctctgtatcgggaagctttagaatctcctgaacattgctcacctcaccacacag
cactcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggaaataatttagaagatccagca
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB073849_C_P-B Feature FT:CDS AB073849_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Na101). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggaattactctcttttttgcctcaagacttctttccgtcgat
tcgagacctcctagataccgctgctgcactgtatcgggawgccttagaatctcctgaacattgcacacctcaccacacag
cactcaggcaagctattctgtgttggggggaattaatgactctagctacctgggtgggtaataatttacaagatccagcg
tccagggacctagtagtcaattatgttaacactaatatgggcctaaagctcaggcaattattgtggtttcacntntcctg
tcttatgtttggaagggaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctatagac
caccaaatgcccctatcttatcaacacttccggaaacttstgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcrccgcgtcgcagaagatctcaatctagggaaccccaatgttag
>gnl|hbvcds|AB073850_C_P-B Feature FT:CDS AB073850_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Na102). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccgtcggt
gcgagatctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgtacattgctcacctcaccacacag
cactcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttagacgatccagcg
tctagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattgttgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgctag
>gnl|hbvcds|AB073851_C_P-B Feature FT:CDS AB073851_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctatccgtcggt
gcgggacctcctagacaccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcaccacacag
cactcaggcaagctgttctgtgctggggggaattaatgactctagctacctgggtgggtaacaatttagacgatccagcg
tccagggacctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB073852_C_P-B Feature FT:CDS AB073852_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttaatctcttttttgccttctgacttctttccgtcggt
gcgagacctcctagataccgcgactgctctgtatcgggacgccttagaatctcctgaacattgcacacctcaccacacag
cactcaggcaagctgttctgtgttggggggaattaatgactctagctacctgggtgggtaataatttacaagatccagcg
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttaa
>gnl|hbvcds|AB073853_C_P-B Feature FT:CDS AB073853_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry24). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtcggt
gcgagatctcctagataccgccgctgctctgtttcgggatgccttagaatctcctgaacattgctcacctcaccacacag
caatcaggcaagctatcgtgtgctggggggaagtaatgactctagcttcctgggtgggtaataatttacaagatccagca
tccagggacctagtagtcgattatgttaacactcacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tattatttttggaagagaagttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttga
>gnl|hbvcds|AB073854_C_P-B Feature FT:CDS AB073854_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry30). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtcggt
gcgggacctcctagataccgcttctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcaccatacag
caatcaggcaagctattctatgctgggtggaattaatgactctagcttcctgggtgggtcagaatttacaagatcaagcg
tccagggacctagtagtcaattatgttaacactaacatgggactaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttgaaagagaagttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttga
>gnl|hbvcds|AB073855_C_P-B Feature FT:CDS AB073855_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry34). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgaccattataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtcggt
gcgggacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcaccacacag
cactcaggcaagcttttctgtgctggggggaattaatgactctagctacctgggtgggtaataatttacaagatccagcg
tccagggacctagtggtcaattatgttaacactcacatgggactaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgagggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgttag
>gnl|hbvcds|AB073856_C_P-B Feature FT:CDS AB073856_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry46). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccgtcggt
gcgggacctcctagacaccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcaccacacag
ctctcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttagacgatccagcg
tccagggacctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacgtttcttg
tattacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaatccttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcataagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB073857_C_P-B Feature FT:CDS AB073857_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry48). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcttttttgcctactgacttctttccgtcggt
gcgggacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcaccacacag
caatcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttacaagatccagcg
tccagagacctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tattacttttggaagagatactgttctagaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccactgttag
>gnl|hbvcds|AB073858_C_P-B Feature FT:CDS AB073858_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Shin). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgcggagttactctcttttttgcctgctgacttctatccgtcggt
gcgagacctcctagataccgctactgctctatatcgggaagccttagaatctcctgaacattgcacagctcatcacacag
cactcaggcaagctattctgtgctggggagaattaatgactctagctacctgggtgggtaataatttacaagatccagcg
tctagggatctagtagtaaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaacttgtgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctaggggatcccaatgttaa
>gnl|hbvcds|AB100695_C_P-B Feature FT:CDS AB100695_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-VH133). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagagcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacgg
cactcaggcaagctattctgtgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattggtagtcagccatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatccccccttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB106884_C_P-B Feature FT:CDS AB106884_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactttcttttttgcctcctgacttctttccgtcggc
gagagacctcctagataccgccgctgctctgtatcgggaagccttagaatctcctgaacattgctcaccccaccacacag
cactcaggcaagctrttctgtgctggggggaattaatgactctagctacctgggtgggtaataatttrcaagatccagca
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tcttatgtttggaaaagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
cacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB115551_C_P-B Feature FT:CDS AB115551_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-CB15). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccctctgacttttttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattggtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB117759_C_P-B Feature FT:CDS AB117759_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-CB14). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195933_C_P-B Feature FT:CDS AB195933_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195934_C_P-B Feature FT:CDS AB195934_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195935_C_P-B Feature FT:CDS AB195935_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB205119_C_P-B Feature FT:CDS AB205119_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-IF687-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB205120_C_P-B Feature FT:CDS AB205120_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-IF687-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB205121_C_P-B Feature FT:CDS AB205121_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-IF720-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccgtcggt
gcgagacctcctagataccgcggctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcaccacacag
cactcaggcaagctatcctgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaagatccagcg
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB205122_C_P-B Feature FT:CDS AB205122_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-VH69-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctacggagttactctcttttttaccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtggtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttggaagagaaactgttgttgaatatttggtgtcttttggagtgtggattcgcactcctactccatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB212625_C_P-B Feature FT:CDS AB212625_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VT1026). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttcctactat
tcgagatcttctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgtacttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaacaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB212626_C_P-B Feature FT:CDS AB212626_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VT1022). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB219426_C_P-B Feature FT:CDS AB219426_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4014, PNN1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB219427_C_P-B Feature FT:CDS AB219427_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4075, PNN2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacactgtacacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacctttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB219428_C_C-B Feature FT:CDS AB219428_C_C-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4076, PNN3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacactgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB219429_C_P-B Feature FT:CDS AB219429_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4101, PNN4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacactgttcacctcaccatacgg
ctctcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttagaagatccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaacttttgtggtttcacatttcctg
tcttacttttggaagagaaacggttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgcatataggc
caccaaatgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB219430_C_P-B Feature FT:CDS AB219430_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4148, PNN5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatcttctcgacaccgcctctgctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcc
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB231909_C_P-B Feature FT:CDS AB231909_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VH10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctgctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cacccaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattaatagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtttcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB241116_C_P-B Feature FT:CDS AB241116_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PhHCC03). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctacggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacactgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaagatccagca
tccagggaattagtggtcggctatgtcaatgttaatatgggcctaaaactcagacaactgttgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB241117_C_P-B Feature FT:CDS AB241117_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PhHCC05). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctacggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacactgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtggtcggctatgtcaatgttaatatgggcctaaaactcagacaactgttgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB246339_C_P-B Feature FT:CDS AB246339_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcatatttcctg
tcttacttttgggagagaaactgttcttgaatacttggtgtcttttggagtgtggattcgcactcctcctgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB246340_C_P-B Feature FT:CDS AB246340_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB246341_C_P-B Feature FT:CDS AB246341_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccgtcggt
gcgagatctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcaccacacag
cactcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaagatccagcc
tccagggatctagtagtcaattatgttaacactaatatgggcctaaagatcaggcaattattgtggtttcacatttcttg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB246342_C_P-B Feature FT:CDS AB246342_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccgtcggt
gcgagacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcaccacacag
cactcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaagatccagca
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB246343_C_P-B Feature FT:CDS AB246343_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccgtcggt
gcgagacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcaccacacag
cactcaggcaagctattctgtgctgggtggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacgtttcctg
ccttatgtttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB287314_C_P-B Feature FT:CDS AB287314_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska433). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctctttcttgccttctgacttctttccgtcggt
tcgagatctcctagacaccgcagctgctttgtatcgggaagccttagagtctcctgaacattgctctcctcaccatacag
cactcaggcaagctattttgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaagatccagca
tccagagacctagtagttaattatgttaacactaacatgggactaaagatcaggcaattattgtggtttcacatttcctg
tcttacctttggaagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB287315_C_P-B Feature FT:CDS AB287315_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska419). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctctttcttgccttctgacttctttccgtcggt
tcgagatctcctagacaccgcagctgctttgtatcgggaagccttagagtctcctgaacattgctctcctcaccatacag
cactcaggcaagctattttgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaagatccagca
tccagagacctagtagttaattatgttaacactaacatgggactaaagatcaggcaattattgtggtttcacatttcctg
tcttacctttggaagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB287316_C_P-B Feature FT:CDS AB287316_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska427). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtcggt
tcgagatctcctagacaccgcatctgctttgtatcgggaagccttggagtctcctgaacattgcacttctcaccatacgg
cactcaggcaagctattttgtgctggggggaattaatgactctagctacctgggtgggtaataatttacaagatccagca
tccagagacctagtagttaattatgttaacactaacatgggactaaagatcaggcaattattgtggtttcacatttcctg
tatttgctttggaagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagtcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB287317_C_P-B Feature FT:CDS AB287317_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska416). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacttataaagaatttggagctactgtggagttactctctttcttgcctgatgacttctttccgtcggt
gcgagatctcctagacaccgccgctgctttgtatcgggaagccttagagtgtcctgaacatcgctcgcctcaccatacag
caatcaggcaagctattgtgtgctggggggaattaatgactctagcttcctgggtgggtaataatttacaagatccagca
tccagagatctagtagttaattatgttaacactcacatgggactaaagatcaggcaattattgtggtttcacatttcctg
tattatctttgggagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatacagac
caccaaatgcccctatcttatcaatacttccggaaactactgttgttagacgacgaggcaggtcccctggaagaagaact
ccctcgcctcgcagacgaagatctaaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB287318_C_P-B Feature FT:CDS AB287318_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgcggagttactctctttcttgcctaatgacttctttccgtcggt
tcgagatctcctagacaccgccgctgctttgtatcgggaagccttagagtctcctcaacattgctcgcctcaccatacag
caatcaggcaagctgtgttgtgctggggggaattaatgactctagcttcctgggtgaataataatttacaagatccagca
tccagagacctagtagttaattatgttaacactcacatggcactaaagatcaggcaattattgtggtttcacgtttcctg
tattatgtttgggagaaacactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctggaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB287319_C_P-B Feature FT:CDS AB287319_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AlaskaG23). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctctttcttgccttctgacttctttccgtcggt
gcgagatctcctagacaccgcctctgctctgtatcgggaagccttagagtctcctgaacattgctcgcctcaccatacag
caatcaggcaagctattttgtgctggggggaattaatgactctagctacctgggtgggtagtaatttagacgatccagca
tccagagacctagtagtcaattatgtcaacattaacatgggactaaagatcaggcaattattgtggtttcacctttcctg
tattacctttgggagagatactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB287320_C_P-B Feature FT:CDS AB287320_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacttataaagaatttggagcttctgtggagttactctctttcctgccttctgacttctttccgtcggt
tcgagatctcctagacaccgccactgctttgtatcgggaagccttagagtctcctgaacattgctcggctcaccatacag
cactcaggcaagctattgtgtgctggggggaattaacgaccctaggtacctgggtgggtaataatttacaagatccagca
tccagagaccaagtagtcaattatgttaacactaacatgggactaaagattagacaattattgtggtttcatatttcctg
tattacctttggaagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|AB287321_C_P-B Feature FT:CDS AB287321_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctctttcttgcctgctgacttctatccgtcggt
tcgagatctcctagataccgccgctgctttgtatcgggaagccttagagtctcctgaacattgctcgccccatcatacag
cactcaggcaagctattttatgctgggtggaattaatgactctagctacctgggtgggtaataatttagaagatccagca
tccagagacctagtagtcaattatgttaacactaacatgggactaaagatcagacaattattgtggtttcacatttcctg
tcttacctttggaagagagactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactgctattattagacgacgaggcaggagccctagaagaagaact
ccctcgcctcgcagacccagatctcaatcaccgcgtcgcagaagatctcaatctcggggaccccaatgttag
>gnl|hbvcds|AB287322_C_P-B Feature FT:CDS AB287322_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtcggt
tcgagatctcctagataccgcctctgctttgtatcgagaagccttagagtctcctgaacattgctctgctcaccatacag
cactcaggcaagctattttgtgctggggggaattaatgactctagcttcctgggtgggtaataatttaaatgatccagca
tccagagacctagtagtcaattatgttaacactaacatgggactaaagatcagacaattattgtggtttcacatttcctg
tcttacctttggaagagagactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB287323_C_P-B Feature FT:CDS AB287323_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctctttcttgcctactgacttctatccgtcggt
tcgagatctcctagataccgcctctgctttgtatcgggaagccttagagtcttctgaacattgcacgcctcaccatacag
cactcaggcaagctattttgtgctggggggaattaatgactctagctacctgggtgggtaataatttacaagatccagca
tccagagacctggtagttaattatgttaacactaacatggggctgaagatcagacaattattgtggtttcacatttcctg
tcttacctttgggagacaagttgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagaccaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB287324_C_P-B Feature FT:CDS AB287324_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-5). Partial genome (Contains: HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgcggagttactctctttcttgccttctgacttctttccgtcggc
tcgagatctcctagataccgcctctgctttgtttcgggaagccttagagtctcctgaacattgctcatctcaccatacag
cactcaggcaagctattttgtgctggggggaattaatgactctagctacctgggtgggtaataatttacaagatccagca
tccagagacctagtagtcaattatgttaacactaacatgggactaaagatcagacaattattgtggtttcacatttcctg
tatttcctttgggagagacactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgatgcaggtccactggaagaagaact
ccctcgcctcgcagaccaagatctaaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB287325_C_P-B Feature FT:CDS AB287325_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctctttcttgcctactgacttctttccatcggt
tcgagatctcctagataccgcctctgcgttgtatcgggaagccttagagtctcctgaacattgctcgcctcaccatacag
cactcaggcaagctattttgtgctggggggaattaacgactctaggtacctgggtgggtaataatttacaagatccagca
tccagagaccaagtagtcaattatgttaacactaatatgggactaaagatcagacaattattgtggtttcacgtttcctg
tcttacctttggaagagagactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB287326_C_P-B Feature FT:CDS AB287326_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Bj A44). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccgtcggt
gcgagacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcatcatacag
cactcaggcaagctattctgtgctgggtggaattaatgactctagctacctgggtgggtaataatttacaagatccagcg
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB287327_C_P-B Feature FT:CDS AB287327_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Bj A53). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttccgtcggt
gcgagacctcctagataccgctgctgctctgtatcgggaagccctagaatctcctgaacattgctcacctcaccatacag
cactcaggcaagctgttctgtgctggggggaattaatgactctagctacctgggtgggtaataatttacaagatccagcg
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
ccttacttttggaagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
ctgcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgcaggtctaaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB287328_C_P-B Feature FT:CDS AB287328_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Ba 51). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcatatttcctg
tcttacttttgggagagaaactgttcttgaatacttggtgtcttttggagtgtggattcgcactcctcctgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB287329_C_P-B Feature FT:CDS AB287329_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Ba A55). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggaattactctcttttttgccttctgatttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB300364_C_P-B Feature FT:CDS AB300364_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB300370_C_P-B Feature FT:CDS AB300370_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient12). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcctcaggacttctttccgtcggt
gcgagacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcaccacacag
cactcaggcaagctattctgtgttggggggaattaatgactctagctacctgggtgggtaataatttacaagatccagcg
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tattacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctagggaaccccaatgttag
>gnl|hbvcds|AB300371_C_P-B Feature FT:CDS AB300371_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient13). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgcctcctgacttctttccgaacat
acgagacctcctagatactgctgctgctttgtatcgggatgccttagaatctcctgagcactgctcacctcaccacacag
cactcaggcaagctattctgtgctggggggatgtaatgaatctagccacctgggtgggcactaatttacaagattcaggg
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatgaggcaattattgtggtttcacatttcctg
tcttacttttggaagagaaaccgttcttgaatatttggggtcttttggagtgtggattcgcactcctcctgcctacagac
cacaaaatgcccctatcttatcaactcttccggaaactactgttgttagacaacgaggcaggtcctctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgctag
>gnl|hbvcds|AB302095_C_P-B Feature FT:CDS AB302095_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgctgagttactctcttttttgcctcctgacttctttccgtcggc
gcgagacctcctcgataccactgctgctctgtatcgggaagccttagaatctcctgaacattgctcatctcaccacacag
ccctcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttacaagatccagcg
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacgtttcctg
tattatgtttggaagagacactgttgttgaatttttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactgctgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB302942_C_P-B Feature FT:CDS AB302942_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3837NN). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttgcaagatcaagca
tccagggaagcagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcatatagac
caccaaatgcctctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB302943_C_P-B Feature FT:CDS AB302943_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3639NN). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttgcaagatcaagca
tccagggaagcagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB302944_C_P-B Feature FT:CDS AB302944_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3641NN). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttgcaagatcaagca
tccagggaagcagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcatatagac
caccaaatgcctctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB302945_C_P-B Feature FT:CDS AB302945_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3643NN). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcaccttaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttgcaagatcaagca
tccagggaagcagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcatatagac
caccaaatgcctctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB334299_C_P-B Feature FT:CDS AB334299_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3UC). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagacctcctcgacaccgcctcagccttgtatcgggaggccttagagtctccggagcattgctcacctcaccatacag
ccctcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttagaagacccagca
tcaagagaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tctcacatttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB334300_C_P-B Feature FT:CDS AB334300_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 5UC). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagacctcctcgacaccgcctcagccttgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
ccctcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttagaagacccagca
tccagagaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tctcacatttggaagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacgatctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB334301_C_P-B Feature FT:CDS AB334301_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6UC). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagacctcctcgacaccgcctcagccttgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
ccctcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttagaagacccagca
tccagagaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tctcacatttggaagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacgatctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB334302_C_P-B Feature FT:CDS AB334302_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 16UC). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgggacctccttgacaccgcctcagctttgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
ccctcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttagaagacccagca
tccagagaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcatatttcctg
tctcacatttggaagagaaacggttcttgaatatttggtgtcctttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB334303_C_P-B Feature FT:CDS AB334303_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 21UC). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctcctcgacaccgcctcagcgttgtatcgggaagccttagagtctccggaacattgttcacctcaccatacag
ccctcaggcaagctgttctgtgttggggtgagttaatgaatctagctacctgggtgggtagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctgaaaattagacaactattgtggtttcacatttcctg
tctcacatttggaagagaaacagttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB355453_C_P-B Feature FT:CDS AB355453_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 25UC). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctactgcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB355454_C_P-B Feature FT:CDS AB355454_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 29UC). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctcctcgacaccgcctcagcgttgtatcgggaagccttagagtctccggaacattgttcacctcaccatacag
ccctcaggcaagctgttctgtgttggggtgagttaatgaatctagctacctgggtgggtagtaatttggaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctgaaaattagacaactattgtggtttcacatttcctg
tctcacatttggaagagaaacagttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB355455_C_P-B Feature FT:CDS AB355455_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 33UC). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagacccagca
tctagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcttg
tcttacttttggaagagaaactgttcttgaatatttagtttcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB362933_C_P-B Feature FT:CDS AB362933_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttttatccgtcggt
gcgagacctcttagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcaccacacag
caatcaggcaagctgttctgtgctggggggaattaatgactctagcttcctgggtgggtaataatttacaagatccagca
tccagggatctagtagttaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tattacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB365445_C_P-B Feature FT:CDS AB365445_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BOL1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggcaatttggaagatcaagga
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacagctattgtggtttcacatttcctg
tcttatgtttgggagagaaactgttctggaatatttggtgtcttttggagtgtggattcgcactcctgctgcatatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB368295_C_P-B Feature FT:CDS AB368295_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctat
tcgagatcttctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctgttgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctacgtcaatgttaatatgggcctaaaaatcaggcaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AB471854_C_P-B Feature FT:CDS AB471854_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F5M-F). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB471855_C_P-B Feature FT:CDS AB471855_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F5M-C). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB493827_C_P-B Feature FT:CDS AB493827_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 25UC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcganatcttctcaaccccgttttggttttgtatcggggggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctactgcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB493833_C_P-B Feature FT:CDS AB493833_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB493835_C_P-B Feature FT:CDS AB493835_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P30). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgatgccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaaggaatctagccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgcatatagac
ctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB555498_C_P-B Feature FT:CDS AB555498_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TA41). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccagaacattgttcacctcaccatacgg
caatcaggcaagctattctatgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattaatagtcggctatgtcaacgttaatatgggcctaaaagtcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|AB555499_C_P-B Feature FT:CDS AB555499_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TA62). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactaaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggaaagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagaggaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgttag
>gnl|hbvcds|AB642093_C_P-B Feature FT:CDS AB642093_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BFJT1999-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccattataaagaatttggagcttctgtggagttactctcttttttgcctywkgacttctttccgtcggt
gcgrgatctcctagatacygcykytgctctgtatcgggatgccttagaatctccwgaacattgctcacckcaccatacag
cactcaggcaagctatcctgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaygatccagca
tccagggacctagtagtcaattatgttaacactmatatgggcctaaagatcaggcaattattgtggtttcacctttcctg
tattwsttttggaasggacaccgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
cascaaatgcccctatcttatcaacacttccggaaactactgttrttagacgacgagtcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgctag
>gnl|hbvcds|AB642094_C_P-B Feature FT:CDS AB642094_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BFJT1999-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggggtgtggattcgcactcctactgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB642101_C_P-B Feature FT:CDS AB642101_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BFJT2009-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccattataaagaatttggagcttctgtggagttactctcttttttgcctcaggacttctatccgtcggt
gcgggatctcctcgataccgctgctgctctctatcgggaagccttagaatctcctgaacattgctcacctcaccacacag
cactcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttacaagatccagca
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagatactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctagggaaccccaatgttag
>gnl|hbvcds|AB675676_C_P-B Feature FT:CDS AB675676_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 10A37). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB713527_C_P-B Feature FT:CDS AB713527_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv30). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatctagctacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB713528_C_P-B Feature FT:CDS AB713528_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv44). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttggaagagaaacggttcttgaatatttggtctcttttggggtgtggattcgcacccctactgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB713529_C_P-B Feature FT:CDS AB713529_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv68). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgggggaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacgccgcctctgctctgtatcgggaggccttaaagtctccagaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcccgggatttgatagtcagctaagtcaatgttaatatgggcctaaaaatcagaccactattgtggtttcacatttcctg
tcttaattttggaaaagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcaagcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB713530_C_P-B Feature FT:CDS AB713530_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv94). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaagcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tgccgggatttgatagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcaagcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB713531_C_P-B Feature FT:CDS AB713531_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv98). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctat
tcgagatcttctcgacaccgcctccgctttgtatcgggaggccttagagtctccggaacactgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtctctttcggagtgtggattcgcactcctactgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB713532_C_P-B Feature FT:CDS AB713532_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv132). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatctagctacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcaaacaactattgggggttcccattttcgg
tcgtacttttagaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB828708_C_P-B Feature FT:CDS AB828708_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HB12-0626). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactacggaattactctcttttttgcctattgacttctttccgtcggt
gcgagatctcctagataccgctgctgctttgtatcgggaagccttagaatctcctgaacattgctcagctcaccacacag
cactcaggcaagctgttctatgctggggggaattaatgactctagctacctgggtgggtaataatttagacgatccagcg
tccagggatttagtagtcaattatgttaacactaacatgggcytaaagatcaggcaattattgtggtttcacatttcctg
tmttatgtttggaagagawactgttcttgaatwtttggtgtcttttggagtgtggattcgcactcctcctscmtacagac
caccaaatgcccctatcttatcaacacttccggaaactgctgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcrccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|AB900095_C_P-B Feature FT:CDS AB900095_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtcggt
gcgagacctccttgatactgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcatctcaccacacag
cactcaggcaagctattctgtgctggggggaattaatgactttagctacctgggtgggtaataatttacaagatccagcg
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
ccttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggatccgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB900096_C_P-B Feature FT:CDS AB900096_C_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtcggt
gcgagacctcctagacaccgctgctgctctgtatcgggaagccttagaatctcctgaacatgtctcacctcaccacacag
ctctcaggcaagctgttttgtgctggggggaattaatgactctagctacctgggtgggtggtaatctagacgatccagcc
tccagggacctagtagtcaattatgttaacactaacatgggcttaaagaccaggcaattattgtggtttcacatttcctg
tctcacttttggaagagacgttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
cacaaaatgcccctatcttatcaacacttccggaaactgctgttattagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgtcag
>gnl|hbvcds|AB900097_C_P-B Feature FT:CDS AB900097_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgttgagttactctcttttttgcctgctgacttttttccttcggt
gcgagacctcctagataccgctgctgctctgtatcgggaagccctagaatctcctgaacattgctcacctcatcacacag
caatcaggcaagctgttctgtgctggctggaattaatgactctagctaactgggtgggcaataatttacaagatccagca
tctagggatatggtagtcaattatgttaacactaacatgggtctaaagatcaggcaattactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgccgacgcaggtctcaatcgccgcgtcgcagaagatctcaatctagggaaccccaatgttag
>gnl|hbvcds|AB900098_C_P-B Feature FT:CDS AB900098_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgycgagttavtctcttttttgccttctgacttctttccgtcggt
gcgagatctcctagataccgctgctgctctgtatcgggaagcyttagaatctcctgaacattgttcacctcaccacacag
cactcaggcaagctattctgtgctggggggaattaatgactctagccacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaacactaayatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcatttggagtgtggattcgcactcctcctccctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|AB900102_C_P-B Feature FT:CDS AB900102_C_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgaccattataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctatccgtcggt
gcgggaccttctagacaccgctactgctctgtatcgggaagccttagaatctcctgaacattactcacctcaccacacag
cactaaggcaagctattttgtgctggggggaattaatgaatctagctamctgggtgggtaataatttacaagatccagcc
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcctatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgttgg
>gnl|hbvcds|AB900103_C_P-B Feature FT:CDS AB900103_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgcggagttactctcttttttgcctcatgacttctttccgtcggc
gcgagacctcctagataccgctgctgctctgtaccgggaagcattagaatctcctgaacattgctcacctcaccacacag
cactcaggcaagctattctgtgctggggggaattaacgactctaggtacctgggtgggtaataatttacaagatcaagca
tccagggatctagtagtcaattatgttgacactaacatgggcctaaagatcagacaattattgtggtttcacatctcttg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttaa
>gnl|hbvcds|AB900104_C_P-B Feature FT:CDS AB900104_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtcggt
gcgagacctcctagataccgctgctgctctgtatcgagaagccttagaatctcctgaacattgcacacctcatcacacag
cactcaggcaagctattctgtgctgggtggaattaatgactctagcttcctgggtgggcaataatttgcaagatccagcg
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagatactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB900105_C_P-B Feature FT:CDS AB900105_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgttgagttactctcttttttgcctgctgacttctttccgtcggt
gcgagacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcagctcaccatacag
caatcaggcaagctattctgtgctggggagaattaatgactctagcttcctgggtgggtaataatttacaagatccagcg
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tattacttttggaagagatactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB900106_C_P-B Feature FT:CDS AB900106_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccattataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtcggt
gcgagacctcctagataccgcgactgctctgtatcgggaagccttagaatctcctgaacattgcacatctcaccacacag
cactcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggcaataatttacaagatcccgcg
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcatg
tcttacttttggaagagatactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacaacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB900107_C_P-B Feature FT:CDS AB900107_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctacttcggagttactctcttttttgccttctgacttctttccgtcggt
gcgagatcttctagataccgccgctgctctgtatcgggaagccttagaatctcctgaacattgctcagctcaccacacag
cactcaggcaagctgttctgtgctggggggaattaatgactctagccacctgggtgggtaataatttacaagatccagca
tccagggacctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB900108_C_P-B Feature FT:CDS AB900108_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccgtcggt
gcgagacctcctagataccgctactgctctgtatcgggaagccttagaatctcctgaacattgctcacctcaccacacag
caatcaggcaagcttttctgtgctggggggaattaatgactctagctacctgggtgggtgataatttagacgatccagcg
tccaggaatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tattacttttggaagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttrttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccgatgttag
>gnl|hbvcds|AB900110_C_P-B Feature FT:CDS AB900110_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgccgcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
caatcaggcaagctattatatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccatca
tccagggaagcagtagtcggctatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagatactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctgctgcatatagac
cagcaaatgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB900111_C_P-B Feature FT:CDS AB900111_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=555 residues).
atggacattgacccttataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctatccgtcggt
gcgagatctcctagataccgccgctgctctgtatcgggatgcattagaatctcctgaacattgctcagctcaccacacag
cactcaggcaagctgttctgtgctggggggaattaatgactctagctacctgggtgggtaataatttagacgatccagca
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatacttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagaggacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggatcgatcccaatgttag
>gnl|hbvcds|AB900112_C_P-B Feature FT:CDS AB900112_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcctcaagacttctatccgtcggt
gcgagacctcctagataccgcttctgctctgtatcgggaagccttagaatctcctgaacattgctctcctcaccacacag
caatcaggcaagctattctrtgctggggggaattaatgactctagctacctgggtgggtaataatttagacgatccagcg
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggttccacatttcctg
tcttacttttggaagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacggggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB908299_C_P-B Feature FT:CDS AB908299_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagagactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|AB908300_C_P-B Feature FT:CDS AB908300_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattaatagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagagactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|AB908303_C_P-B Feature FT:CDS AB908303_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctctggaacattgttcacctcaccatacag
cactcaggcaagctattctttgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagagactgttcttgagtatttggcgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgccgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|AB908304_C_P-B Feature FT:CDS AB908304_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagagactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|AB931168_C_P-B Feature FT:CDS AB931168_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1P_HB11-1417). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactggcgagttactctcttttttgcctcgtgacttctttccgtcggc
gcaagacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcatatcaccacacag
cactcaggcaagctattctgtgctggggggaattaacgaatctaggtacctgggtgggtaacaatttacaagatcaaccg
tccagggatctagtagtcaattatgttaacactaacatgggtctgaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctggaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|AB931169_C_P-B Feature FT:CDS AB931169_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1S_HB11-1418). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactggcgagttactctcttttttgcctcgtgacttctttccgtcggc
gcaagacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcatatcaccacacag
cactcaggcaagctattctgtgctggggggaattaacgaatctaggtacctgggtgggtaacaatttacaagatcaaccg
tccagggatctagtagtcaattatgttaacactaacatgggtctgaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctggaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|AB976562_C_P-B Feature FT:CDS AB976562_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AK8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctgctgt
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaattcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtttcttttggagtgtggattcgcactcctgttgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacaacgaggcagggcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF100308_C_P-B Feature FT:CDS AF100308_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcggggggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggcgagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF100309_C_P-B Feature FT:CDS AF100309_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccatca
tccagggaattagtagtcagctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctg
tctcacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF121243_C_P-B Feature FT:CDS AF121243_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/14611). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF121244_C_P-B Feature FT:CDS AF121244_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/15122). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF121245_C_P-B Feature FT:CDS AF121245_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/16091). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF121246_C_P-B Feature FT:CDS AF121246_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/IK29902). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF121247_C_P-B Feature FT:CDS AF121247_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/719). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattttgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
ccttacttttggaagagaagttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF121248_C_P-B Feature FT:CDS AF121248_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/139-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattttgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaagatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|AF121249_C_P-B Feature FT:CDS AF121249_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/4014). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattttgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF121250_C_P-B Feature FT:CDS AF121250_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/6395). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AF121251_C_P-B Feature FT:CDS AF121251_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/9873). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattttgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AF157020_C_P-B Feature FT:CDS AF157020_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tagagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaacatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggatttgcactcctcctgcatatagac
cacccaatgcccctatcttatcaacacttccggatactactgttgttagacgccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagaagaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctccatgttag
>gnl|hbvcds|AF157021_C_P-B Feature FT:CDS AF157021_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattggtagtcagctatgtcaacgttaacatgggcttaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatgtggtgtcttttggagtgtggattcgcactcctactgcatatagac
caccaaatgcccctatcttatcaacacttccggatactactgttattagacgccgaggcaggccccctagaagaagaact
ccctcgcctcgcagaagaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctccatgttag
>gnl|hbvcds|AF157022_C_P-B Feature FT:CDS AF157022_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattggtagtcagctatgtcaacgttaacatgggcttaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagac
caccaaatgcccctatcttatcaacacttccggatactactgttgttagacgaagaggcaggccccctagaagaagaact
ccctcgcctcgcagaagaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctccatgttag
>gnl|hbvcds|AF157023_C_P-B Feature FT:CDS AF157023_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctccatgttag
>gnl|hbvcds|AF157024_C_P-B Feature FT:CDS AF157024_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctccatgttag
>gnl|hbvcds|AF157025_C_P-B Feature FT:CDS AF157025_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctccatgttag
>gnl|hbvcds|AF233231_C_P-B Feature FT:CDS AF233231_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV147c). Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggtgcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagataactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
taccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttgg
>gnl|hbvcds|AF233234_C_P-B Feature FT:CDS AF233234_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV259c). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacgcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtaggctatgtcaacgttaatatgggcctaaaacttagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF233235_C_P-B Feature FT:CDS AF233235_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV263c). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF233237_C_P-B Feature FT:CDS AF233237_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV4c). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagccattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF282917_C_P-B Feature FT:CDS AF282917_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-B1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctactgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacatagttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggtagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggccaaaatttcagacaactattgtggtttcacatttcctg
tctcacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF282918_C_P-B Feature FT:CDS AF282918_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-B2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggtagtaatttgcaagatccagca
tccagggaactagtagtcagttatgtcaacgctaatatgggcctaaagatcaggcaactattgtggtttcacatttcctg
tctcacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF323467_C_P-B Feature FT:CDS AF323467_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Korean A5). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagagcttatcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctatgctgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtcccaatcaccgcgtcgcagaagatctcattctcgggaatctcaatgttag
>gnl|hbvcds|AF323470_C_P-B Feature FT:CDS AF323470_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Korean A10). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttcttcccttctat
tcgagatctcctcgacaccgcttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtatctttcggagtgtggattcgcactcctcccggttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324066_C_P-B Feature FT:CDS AF324066_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A11). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatcttctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
ctctcaggcaagctattctgtgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcttg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AF324067_C_P-B Feature FT:CDS AF324067_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A12). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AF324069_C_P-B Feature FT:CDS AF324069_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A14). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttctgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgttag
>gnl|hbvcds|AF324070_C_P-B Feature FT:CDS AF324070_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A15). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttgtgtggagttactctcttttttgccttatgacttctttccttctat
tcgagagcttatcgacaccgcctctgctatgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctatactgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctgaatgttag
>gnl|hbvcds|AF324073_C_P-B Feature FT:CDS AF324073_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A20). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggaattactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacactgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tctcacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324078_C_P-B Feature FT:CDS AF324078_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A34). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324082_C_P-B Feature FT:CDS AF324082_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A38). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagacctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcagccatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaaggggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324085_C_P-B Feature FT:CDS AF324085_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A42). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccatca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatatcagtgttag
>gnl|hbvcds|AF324086_C_P-B Feature FT:CDS AF324086_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A43). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324088_C_P-B Feature FT:CDS AF324088_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A45). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctgt
tcgagaccttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttgaacgacccagca
tccagggaattagtggtcaactatgttaatgttaacatgggcctaaaattcagacaattattgtggtttcacatttcctg
tcttacttttggaagagatactgttattgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AF324089_C_P-B Feature FT:CDS AF324089_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A48). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatctggtatcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|AF324101_C_P-B Feature FT:CDS AF324101_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 0078). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagacctcctcgacaccgcctcagctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgtcctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagca
tccagggaattagtggtcagttatgtcaacattaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324106_C_P-B Feature FT:CDS AF324106_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 5072). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
acgagatctcctcgacaccgcctcagccctgtatagggaagccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctagctacctgggtgggtagtaatttggaagaccccgca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccatcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF335738_C_P-B Feature FT:CDS AF335738_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgcactgcatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF335740_C_P-B Feature FT:CDS AF335740_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgcactgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF335741_C_P-B Feature FT:CDS AF335741_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgcactgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF335746_C_P-B Feature FT:CDS AF335746_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattatggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF335748_C_P-B Feature FT:CDS AF335748_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccgtctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattcagtgttggggtgaggtgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattatggtttcacatttcctg
tcttacatttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF335751_C_P-B Feature FT:CDS AF335751_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctcgggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF335754_C_P-B Feature FT:CDS AF335754_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattatggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF461360_C_P-B Feature FT:CDS AF461360_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FH14-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaacctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttcagcatatagac
cacaaaatgcccctatcttatcaacgcttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF461362_C_P-B Feature FT:CDS AF461362_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FH10). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|AF479684_C_P-B Feature FT:CDS AF479684_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3c). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgttctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagaraaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacggagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480337_C_P-B Feature FT:CDS AF480337_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-1). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctagtctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgtcgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480338_C_P-B Feature FT:CDS AF480338_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-2). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
cccttgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480339_C_P-B Feature FT:CDS AF480339_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-3). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagttgtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480340_C_P-B Feature FT:CDS AF480340_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-4). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagatattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaacaatcagacgactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480341_C_P-B Feature FT:CDS AF480341_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-6). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatttcatcgacaccgcctctgctctgtatcgggaggccttagagtcttcggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480342_C_P-B Feature FT:CDS AF480342_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-8). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480343_C_P-B Feature FT:CDS AF480343_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-9). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacctgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagagattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480344_C_P-B Feature FT:CDS AF480344_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-11). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcagacaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480345_C_P-B Feature FT:CDS AF480345_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-12). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480346_C_P-B Feature FT:CDS AF480346_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-13). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagatattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaacaatcagacgactattgtggtttcacatttcatg
tcctacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480347_C_P-B Feature FT:CDS AF480347_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-14). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagatattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaacaatcagacgactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480348_C_P-B Feature FT:CDS AF480348_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-15). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagatattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480349_C_P-B Feature FT:CDS AF480349_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-16). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcacg
tcttacttttgggagagaaactgttcttgaatatttggtgtctcttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480350_C_P-B Feature FT:CDS AF480350_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-17). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagatattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaacaatcagacgactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480351_C_P-B Feature FT:CDS AF480351_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-18). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctaaccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaagtctcaatcgccgcgtcgcagaggatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480352_C_P-B Feature FT:CDS AF480352_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-19). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagatattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaacaatcagacgactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtctcttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480353_C_P-B Feature FT:CDS AF480353_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-20). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaaaatattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaacaatcagacgactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgttag
>gnl|hbvcds|AF480354_C_P-B Feature FT:CDS AF480354_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-21). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagatattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaacaatcagacgactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480355_C_P-B Feature FT:CDS AF480355_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-22). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggttccacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480356_C_P-B Feature FT:CDS AF480356_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-23). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480357_C_P-B Feature FT:CDS AF480357_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-24). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480358_C_P-B Feature FT:CDS AF480358_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-25). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagatattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaacaatcagacgactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcgggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480359_C_P-B Feature FT:CDS AF480359_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-27). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagatattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaacaatcagacgactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480360_C_P-B Feature FT:CDS AF480360_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-28). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagatattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaacaatcagacgactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480361_C_P-B Feature FT:CDS AF480361_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-29). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagatattctgtgttggtgtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaacaatcagacgactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480362_C_P-B Feature FT:CDS AF480362_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-30). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480363_C_P-B Feature FT:CDS AF480363_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-31). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcccgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaacaatcagacgactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480364_C_P-B Feature FT:CDS AF480364_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-32). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtatatagaatttcgagcttctggggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttacagtctccggaacattgttcacctcaccatacgg
cactcaggcaagatattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaacaatcagacgactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AJ298864_C_P-B Feature FT:CDS AJ298864_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctctgctttgtatagggaggccttagagtctccggaacattgttcacctcaccatacag
cactaaggcaagctattctgtgttggggtgagttgatgaatctagctacctgggtgggtactaatttagaagatccagca
tctagggacctagtagtaagctatgtcaacactaatgtgggcctaaagttcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctaccgcttatagac
caccaaatgcccctatcttatcaacacttccggcaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AJ627225_C_P-B Feature FT:CDS AJ627225_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 19749). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcttctgcggagttactctcttttttgccgtctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacatcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacatgggtgggaagtaatttggacgatcaagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
ctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AM888201_C_P-B Feature FT:CDS AM888201_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BM1). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggaccttctgtggagttactttcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgtccttgaatatttggtgtcttttggagtgtggattcgcactcctcctgtatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011084_C_P-B Feature FT:CDS AP011084_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatacagac
cccaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011085_C_P-B Feature FT:CDS AP011085_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcc
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011086_C_P-B Feature FT:CDS AP011086_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagaccttctcgacaccgcctctgctctgtatagggaggccttagagtctccggaacactgttcacctcatcatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatcttgccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tctcacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
ccccaaatgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011087_C_P-B Feature FT:CDS AP011087_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagaccttctcgacaccgcctctgctctgtatagggaggccttagagtctccggaacactgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatcttgccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tctcacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011088_C_P-B Feature FT:CDS AP011088_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011089_C_P-B Feature FT:CDS AP011089_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttcttcccgtctat
tcgagatcttctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tctcacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011090_C_P-B Feature FT:CDS AP011090_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacacagcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatttagccacttgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011091_C_P-B Feature FT:CDS AP011091_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtttcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011092_C_P-B Feature FT:CDS AP011092_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011093_C_P-B Feature FT:CDS AP011093_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctttgtatcgggaggccttagagtctccggagcattgttcacctcaccatacgg
cactcaggcaagctattctctgttggggggagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tattacttttggaagagaaattgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcaggcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011094_C_P-B Feature FT:CDS AP011094_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgtacacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacctttcctg
tcttatgtttggaagagawactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctgctgcatatagac
catcaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011095_C_P-B Feature FT:CDS AP011095_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011096_C_P-B Feature FT:CDS AP011096_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagaccttctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY033072_C_P-B Feature FT:CDS AY033072_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY033073_C_P-B Feature FT:CDS AY033073_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY163869_C_P-B Feature FT:CDS AY163869_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FMClx-1). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctactcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttgcaagatccagca
tccagggaagtagtagtcggctatgttaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caaccaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatgttaatgttag
>gnl|hbvcds|AY163870_C_P-B Feature FT:CDS AY163870_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FMU001). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctactcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttgcaagatccagca
tccagggaagtagtagtcggctatgttaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caaccaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatgttaatgttag
>gnl|hbvcds|AY167089_C_P-B Feature FT:CDS AY167089_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttgtcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY167093_C_P-B Feature FT:CDS AY167093_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIa). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccctctgt
tcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggacgatccagca
tcccgggacgcagtagtcagctatgtcaacgttaatatgggcctaaaattcagacaactattgtggtttcacatttcctg
tcttacttttggaagagacactgttcttgaatatttggtgtcttttggagtgtggatgcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagaggaaggcgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY167094_C_P-B Feature FT:CDS AY167094_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIb). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcntcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaagatccggca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgnggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacnaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctnaatgttag
>gnl|hbvcds|AY167097_C_P-B Feature FT:CDS AY167097_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIIb). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AY167098_C_P-B Feature FT:CDS AY167098_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IVa). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttccat
tcgagagcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagagaattagtagtcagttatgtcaacgttaatgcgggcctaaaaatcagacaaatattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY167100_C_P-B Feature FT:CDS AY167100_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Va). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggcagtaatttggacgatccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY167101_C_P-B Feature FT:CDS AY167101_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vb). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatagggaggccttagagtctccggaacattgttcagctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctggaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgttag
>gnl|hbvcds|AY167102_C_P-B Feature FT:CDS AY167102_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vc). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctaatgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccctagagtctccggaacatttaacacctcaccatacgg
cgctcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctg
tctcacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgcatatagac
cagcaaatgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AY206375_C_P-B Feature FT:CDS AY206375_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctactcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaagatccagca
tccagggaagcagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY206383_C_P-B Feature FT:CDS AY206383_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcagctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacgg
caatcaggcaagctgttctgtgttggggggagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcataaaactcagacagctattgtggtttcacatttcctg
tcttatgtttgggagacaagttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacgcttccggagactactgttgttagagcaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY206387_C_P-B Feature FT:CDS AY206387_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctat
tcgggatctgctcgacaccgcctctgctctctatcgggaggctttagagtctccggaacattgttcacctcaccatacgg
ctctcaggcaagctattcaatgttggggtgaggtgatgaatctagccacctgggtgggaggtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tctttcttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcctatcaacgcttccggaaactactgttgttagacggagatgcaggtcccctagaagaggaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgttag
>gnl|hbvcds|AY206390_C_P-B Feature FT:CDS AY206390_C_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtctgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagca
tccagggacttagtagtcagctatgtcaacgttaatatgggcctaaagatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccccccatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgtcag
>gnl|hbvcds|AY206391_C_P-B Feature FT:CDS AY206391_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgcacacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttagacgatccagca
tccagggaagtagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaaatattgtggtttcacgtttcctg
tcttatgtttggaagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
ctcaaaatgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AY217355_C_P-B Feature FT:CDS AY217355_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A6-2). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgccctgtatcgggaggccttagagtctccggaacattggtcacctcaccatacgg
cactcaggcaagctattgtgtgctggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaatca
tccagggatttagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaagttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|AY217356_C_P-B Feature FT:CDS AY217356_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A9-2). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattggtcacctcaccatacgg
cactcaggcaagctattgtgtgctggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaatca
tccagggatttagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaagttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|AY217357_C_P-B Feature FT:CDS AY217357_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1r-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgcgttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY217358_C_P-B Feature FT:CDS AY217358_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B8r-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgcgttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY217359_C_P-B Feature FT:CDS AY217359_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Q6-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY217360_C_P-B Feature FT:CDS AY217360_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcatcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY217361_C_P-B Feature FT:CDS AY217361_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 582-2). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatacagac
cacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY217362_C_P-B Feature FT:CDS AY217362_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 582-4). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgatttttttccttccat
tcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacgg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|AY217364_C_P-B Feature FT:CDS AY217364_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 586). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctggacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgaattaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|AY220697_C_P-B Feature FT:CDS AY220697_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggaattactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatcaagca
tccagggatttagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcatatagac
cgccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY220698_C_P-B Feature FT:CDS AY220698_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcatatagac
cgccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY220703_C_P-B Feature FT:CDS AY220703_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaacttagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttccgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY220704_C_P-B Feature FT:CDS AY220704_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttaccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaacttagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgcatatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY238972_C_P-B Feature FT:CDS AY238972_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FMU023). Partial genome (Contains: HBx, LHBs, MHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtctgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagca
tccagggacttagtagtcagctatgtcaacgttaatatgggcctaaagatcagacaactattgtggtttcacatctcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcccccctcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgttag
>gnl|hbvcds|AY269065_C_P-B Feature FT:CDS AY269065_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3419). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagatctcctcgacaccgcctcagctttgtaccgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagca
tccagggaattagttgtcagttatgttaacattaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269078_C_P-B Feature FT:CDS AY269078_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 5075). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtccat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacag
cactcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagatccagct
tccagagaattagttgtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtacttggtgtctttcggagtgtggattcgcactcctcccgcttacagac
cacccaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269091_C_P-B Feature FT:CDS AY269091_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 30). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacag
cactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269093_C_P-B Feature FT:CDS AY269093_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 2). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttagtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269095_C_P-B Feature FT:CDS AY269095_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 4). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctctccttctat
tcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactgttgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269097_C_P-B Feature FT:CDS AY269097_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 6). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttccgtggagttactctcgtttttgccttctgatttctttccttctat
tcgtgatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctg
tcttacgtttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269100_C_P-B Feature FT:CDS AY269100_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 52). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269102_C_P-B Feature FT:CDS AY269102_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 50). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcgtctgttgagttactctcttttttgccttctgacttctttccttctgc
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
caatcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcgactatgtcaacgttaatatgggcctaaaattcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttattagacaaagaggcaggtccactagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269105_C_P-B Feature FT:CDS AY269105_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 47). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcctctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatagggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctgttctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctg
tcttacttttgggagagaaactgttctggaatatttggtgtcttttggagtgtggattcgcactcctgccgcatatagac
catcaaatgcccctatcttatcaacacttccggaaactgctgttgttagatgcagaggcaggtcctctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269108_C_P-B Feature FT:CDS AY269108_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 44). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctat
tcgagagcttctcgacaccgcctctgctcagtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttgggttgagttgatgaatttagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269109_C_P-B Feature FT:CDS AY269109_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 43). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttagagcttcagtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctgttctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagagaattagtagtcggctatgtcaacgttaatatgggcctaaaacttagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caacaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269110_C_P-B Feature FT:CDS AY269110_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 42). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcctctgctgagttactctcttttttgccttctgacttctttcctaatat
tcgagatcttctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaacctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269115_C_P-B Feature FT:CDS AY269115_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 11). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269120_C_P-B Feature FT:CDS AY269120_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 16). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgttaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tctcacttttgggagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactccacctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269128_C_P-B Feature FT:CDS AY269128_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 36). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacgg
cactcaggcaagccattctgtgctggggtgagttgatgaatctagccacctgggtgggaggtaatttggaagatccctca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccagctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaaatactgttgttagacaaagaggcaggtcctctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttta
>gnl|hbvcds|AY269131_C_P-B Feature FT:CDS AY269131_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 33). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcctttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269135_C_P-B Feature FT:CDS AY269135_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 25). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcctttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY293309_C_P-B Feature FT:CDS AY293309_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctatcctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY517488_C_P-B Feature FT:CDS AY517488_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcctctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatcaagca
tccagggatttagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagagct
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY517620_C_P-B Feature FT:CDS AY517620_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatcttctcgacaccgcctctgctctgaatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY518556_C_P-B Feature FT:CDS AY518556_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 57-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcatctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY582137_C_P-B Feature FT:CDS AY582137_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY596102_C_P-B Feature FT:CDS AY596102_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactaaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY596103_C_P-B Feature FT:CDS AY596103_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctgttctgtgttgggttgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AY596104_C_P-B Feature FT:CDS AY596104_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgatctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaagatccggca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY596105_C_P-B Feature FT:CDS AY596105_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-5). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttccat
tcgagagcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagagaattagtagtcagttatgtcaacgttaatgcgggcctaaaaatcagacaaatattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|AY596106_C_P-B Feature FT:CDS AY596106_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggactcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY596109_C_P-B Feature FT:CDS AY596109_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate II-1). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcatctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatatcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttgtcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|AY596110_C_P-B Feature FT:CDS AY596110_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate II-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgttgagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattaatagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctaccgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY596111_C_P-B Feature FT:CDS AY596111_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-3). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcatctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggacgatcccgca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaattcagacaaatattgtggtttcacatttcctg
tcttacttttggaaaagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactgctgttattagacaacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AY596112_C_P-B Feature FT:CDS AY596112_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgctgagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaagatccagca
tccagggaattggtagtcggctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttgggagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctaccgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY766463_C_P-B Feature FT:CDS AY766463_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY800389_C_P-B Feature FT:CDS AY800389_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ZY041024). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacccttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY800391_C_P-B Feature FT:CDS AY800391_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ZY041026). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcttctttggagttactctcttttttaccttctgacttctttccttctat
tcgagaccttctcgacaccgccaatgctatgtttcgggaggccttagagtctcctgaacattgttcgcatcatcatacgg
cactcaggcaagcaattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgttaatgttaatatgggcataaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaaaagatactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcatatagac
cagcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY800392_C_P-B Feature FT:CDS AY800392_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ZY041027). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcttctttggagttactctcttttttaccttctgacttctttccttctat
tcgagaccttctcgacaccgccaatgctatgtttcgggaggccttagagtctcctgaacattgttcgcatcatcatacgg
cactcaggcaagcaattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgttaatgttaatatgggcataaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaaaagatactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcatatagac
cagcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|D00329_C_P-B Feature FT:CDS D00329_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccctataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccgtcggt
gcgggacctcctagataccgtctctgctctgtatcgggaagccttaaaatctcctgagcattgctcacctcaccacacag
cactcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tcccgggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaactatggtggtttcacatttcctg
tcttacttttggaagagaaactgttctggaatatttggtatcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|D00330_C_P-B Feature FT:CDS D00330_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtcggt
gcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccggca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|D00331_C_C-B Feature FT:CDS D00331_C_C-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcc
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacgtttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctccagcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|D23678_C_P-B Feature FT:CDS D23678_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-HBVYS2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttccgtcggt
gcgagacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctcaacattgctcacctcaccacacag
cactcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttacaagatccagcg
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|D23679_C_P-B Feature FT:CDS D23679_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-HBVMS2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcggt
gcgagacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcaccacacag
cactcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaagatccagcc
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|D50521_C_P-B Feature FT:CDS D50521_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccgtcggt
gcatgacctcctagataccgcttctgctttgtatcgggaagccttagaatctcctgaacattgctcacctcatcacacag
caatcaggcaagctattctgtgctggggggaattaatgactctagcttcctgggtgggtaataatttacaagatccagcg
tccagggaactagtagtcaattatgttaacactcacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tattacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcggtctagggaacctcaatgttag
>gnl|hbvcds|D50522_C_P-B Feature FT:CDS D50522_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccgtcggt
gcatgacctcctagataccgcttctgctttgtatcgggaagccttagaatctcctgaacattgctcacctcatcacacag
caatcaggcaagctattctgtgctggggggaattaatgactctagcttcctgggtgggtaataatttacaagatccagcg
tccagggaactagtagtcaattatgttaacactcacatgggcctaaagatcaggcaattattgtggtttcacatttcctg
tattacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcggtctagggaacctcaatgttag
>gnl|hbvcds|DQ144543_C_P-B Feature FT:CDS DQ144543_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq1-A14). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144544_C_P-B Feature FT:CDS DQ144544_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq1-2). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgtcaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatcccgggaatctcaatgttag
>gnl|hbvcds|DQ144545_C_P-B Feature FT:CDS DQ144545_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq1-B3). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgccttgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144546_C_P-B Feature FT:CDS DQ144546_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq1-C2). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144548_C_P-B Feature FT:CDS DQ144548_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq1-E4). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctattttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144550_C_P-B Feature FT:CDS DQ144550_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq1-21). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctctccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcaccccaccatacgg
cactcaggcgagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcacagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144551_C_P-B Feature FT:CDS DQ144551_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq1-F3). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtatggattcgcgctcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144552_C_P-B Feature FT:CDS DQ144552_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq1-G2). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144554_C_P-B Feature FT:CDS DQ144554_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq2-2). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgtcaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatcccgggaatctcaatgttag
>gnl|hbvcds|DQ144555_C_P-B Feature FT:CDS DQ144555_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq2-B10). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144556_C_P-B Feature FT:CDS DQ144556_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq2-C6). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttgaagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144557_C_P-B Feature FT:CDS DQ144557_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq2-D2). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144558_C_P-B Feature FT:CDS DQ144558_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq2-10). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctattttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144559_C_P-B Feature FT:CDS DQ144559_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq2-11). Partial genome (Contains: HBc, HBx). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttagcaacacttccggaaactactgttgttagacgaagagacaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144560_C_P-B Feature FT:CDS DQ144560_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq2-12). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcaagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144561_C_P-B Feature FT:CDS DQ144561_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq2-E2). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacccgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcattgttag
>gnl|hbvcds|DQ144564_C_P-B Feature FT:CDS DQ144564_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq2-24). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctagaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cgccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgccgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144565_C_P-B Feature FT:CDS DQ144565_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq2-25). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatctggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144567_C_P-B Feature FT:CDS DQ144567_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq3-A17). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144569_C_P-B Feature FT:CDS DQ144569_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq3-C2). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctattttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144570_C_P-B Feature FT:CDS DQ144570_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq3-D3). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgcgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144574_C_P-B Feature FT:CDS DQ144574_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq3-13). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcatatttcctg
tcttacttttgggagggaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144575_C_P-B Feature FT:CDS DQ144575_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq3-18). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctattttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144576_C_P-B Feature FT:CDS DQ144576_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq3-21). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144578_C_P-B Feature FT:CDS DQ144578_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq3-25). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144579_C_P-B Feature FT:CDS DQ144579_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq4-2). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctggcttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144581_C_P-B Feature FT:CDS DQ144581_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq4-B14). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctacaaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcgctcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144582_C_P-B Feature FT:CDS DQ144582_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq4-7). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgtccttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144583_C_P-B Feature FT:CDS DQ144583_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq4-C4). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144584_C_P-B Feature FT:CDS DQ144584_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq4-14). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaactagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144585_C_P-B Feature FT:CDS DQ144585_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq4-13). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgcgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144586_C_P-B Feature FT:CDS DQ144586_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq4-D2). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144587_C_P-B Feature FT:CDS DQ144587_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq4-17). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaactttgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgtgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144589_C_P-B Feature FT:CDS DQ144589_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq4-23). Partial genome (Contains: HBc, HBx). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttagcaacacttccggaaactactgttgttagacgaagagacaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144590_C_P-B Feature FT:CDS DQ144590_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq4-24). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatctggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144591_C_P-B Feature FT:CDS DQ144591_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq4-26). Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagatgatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144592_C_P-B Feature FT:CDS DQ144592_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq4-30). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttgaagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144593_C_P-B Feature FT:CDS DQ144593_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq4-32). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaagccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144594_C_P-B Feature FT:CDS DQ144594_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq5-1). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctagaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cgccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgccgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144595_C_P-B Feature FT:CDS DQ144595_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq5-A6). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttgaagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144596_C_P-B Feature FT:CDS DQ144596_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq5-B2). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggagaccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaacttctgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144597_C_P-B Feature FT:CDS DQ144597_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq5-C3). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcaagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144598_C_P-B Feature FT:CDS DQ144598_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq5-D7). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacccgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcattgttag
>gnl|hbvcds|DQ144599_C_P-B Feature FT:CDS DQ144599_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq5-7). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144600_C_P-B Feature FT:CDS DQ144600_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq5-9). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattggcacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagtcgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144602_C_P-B Feature FT:CDS DQ144602_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq5-12). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattggtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactatcgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtctttcggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144606_C_P-B Feature FT:CDS DQ144606_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq5-F2). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtagtttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ361535_C_P-B Feature FT:CDS DQ361535_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CRP-228). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacgcctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagctacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggttatgtcaatgttaatatgggcctaaaactcagacaattattgtggtttcacatctcctg
tcttacttttggaagagagactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ377158_C_P-B Feature FT:CDS DQ377158_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WJT31). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtgatttcacatctcctg
tcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ448619_C_P-B Feature FT:CDS DQ448619_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-DYH). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcatctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagttagctatgtcaacgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ448620_C_P-B Feature FT:CDS DQ448620_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-DYF). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ448621_C_P-B Feature FT:CDS DQ448621_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-HQY). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
ccccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ448622_C_P-B Feature FT:CDS DQ448622_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-JSM). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctttatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttagaagatccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttttagaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ448623_C_P-B Feature FT:CDS DQ448623_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-LMX). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttccttctat
tcgagatctcctcgacaccgcttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ448624_C_P-B Feature FT:CDS DQ448624_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-QSA). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcatctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ448625_C_P-B Feature FT:CDS DQ448625_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-TXB). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctatcctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ448626_C_P-B Feature FT:CDS DQ448626_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-XLB). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggggaattgatgaatctagccacctgggtgggaagtaatttggaagatccatca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ448627_C_P-B Feature FT:CDS DQ448627_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-ZFL). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ448628_C_P-B Feature FT:CDS DQ448628_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-ZX). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaagctcaatgttag
>gnl|hbvcds|DQ463787_C_P-B Feature FT:CDS DQ463787_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 928-9_1979). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctctttcttgcctgctgacttctttccgtcggt
tcgggatctcctagacaccgcctctgctttgtatcgagaagccttagagtctcctgaacattgctcgcatcaccatacag
caatcaggcaagctgttttgtgctggggggaattaatgactctagcttcctgggtgggtagtaatttagacgatccagca
tccagagacctagtagtcaattatgttaacattaacatgggactaaagatcaggcaattattgtggtttcacctttcctg
tattacctttgggaaagacactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|DQ463788_C_P-B Feature FT:CDS DQ463788_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 739-11_1979). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccgtcggt
tcgggatctcctagacaccgccgctgctttgtatcgggaagccttagagtctcctgaacattgctcgtctcaccatacag
cactcaggcaagctattttgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaagatccagca
tccagagacctagtagtcaattatgttaacactaacatgggactaaagatcaggcaattattgtggtttcacatttcctg
tcttacctttgggagagacactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|DQ463789_C_P-B Feature FT:CDS DQ463789_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 650-15_1979). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggcgctactgtggagttactctcttttttgcctactgacttctttccgtcggt
tcgagatctcctagacaccgccgctgctttgtttcgggaagccttagagtcccctgaacattgctcacctcaccatacag
cactcaggcaagctattttgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaagatcaagca
tccagagacctagtagtcaattatgttaacactaatatgggactaaagatcaggcaattattgtggtttcacgtttcctg
tattatctttgggagagacattgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|DQ463790_C_P-B Feature FT:CDS DQ463790_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 621-14_1979). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctctttcttgccttctgacttctttccgtcggt
tcgggatctcctagacaccgccactgctttgtatcgggaagccttagagtcttctgaacattgctcgtatcaccatacag
cactcaggcaagctattttgtgctggggggaattaatgactctagcttcctgggtgggtaataatttagacgatccagct
tccagagacctagtagtcaattatgttaacactaacatgggactaaagatcaggcaattattgtggtatcacctttcctg
tcttacctttgggagagacactgttcatgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|DQ463791_C_P-B Feature FT:CDS DQ463791_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 539-16_1979). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctctttcttgccttctgacttctttccgtcggt
tcgggatctcctagacaccgcatctgctttgtatcgggaagccttagagtctcctgaacattgctcgcctcaccatacag
caatcaggcaagctattttgtgctggggggaattaatgactctagcttcctgggtgggtaataatttacaagatccagca
tccagagacctagtagtcaattatgttaacactaacatgggactaaagatcaggcaattattgtggtttcacatttcctg
tattacctttggaagagatactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|DQ463792_C_P-B Feature FT:CDS DQ463792_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 524-3_1979). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccgtcggt
tcgggatctcctagacaccgcctctgctctgtatagggaagccttagagtctccggaacattgctcggctcaccatacag
cactcaggcaagctattttgtgctggggcgaattaatgactctagctacctgggtgggtaataatttagacgatccagca
tccagagacctagtagtcaattatgttaacactaacatgggactaaagatcaggcaattattgtggtttcacatttcctg
tcttacctttgggagagatactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacaccgacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|DQ463793_C_P-B Feature FT:CDS DQ463793_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 462-4_1979). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgcgcagttactctctttcttgccttctgacttctttccgtcggt
tcgggatctcctagacaccgccactgctttgtatcgagaagccttagagtctcctgaacatgtctcgcctcaccatacag
cactcaggcaagccattttgtgctggggggacttaatgactctagctacatgggtgggtaataatttagaagatccagca
tccagagacctagtagtcaattatgttaacaataccacgggactaaagatcaggcaattattgtggtttcacatttcctg
tcttacctttgggagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcctaatgttag
>gnl|hbvcds|DQ463794_C_P-B Feature FT:CDS DQ463794_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 234-6_1979). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgcggagttactctctttcttgccttctgacttctttccgtcggt
tcgggatctcctagacaccgccgctgctttgtatcgggaagccttagagtctcctgaacattgctcgcatcaccatacag
cactcaggcaagctatcttatgctggggggaattaatgactctagctacctgggtgggtaataatttagaagatccagca
tccagagacctagtagtcaattatgttaacactaacatgggactaaagatcaggcaattattgtggtttcacgtttcctg
tcttacctttgggagagatactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|DQ463795_C_P-B Feature FT:CDS DQ463795_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 928-9_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccgtcggt
tcgggatctcctagacaccgcctctgctttgtttcgagaagctttagagtctcctgaacattgctcgcctcaccatacag
caatcaggcaagctgttttgtgctggggggaattaatgactctagcttcctgggtgggtaataatttagacgatccagca
tccagagacctagtagtcaattatgttaacactaacatgggactgaagatcaggcaattattgtggtttcacatttcctg
tattatctttgggagaagcactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|DQ463796_C_P-B Feature FT:CDS DQ463796_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 739-11_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctctttcttgccttctgacttctttccgtcggt
tcgggatctcctagacaccgccactgctttgtttcgagaagccttagagtctcctgaacattgctctcctcaccatacag
caatcaggcaagccattttgtgctggggggaattaatgactctagcttcctgggtgggtaataatttagacgatccagca
tccagagacctagtagtcaattatgttaacactaacatgggactaaagatcaggcaattattgtggtttcacatttcctg
tattatctttgggaaagacactgttcttgaatatttggtgtcatttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|DQ463797_C_P-B Feature FT:CDS DQ463797_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 650-15_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggcgctactgtggagttactctcttttttgcctactgacttctttccgtcggt
tcgagatctcctagacaccgccgctgctttgtttcgggaagccttagagtcccctgaacattgctcacctcaccatacag
cactcaggcaagctattttgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaagatcaagca
tccagagacctagtagtcaattatgttaacactaatatgggactaaagatcaggcaattattgtggtttcacgtttcctg
tattatctttgggagagacattgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|DQ463798_C_P-B Feature FT:CDS DQ463798_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 621-14_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccgtcggt
tcgggatctcctagacaccgcctctgctttgtatcgggaagccttagagtctcctgaacattgttcggctcaccatacag
caatcaggcaagctattttgtgctggggggaattaatgactctagcttcctgggtgggtagtaatttaaatgatccagct
tccagagacctagtagtcaattatgttaacattaacatgggactaaagatcaggcaattattgtggtatcacatttcctg
tattacctttgggagagacactgttctcgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|DQ463799_C_P-B Feature FT:CDS DQ463799_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 539-16_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtgaacttactctctttcttgcctgctgacttctttccgtcggt
tcgggatctcctagacaccgcatctgctttgtatcgggaagccttagagtctcctgaacattgctcgcctcaccatacag
caatcaggcaagctattttgtgctgggggcaattaatgactttagcgtcctgggtgggtaataatttacaagatccagca
tccagagacctagtagtcgattatgttaacaataacatgggactaatgatcaggcaattattgtggtttcacctgtcctg
cattacctttggacaagatactgttcttgaatatttggtgtcctttggagtgtggattcgcactccacccgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|DQ463800_C_P-B Feature FT:CDS DQ463800_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 524-3_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctctttcttgccttctgacttctttccgtcggt
tcgggatctcctagacaccgcctctgctctgtatagggatgccttggagtctccggaacattgctcggctcaccatacag
caatcaggcaagctattttgtgctggggcgaattaatgactctagctacctgggtgggtaataatttagacgatccagca
tccagagacctagtagtcaattatgttaacactcacatgggactaaagatcaggcaattattgtggtttcacatttcctg
tattacctttgggagagatactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagactccgacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|DQ463801_C_P-B Feature FT:CDS DQ463801_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 462-4_2004). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctctttcttgccttctgacttctttccgtcggt
tcgggatctcctagacaccgccactgctttgtatcgagaagccttagagtctcctgaacatgtctcgcctcaccatacag
cactcaggcaagccattttgtgctggggggacttaatgactctagctacatgggtgggtaataatttagaagatccagca
tccagagacctagtagtcaattatgttaacaataccacgggactaaagatcaggcaattattgtggtttcacatttcctg
tcttacctttgggagagacactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctcgggaatcctaatgttag
>gnl|hbvcds|DQ463802_C_P-B Feature FT:CDS DQ463802_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 234-6_2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctctttcttgcctgctgacttctttccgtcggt
tcgggatctcctagacaccgcctctgctttgtatcgggaagccttagagtctcctcaacattgctcgcctcaccatacgg
caatcaggcaagctattttatgctggggggaattaatgactctagcttcctgggtgggtaataatttagacgatccagca
tccagagacctagtagtcaattatgttaacactaacatgggactaaagatcaggcaattattgtggtttcacctttcctg
tattacctttggaaaagatactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|DQ904357_C_P-B Feature FT:CDS DQ904357_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctgttctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattatggtttcacatttcctg
tctttcttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgaagaggcaggtcccctagaagaagagct
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ975271_C_P-B Feature FT:CDS DQ975271_C_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatggggctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993680_C_P-B Feature FT:CDS DQ993680_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 268). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttcttgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcctgggaattattagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttggaagagaagttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagac
cacaaaatgcccctatcttatgaagacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993681_C_P-B Feature FT:CDS DQ993681_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 290). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagtaactctcttttttgcctactgactactttccttctat
tcgagatcttctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|DQ993682_C_P-B Feature FT:CDS DQ993682_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 479). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgactaccttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcccgaa
tcttgggaaatagtaggcacctatgtcaatggtagcctggggctaagaggcagaccactattgcggtttcacatttcctg
tcgtacttttggaagagaaactgttcgtgaatattgggggtcttttggaatgcgggttcccactcctactgaatatcgac
cacccaaggccaatatcttatcaacacttccggaaaataccgctgttagacgaatatgcaggtcccctataagaagaact
ccctcgcctcgcagactaagggctcattcgccgcgacggagaagatctcaatctcgggaagcttaatgtcat
>gnl|hbvcds|DQ993683_C_P-B Feature FT:CDS DQ993683_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 82). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgcatcaagaatttggatcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagga
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacgtttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccacctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|DQ993684_C_P-B Feature FT:CDS DQ993684_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 336). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctacccacctgggtgggaagtaatttggaagacccagca
tcatggaaattattagccacctgtcggaacgttaaaatgggcccaaaaattagccaactattgtggtttcacatttcctg
gcttatgtttgggagagaaactgttctggaatatttggggtcttttggagtgtggattcgcactcctactgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993685_C_P-B Feature FT:CDS DQ993685_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 554). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgcataaagaatttggagcttctgtggagtaactctcttatttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctggggaatctcaatgttag
>gnl|hbvcds|DQ993686_C_P-B Feature FT:CDS DQ993686_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 342). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacactgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcctgggactttttagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993687_C_P-B Feature FT:CDS DQ993687_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 700). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggatcttctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgaattgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtccgctatgttaatgttaatatgggcctaaaacttacacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993694_C_P-B Feature FT:CDS DQ993694_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 234). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagctacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993696_C_P-B Feature FT:CDS DQ993696_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 452b1). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993697_C_P-B Feature FT:CDS DQ993697_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 940b1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993698_C_P-B Feature FT:CDS DQ993698_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6144-0327-ETCvs3TC-Naive). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcgcctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtagtttcacatttcctg
tctcactttcgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgcatatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993699_C_P-B Feature FT:CDS DQ993699_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6144-0226-ETCvs3TC-Break). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttcttcccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacttgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993700_C_P-B Feature FT:CDS DQ993700_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JMY-0725-ETC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtaagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993701_C_P-B Feature FT:CDS DQ993701_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JMY-0210-ETCvs3TC-Brack). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtaagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993702_C_P-B Feature FT:CDS DQ993702_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JMY-0919-ETCvs3TC-Naive). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtaagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993703_C_P-B Feature FT:CDS DQ993703_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 236-0526-Nature1.2-Sero). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagacctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993704_C_P-B Feature FT:CDS DQ993704_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-1127-Nature3.1-unSero). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcaattatgtcaacgttaatgtgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagagtggattcgcactcctcctgcataaagac
caccaaatgcccctatattatcaacacttccggaaactactgttgttagacgaacaggcaggtcccctagaaaaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993705_C_P-B Feature FT:CDS DQ993705_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-0625-Nature3.4-unSero). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggccattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaacgttaatgtgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgataa
>gnl|hbvcds|DQ993706_C_P-B Feature FT:CDS DQ993706_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-0402-Nature3.3-unSero). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993707_C_P-B Feature FT:CDS DQ993707_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-O218-Nature3.2-unSero). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagaggctccggaacattgttcacctcaccatacgg
cactcaggcaagctcttctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993708_C_P-B Feature FT:CDS DQ993708_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6136-1228-Naive). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tccagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993709_C_P-B Feature FT:CDS DQ993709_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6136-0127-ETCvs3TC-Break). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993710_C_P-B Feature FT:CDS DQ993710_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6144-0718-ETC). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcgcctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtagtttcacatttcctg
tctcactttcgggagagaaattgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993711_C_P-B Feature FT:CDS DQ993711_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 221-1120-Nature1.1-unSero). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattggtagtcagctatgtcaacgttaatatgggtctaaaaatcagacaactattgtggtttcacatttcctg
tcttacctttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|DQ995801_C_P-B Feature FT:CDS DQ995801_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H60-6). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cagcaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ995802_C_P-B Feature FT:CDS DQ995802_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H293-16). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattattcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagttagctatgtcaacgttaatatgggactaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagacaaattgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttag
>gnl|hbvcds|DQ995803_C_P-B Feature FT:CDS DQ995803_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C265-15). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgactcctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
caatcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaacatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaattcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagaccaagaggcaggtcccttagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|DQ995804_C_P-B Feature FT:CDS DQ995804_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1691-11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggaattgatctcttttttgcctgctgacttctttccttctgt
tcgagatctccttgacaccgcctctgctctgtatcgggaggccttagagtctccagaacattgtacacctcaccatacag
caatcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggtggtaatttggacgatccagca
tcaagagaattagtagtcggctatgtcaacgttaatatgggcctaaaattcagacaaattttgtggtttcacatttcatg
tctcacttttgggagagccactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatataggc
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagaccaagagtcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|DQ995805_C_P-B Feature FT:CDS DQ995805_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H60-2.5KB). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatcccctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgctggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaaccgttactgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cagcaaatgcccctatcttatcaacacttccggagactactgttgttagatgcagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatttgga
>gnl|hbvcds|EF134945_C_P-B Feature FT:CDS EF134945_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G247-B3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttcggacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatacgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF134946_C_P-B Feature FT:CDS EF134946_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G247-B5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttcggacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatacgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF473971_C_P-B Feature FT:CDS EF473971_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2059Java). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggactaaaaatcagacaactattgtggtttcacgtttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF473972_C_P-B Feature FT:CDS EF473972_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1839Java). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattttgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagaccctgca
tcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF473973_C_P-B Feature FT:CDS EF473973_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH45AChinese). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgactcctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgggttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgcccggtcgcagacgatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF473974_C_P-B Feature FT:CDS EF473974_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH21AChinese). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctccacaccgcctctgctttgaatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgggttggggtgagttaatgaatctagccacctgggtgggaagaaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagagtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgtcgggtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF473975_C_P-B Feature FT:CDS EF473975_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2061Chinese). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccagaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF473976_C_P-B Feature FT:CDS EF473976_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alr049East). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacacagcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
ccccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF473977_C_P-B Feature FT:CDS EF473977_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KD048East). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaattcggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgtgatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tctgacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcatacctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF494380_C_P-B Feature FT:CDS EF494380_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TW836). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgataccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgagtctagccacctgggtgggaagtaatttggatgatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaatctcaatgttag
>gnl|hbvcds|EF494381_C_P-B Feature FT:CDS EF494381_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TW936). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctaccgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacgg
ccctcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaggtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctactgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF494382_C_P-B Feature FT:CDS EF494382_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TWD347). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctaatat
tcgagatctcctcgacaccgccaatgctctgtatcgggaggccttagagtctccggaacattgttcagctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaagatccagga
tctagagaattagtagtcggctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatttttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacaaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctaaatcaccgcgtcgcaaaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|EU139543_C_P-B Feature FT:CDS EU139543_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU158262_C_P-B Feature FT:CDS EU158262_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G116). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctatcctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagacccagca
tccagggaagcagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaaaagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU158263_C_P-B Feature FT:CDS EU158263_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G108). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcaccacacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggacgatccagca
tccagggaattggtagtcggctatgtcaacgttaatatgggactaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttgggaaagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
ctcaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|EU305547_C_P-B Feature FT:CDS EU305547_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M118-481). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagccattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU305548_C_P-B Feature FT:CDS EU305548_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M118-673). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306677_C_P-B Feature FT:CDS EU306677_C_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgataccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaaatattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccacctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306678_C_P-B Feature FT:CDS EU306678_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccacctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306679_C_P-B Feature FT:CDS EU306679_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggcttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccacctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306680_C_P-B Feature FT:CDS EU306680_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggcttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccacctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306681_C_P-B Feature FT:CDS EU306681_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttgggagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccacctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306695_C_P-B Feature FT:CDS EU306695_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttactttcgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306696_C_P-B Feature FT:CDS EU306696_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
cccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttactttcgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306697_C_P-B Feature FT:CDS EU306697_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttactttcgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306698_C_P-B Feature FT:CDS EU306698_C_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttactttcgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306699_C_P-B Feature FT:CDS EU306699_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatttcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgtgttgatgaatctagccacctgggtgggaagtaatttggaaaatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306700_C_P-B Feature FT:CDS EU306700_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306701_C_P-B Feature FT:CDS EU306701_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306702_C_P-B Feature FT:CDS EU306702_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaggaatttggagcttctgtggagttactctcttttctgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306703_C_P-B Feature FT:CDS EU306703_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatggcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcggaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306704_C_P-B Feature FT:CDS EU306704_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306705_C_P-B Feature FT:CDS EU306705_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagaatctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306706_C_P-B Feature FT:CDS EU306706_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306707_C_P-B Feature FT:CDS EU306707_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcgctcctcctgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgccgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306708_C_P-B Feature FT:CDS EU306708_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306709_C_P-B Feature FT:CDS EU306709_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaaccattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306710_C_P-B Feature FT:CDS EU306710_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306711_C_P-B Feature FT:CDS EU306711_C_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
acttatttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306712_C_P-B Feature FT:CDS EU306712_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggaattactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccacctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU330989_C_P-B Feature FT:CDS EU330989_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M84-74). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccctagagtctccggagcattgttcacctcaccatacgg
cgctcaggcaagctattctgtgttggggagagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttagtgtcttttggagtgtggattcgcactccccctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU330990_C_P-B Feature FT:CDS EU330990_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M84-146). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccctagagtctccggagcattgttcacctcaccatacgg
cgctcaggcaagctattctgtgttggggagagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttagtgtcttttggagtgtggattcgcactccccctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU330992_C_P-B Feature FT:CDS EU330992_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-6). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggagagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU330994_C_P-B Feature FT:CDS EU330994_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-10). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggagagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU330995_C_P-B Feature FT:CDS EU330995_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-80). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacgccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggagagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtgaattcgcactccccctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU330996_C_P-B Feature FT:CDS EU330996_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-81). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgccctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggagagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagccaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgcggattcgcactacccccgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU330997_C_P-B Feature FT:CDS EU330997_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-216). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaaggatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggagagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU330998_C_P-B Feature FT:CDS EU330998_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1043). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggagagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU330999_C_P-B Feature FT:CDS EU330999_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1044). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggagagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU331000_C_P-B Feature FT:CDS EU331000_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1045). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggagagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU331001_C_P-B Feature FT:CDS EU331001_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1046). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggagagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU350409_C_P-B Feature FT:CDS EU350409_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BTO5856). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU439018_C_P-B Feature FT:CDS EU439018_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU439020_C_P-B Feature FT:CDS EU439020_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggaggtactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU439021_C_P-B Feature FT:CDS EU439021_C_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgctag
>gnl|hbvcds|EU439022_C_P-B Feature FT:CDS EU439022_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU439023_C_P-B Feature FT:CDS EU439023_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU487256_C_P-B Feature FT:CDS EU487256_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctatgctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttactttcgggagagaaactgttcttgaatatttggtgtcttttggggtgtggattcgcactcctaccgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU487257_C_P-B Feature FT:CDS EU487257_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient14). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtgccgttactctcttttttgccttcggacttctttccttctat
tcgagatctcctcgacaccgccactgctctgtatggggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctgttgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggacgatccagca
tccagggaagtagtagtcaactatgtcaacgttaatatgggcctaaaaatcagacaaatattgtggtttcacatttcctg
tcttacttttgggagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU522066_C_P-B Feature FT:CDS EU522066_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 4N). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|EU522067_C_P-B Feature FT:CDS EU522067_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 4T). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagtgactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU522072_C_P-B Feature FT:CDS EU522072_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 8N). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
caatcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggttatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaaagaggcaggtccactagaagaagaact
ccctcgcctcgcagacgaaggactcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|EU522073_C_P-B Feature FT:CDS EU522073_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 8T). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctactat
tcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatactg
cgatcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggttatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactattgttagacaaagaggcaggtccactagaagaagaact
ccctcgcctcgcagacgaaggactcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU522074_C_P-B Feature FT:CDS EU522074_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 8T). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctaatat
tcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatactg
cgctcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccacatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU522075_C_P-B Feature FT:CDS EU522075_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 8T). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctactat
tcgtgatctcctcgacaccgcctctgctctgtatcggaaggccttagagtctccggaacattgttcacctcaccatactg
cgatcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggttatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactattgttagacaaagaggcaggtccactagaagaagaact
ccctcgcctcgcagacgaaggactcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU547563_C_P-B Feature FT:CDS EU547563_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MC06). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttccgacttttttccttctat
tcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaacttggaagatccagca
tccagggaattagtagtcggttatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacctttcctg
tcttatgtttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagaccaagaggcaggtcccttagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU564822_C_P-B Feature FT:CDS EU564822_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-10TA). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacgg
cgctcaggcaagctattcaatgttggggtgaagtaatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaatcagtagttagctatgtcaacattaatatgggcctcaaaatgagacaactattgtggtttcacatttcctg
tcttacttttgggagagatactgttcttgaatatttagtgtcttttggagtgtggattcgcactcctccagcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcccaatgttag
>gnl|hbvcds|EU564823_C_P-B Feature FT:CDS EU564823_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-10TB). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacgg
cgctcaggcaagctattcaatgttggggtgaagtaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaatcagtagttagctatgtcaacattaatatgggcctcaaaatgagacaactattgtggtttcacatttcctg
tcttacttttgggagagatactgttcttgaatatttagtgtcttttggagtgtggattcgcactcctccagcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcccaatgttag
>gnl|hbvcds|EU564824_C_P-B Feature FT:CDS EU564824_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-10N). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacgg
cgctcaggcaagctattcaatgttggggtgaagtaatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaatcagtagttagctatgtcaacattaatatgggcctcaaaatgagacaactattgtggtttcacatttcctg
tcttacttttgggagagatactgttcttgaatatttagtgtcttttggagtgtggattcgcactcctccagcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcccaatgttag
>gnl|hbvcds|EU564825_C_P-B Feature FT:CDS EU564825_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-11T). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
ctctcaggcaagctgttgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgtaaatatgggccttaaaatcagacaactattgtggttccacatttcctg
tctcacttttgggagacaaactgttcttgactatttggtgtcttttggagtgtggattcgcactccttctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctggaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU564826_C_P-B Feature FT:CDS EU564826_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-11N). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatcttctcgacaccgcctctgctctgtatcgggaagccttagagtctccggaacattgttcacctcaccatacgg
cgctcaggcaagctgttgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgtaaatatgggccttaaaatcagacaactattgtggttccacatttcctg
tctcacttttgggagacatattgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctggaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccctaatgttag
>gnl|hbvcds|EU570069_C_P-B Feature FT:CDS EU570069_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1-B24). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttcagacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttggacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU570070_C_P-B Feature FT:CDS EU570070_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2-B24). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
cccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU570071_C_P-B Feature FT:CDS EU570071_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 4-B24). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagaatctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU570075_C_P-B Feature FT:CDS EU570075_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 11-S142). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtttcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cagcaaatgcccctatcttatcaacacttccggaacatactgttgttagacaaagacgcaggtcccctggaagaagaact
ccctcgcctcgcagaccaaggtctaaatcgccgcgtcgcagaagatctcggtctcgggaatctcaatgttag
>gnl|hbvcds|EU579441_C_P-B Feature FT:CDS EU579441_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgatttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtttcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
catcaaatgcccctatcttatcaacacttccggaaaatactgttgttagaccaagacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU589335_C_P-B Feature FT:CDS EU589335_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S142-5). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctatgtttcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cagcaaatgcccctatcttatcaacacttccggaacatactgttgttagataaagacgcaggtcccctggaagaagaact
ccctcgcctcgccgaccaaggtctaaatcgccgcgtcgcagaagatctcggtctcgggaatctcaatgttag
>gnl|hbvcds|EU595031_C_P-B Feature FT:CDS EU595031_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU660224_C_P-B Feature FT:CDS EU660224_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-12N). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttactttcgggagagaaactgttcttgaatatttggtgtcttttggggtgtggattcgcactcctatcgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggccccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU660230_C_P-B Feature FT:CDS EU660230_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-16T-del1). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcctctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagaccttctcgacaccgcctctgctctgtatcgggaagccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU660231_C_P-B Feature FT:CDS EU660231_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-16T-del2). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcctctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagaccttctcgacaccgcctctgctctgtatcgggaagccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU660232_C_P-B Feature FT:CDS EU660232_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-16N-del1). Partial genome (Contains: HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcctctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagaccttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacgcttccggaaactgctgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU660233_C_P-B Feature FT:CDS EU660233_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-16N-del2). Partial genome (Contains: HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcctctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagaccttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacgcttccggaaactgctgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU796066_C_P-B Feature FT:CDS EU796066_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcgat
tcgagatctactcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgctcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|EU796067_C_P-B Feature FT:CDS EU796067_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctactcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU796068_C_P-B Feature FT:CDS EU796068_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcctctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU796071_C_P-B Feature FT:CDS EU796071_C_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctactcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttctggaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|EU881997_C_P-B Feature FT:CDS EU881997_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient18). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU881998_C_P-B Feature FT:CDS EU881998_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient18). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU882002_C_P-B Feature FT:CDS EU882002_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient20). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagaggcaggtcccctggaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU882003_C_P-B Feature FT:CDS EU882003_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient21). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattggtagtcggctatgtcaacgttaatatgggcctaaaactcagacaaatatggtggtttcacatttcctg
tcttacatttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactccttctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU882004_C_P-B Feature FT:CDS EU882004_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient21). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattggtagtcggctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacatttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactccttctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU919171_C_P-B Feature FT:CDS EU919171_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient29). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggatcatgtttcagctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacgcttccggaaactactgttgttagacaacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcgatgttag
>gnl|hbvcds|EU919172_C_P-B Feature FT:CDS EU919172_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient30). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctgttctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactccttctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU919173_C_P-B Feature FT:CDS EU919173_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient30). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgagaagccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctgttctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactccttctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU919175_C_P-B Feature FT:CDS EU919175_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient34). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctactat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
caatcaggcaagctattctctgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|EU919176_C_P-B Feature FT:CDS EU919176_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient34). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctactat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
caatcaggcaagctattctctgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|EU939559_C_P-B Feature FT:CDS EU939559_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C67). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcagctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattaatagtcggctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|EU939633_C_P-B Feature FT:CDS EU939633_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C181). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatgcgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaattgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactattgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939634_C_P-B Feature FT:CDS EU939634_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C19). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatgcgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaattgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactattgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939635_C_P-B Feature FT:CDS EU939635_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B125). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctcctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcagctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaggtaatttggaagatgcagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcttaaaactcatacaactattgtggtttcacatttcctg
tcttacttttgggagagatactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939636_C_P-B Feature FT:CDS EU939636_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgcctcctgacttttatccttctat
tcgagatctcctcgataccgcctctgctctatatcgggaggccttagagtctccggaacattgtacagctcatcatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaggcaatttggaagatcccgca
tccagagaattagtagtcggctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaagttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactgctgttattagacgaagaagcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcccaatgttag
>gnl|hbvcds|EU939637_C_P-B Feature FT:CDS EU939637_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C13). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cgctcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgttag
>gnl|hbvcds|EU939638_C_P-B Feature FT:CDS EU939638_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C17). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggaattactctcttttttgccttctgacttctttccttctgt
tcgagatctsctcgacaccgcctctgctctgtatcgggaggccttggagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaacctcaatgttag
>gnl|hbvcds|EU939639_C_P-B Feature FT:CDS EU939639_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C28). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcatctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatagggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagctacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939660_C_P-B Feature FT:CDS EU939660_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C34). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
acgagatctcctcgacaccgctactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939661_C_P-B Feature FT:CDS EU939661_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C40). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgcctactgacttctttccttctat
tcgagatctcctcgacaccgcaactgctctgtatagggaggccttagagtctccggaacattgctcatatcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaagcagtagttagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggaaggaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagacgaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939663_C_P-B Feature FT:CDS EU939663_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C74). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatcttctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggcagtaatttggaagatcaagca
tccagggatttagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccacctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939664_C_P-B Feature FT:CDS EU939664_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C85). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttcgktggarttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgtgaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|EU939665_C_P-B Feature FT:CDS EU939665_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C129). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacmcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggagttagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggtgtgtggattcgcactcctcctccatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagaagaaggggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU939666_C_P-B Feature FT:CDS EU939666_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C150). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939667_C_P-B Feature FT:CDS EU939667_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C171). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctactcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaagcagtagtcagctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|EU939669_C_P-B Feature FT:CDS EU939669_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C185). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaggca
tccagggatttagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939670_C_P-B Feature FT:CDS EU939670_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C189). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacccctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaaatattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgagggggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|EU939671_C_P-B Feature FT:CDS EU939671_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C201). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctttggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaagatcaagca
tccagggatttagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU939672_C_P-B Feature FT:CDS EU939672_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttaccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggccatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939673_C_P-B Feature FT:CDS EU939673_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C219). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939674_C_P-B Feature FT:CDS EU939674_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C232). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaagatcaagca
tccagggacttagtagtcggttatgtcaacgttaacatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttctggaatatttggtgtcttttggagtgtggattcgcactcctcctccatatagac
caccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939675_C_P-B Feature FT:CDS EU939675_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C235). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgccgctgctctgtatcgggaggccttggagtctcccgaacattgttcagctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacacttcctg
tcttacttttgggagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggagtgtactgttgttagacaacgacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939676_C_P-B Feature FT:CDS EU939676_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D54). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctactcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939677_C_P-B Feature FT:CDS EU939677_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D95). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctttggagttactctcttttttgccttcggacttctttccttctat
tcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccacacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacctttcctg
tcttatgtttgggagagagactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaagcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgttag
>gnl|hbvcds|EU939678_C_P-B Feature FT:CDS EU939678_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D106). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcttctacggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacgg
cgctcaggcaagctattctatgttggggtgagttaatgaatctagccacctgggtgggaagtaatttgcaagatcaagca
tccagggacttagtagtcaactatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcacgtttcctg
tcttatgtttggaagagacactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgcatataggc
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU939679_C_P-B Feature FT:CDS EU939679_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D134). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctccttgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cgccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcggctcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023569_C_P-B Feature FT:CDS FJ023569_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-0081). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactatcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023573_C_P-B Feature FT:CDS FJ023573_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-0469). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctctttattgccttctgatttctttccatctat
tcgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccacctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023575_C_P-B Feature FT:CDS FJ023575_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-0990). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgataccgcctctgctctgtacagggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttgggttgagttgatgaatcttgctacctgggtgggaggtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023576_C_P-B Feature FT:CDS FJ023576_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-1046). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtatgttggggtgaattgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FJ023605_C_P-B Feature FT:CDS FJ023605_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3692). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
acgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023606_C_P-B Feature FT:CDS FJ023606_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3692). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
acgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023607_C_P-B Feature FT:CDS FJ023607_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3692). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
acgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023608_C_P-B Feature FT:CDS FJ023608_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3692). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
acgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactggtcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023609_C_P-B Feature FT:CDS FJ023609_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3692). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
acgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023610_C_P-B Feature FT:CDS FJ023610_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3692). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
acgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcc
tccggggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023611_C_P-B Feature FT:CDS FJ023611_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3692). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
acgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023612_C_P-B Feature FT:CDS FJ023612_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3692). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
acgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023613_C_P-B Feature FT:CDS FJ023613_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3692). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
acgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggaaatcccaatgttag
>gnl|hbvcds|FJ023614_C_P-B Feature FT:CDS FJ023614_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3692). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
acgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023617_C_P-B Feature FT:CDS FJ023617_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3718). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
tcgagaccttctcgacaccgcatcagccctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacag
cactcaggcaagcagttttgtgttggggggagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtaaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctggaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggcaatcccaatgttag
>gnl|hbvcds|FJ023618_C_P-B Feature FT:CDS FJ023618_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3718). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
tcgagaccttctcgacaccgcatcagccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtaaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctggaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023620_C_P-B Feature FT:CDS FJ023620_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3718). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
tcgagaccttctcgacaccgcatcagccctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacag
cactcaggcaagcagttttgtgttggggggagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtaaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacaattccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023627_C_P-B Feature FT:CDS FJ023627_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3979). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
acgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcgctcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023628_C_P-B Feature FT:CDS FJ023628_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3979). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
acgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggcgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023629_C_P-B Feature FT:CDS FJ023629_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3979). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
acgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcaaacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023630_C_P-B Feature FT:CDS FJ023630_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3979). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
acgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cgctcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaattccaatgttag
>gnl|hbvcds|FJ023631_C_P-B Feature FT:CDS FJ023631_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2_C04-1213). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgctggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcatctttcctg
tcttacctttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cagcaaatgcccctatcttatcaacacttccggaaactgctgttgttagatcaagagtcaggtcctctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023632_C_P-B Feature FT:CDS FJ023632_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_C04-0254). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctatgttggggtgaattgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023633_C_P-B Feature FT:CDS FJ023633_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_C04-0583). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcatcatacgg
cactcaggcaagctattctgtgttggggtgaattgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023634_C_P-B Feature FT:CDS FJ023634_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_C04-1358). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023635_C_P-B Feature FT:CDS FJ023635_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_M04-0467). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023636_C_P-B Feature FT:CDS FJ023636_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_M04-0876). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacgg
cactcaggcaagctattctatgttggggtgaattgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023637_C_P-B Feature FT:CDS FJ023637_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B5_M04-0013). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtacagggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatcttgctacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaaggact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctmaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023638_C_P-B Feature FT:CDS FJ023638_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B5_M04-0465). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatagggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatcttgctacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032342_C_P-B Feature FT:CDS FJ032342_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S659-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcctctgcggagttaatctcttttttgccttctgacttctttcctaatat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaacctagccacctgggtgggaggtaatttgcaagatcaagca
tccagggatttagtagtcaactatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttgggagagatactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcagcacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ032344_C_P-B Feature FT:CDS FJ032344_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S659-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtttcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cagcaaatgcccctatcttatcaacacttccggaacatactgttgttagacaaagacgcaggtcccctggaagaagaact
ccctcgcctcgcagaccaaggtctaaatcgccgcgtcgcagaagatctcggtctcgggaatctcaatgttag
>gnl|hbvcds|FJ032349_C_P-B Feature FT:CDS FJ032349_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S734-1). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggttatgtcaacgttaatatgggcctaaaactcagacaattattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032352_C_P-B Feature FT:CDS FJ032352_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1026-3). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttccttccttctat
tcgagatctcctcgacaccgcctccgctctgtatagggaggccttagagtctccagaacattgttcacctcatcatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtggtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032353_C_P-B Feature FT:CDS FJ032353_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1026-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctccgctctgtatagggaggccttagagtctccagaacattgttcacctcatcatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttgggagatccagca
tccagggaattagtggtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccccgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032354_C_P-B Feature FT:CDS FJ032354_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1026-7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctccgctctgtatagggaggccttagagtctccagaacattgttcacctcatcatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtggtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032357_C_P-B Feature FT:CDS FJ032357_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1607-8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctgttctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032358_C_P-B Feature FT:CDS FJ032358_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1607-10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctgttctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaggtccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ349236_C_P-B Feature FT:CDS FJ349236_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C15). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
ccccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386582_C_P-B Feature FT:CDS FJ386582_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1765). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctcctgaacattgttcacctcatcatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386583_C_P-B Feature FT:CDS FJ386583_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1780). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgctcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386584_C_P-B Feature FT:CDS FJ386584_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1798). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgcgctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386600_C_P-B Feature FT:CDS FJ386600_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1893). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaaaatggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386608_C_P-B Feature FT:CDS FJ386608_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1998). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtagagttactctcttttttgccttctgacttctttccttccat
acgagatctcctcgacaccgcctctgctctgtttcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgagtctagccacctgggtgggaggtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttgggagagaaactgttattgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgttag
>gnl|hbvcds|FJ386610_C_P-B Feature FT:CDS FJ386610_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2000). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctnt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386615_C_P-B Feature FT:CDS FJ386615_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2061). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagca
tccagggactcagtagtcagctatgtcaacgttaatatgggcataaaaatcagacaattattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ386634_C_P-B Feature FT:CDS FJ386634_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2392). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386636_C_P-B Feature FT:CDS FJ386636_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1813). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacmcstataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttccat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386642_C_P-B Feature FT:CDS FJ386642_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1829). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttagaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386648_C_P-B Feature FT:CDS FJ386648_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2419). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctttggagttactctcttttttgccttctgacttctttccttctat
acgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggtacattgtacacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattaatagtcggctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcttg
tcttacttttgggagagaaactgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cagcaaatgcccctatcttatcaacacttccggaaactactgttgttagaccaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggattctcaatgttag
>gnl|hbvcds|FJ386654_C_P-B Feature FT:CDS FJ386654_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S51). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaacggttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ386655_C_P-B Feature FT:CDS FJ386655_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S121). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386656_C_P-B Feature FT:CDS FJ386656_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S142). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctatgtttcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cagcaaatgcccctatcttatcaacacttccggaacatactgttgttagacaaagacgcaggtcccctggaagaagaact
ccctcgcctcgccgaccaaggtctaaatcgccgcgtcgcagaagatctcggtctcgggaatctcaatgttag
>gnl|hbvcds|FJ386658_C_P-B Feature FT:CDS FJ386658_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S185). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtagagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcagctcaccatacgg
cactcaggcaagctattctatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacctttcctg
tcttacttttgggagagatactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
catcaaatgcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386660_C_P-B Feature FT:CDS FJ386660_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S221). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagca
tccagggacttagtagtcagctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagatactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ386666_C_P-B Feature FT:CDS FJ386666_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S367). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacgg
cactcaggcaagctattctgtgttggggtgaattgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386668_C_P-B Feature FT:CDS FJ386668_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S395). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386669_C_P-B Feature FT:CDS FJ386669_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S411). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgtacacctcaccatacag
cactcaggcaagctattgtgtgttggggtgagttgatgaacctagccacctgggtgggaagtaatttggacgatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386675_C_P-B Feature FT:CDS FJ386675_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S734). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggttatgtcaacgttaatatgggcctaaaactcagacaattattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386676_C_P-B Feature FT:CDS FJ386676_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1055). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctactctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386680_C_P-B Feature FT:CDS FJ386680_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1244). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcaactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagttagctatgtcaacgttaatatgggcctaaaaatcagacaacttttgtggtttcacatttcctg
tctaacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgttag
>gnl|hbvcds|FJ386681_C_P-B Feature FT:CDS FJ386681_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1336). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttaa
>gnl|hbvcds|FJ386682_C_P-B Feature FT:CDS FJ386682_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1416). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcatctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|FJ386683_C_P-B Feature FT:CDS FJ386683_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1450). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386684_C_P-B Feature FT:CDS FJ386684_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1554). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacatcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386688_C_P-B Feature FT:CDS FJ386688_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1632). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctacggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tctttcttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacgcttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ518811_C_P-B Feature FT:CDS FJ518811_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcttctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|FJ518812_C_P-B Feature FT:CDS FJ518812_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagcaacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562219_C_P-B Feature FT:CDS FJ562219_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacccctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562222_C_P-B Feature FT:CDS FJ562222_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I14). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacgg
cactcaggcaagctattctgtgttggggggagttgatgaatctagctacctgggtgggaagtaatttggaagatcaagca
tccagggaattggtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgaaaaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562224_C_P-B Feature FT:CDS FJ562224_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I16). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccagaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtaggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562231_C_P-B Feature FT:CDS FJ562231_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I44). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacacagcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaacttagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgtacttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562234_C_P-B Feature FT:CDS FJ562234_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I49). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacgcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacggtcatatgggcctaaaactcagacaactattgtggtttcacatttcttg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562236_C_P-B Feature FT:CDS FJ562236_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I51). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctacggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcatg
tcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562237_C_P-B Feature FT:CDS FJ562237_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I53). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgctgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctgttctgtgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562240_C_P-B Feature FT:CDS FJ562240_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I65). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaacctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562246_C_P-B Feature FT:CDS FJ562246_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I74). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacmcgtataaagaatttggagcttctgtggarttactctcttttttgccttcygacttytttccttctat
tcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcatatcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtggtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttactttcgggagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactccacctgcatatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562253_C_P-B Feature FT:CDS FJ562253_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I86). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctactcgacaccgcctcagctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactccgacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562254_C_P-B Feature FT:CDS FJ562254_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I87). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
catcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FJ562257_C_P-B Feature FT:CDS FJ562257_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I96). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcctctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562259_C_P-B Feature FT:CDS FJ562259_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I106). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacgcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
cactcaggcaagcaattctgtgttggggtgagttaatgaatctagccacctgggtgggaggtaatttggaagatccacaa
tccagggaagcagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagatactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562260_C_P-B Feature FT:CDS FJ562260_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I107). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatygacacstataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttcctaatat
tcgagatctcctcgacaccgccaatgctctgtatcgggagtccttagagtctccggaacattgttcagatcaccatacgg
caatcaggcacgctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagca
tccagggatttagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagacactgttattgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562262_C_P-B Feature FT:CDS FJ562262_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I111). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttgggttgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562289_C_P-B Feature FT:CDS FJ562289_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I160). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttctggaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562296_C_P-B Feature FT:CDS FJ562296_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I171). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatygacccgtataaagaatttggagcttctgyggagttactctcktttttgccttctgacttctttccttctrt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctatcctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaaatattgtggtttcacatttcctg
tctttcttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttattagaggaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562303_C_P-B Feature FT:CDS FJ562303_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I189). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctgt
tcgagatctcctcgacaccgctgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttagtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562311_C_P-B Feature FT:CDS FJ562311_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I202). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
caatcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagga
tccagggatttagtagtcggatatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcacatttcttg
tcttacttttgggagacaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcgtatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagagggagacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ562312_C_P-B Feature FT:CDS FJ562312_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I203). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacgtctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctactcgacaccgccgctgctttgtatcgggaggccttagagtctccggaacattgtacacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggactaaaactcagacaattattgtggtttcacatttcctg
tcttacttttgggagagacactgttcttgaatatttggtgtcttttggagtgtggatccgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactgctgttgttagaccaagaggcaggtcctctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ562316_C_P-B Feature FT:CDS FJ562316_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I208). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttctcctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgcatatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|FJ562321_C_P-B Feature FT:CDS FJ562321_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I214). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatcttctcgacaccgccactgctctgtatcgggatgccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562322_C_P-B Feature FT:CDS FJ562322_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I216). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
catcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ592177_C_P-B Feature FT:CDS FJ592177_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
ctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ667207_C_P-B Feature FT:CDS FJ667207_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Mars_RJ_8803658). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctat
tcgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtcaatgtcaatatgggcctaaaaattagacaacttttatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ751766_C_P-B Feature FT:CDS FJ751766_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttcttcccttctat
tcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
cacttaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaacttagacaaatattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccccatcttatcaacacttccggaaactgctattgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ751767_C_P-B Feature FT:CDS FJ751767_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, LHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
ctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ751769_C_P-B Feature FT:CDS FJ751769_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=547 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttaccttctgacttcttcccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaacttagacaaatattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccccatcttatcaacacttccggaaactactattgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
>gnl|hbvcds|FJ755833_C_P-B Feature FT:CDS FJ755833_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttcttcccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaggtccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccccatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatga
>gnl|hbvcds|FJ787444_C_P-B Feature FT:CDS FJ787444_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S208-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcatatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787475_C_P-B Feature FT:CDS FJ787475_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgccactgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctatcctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatcaagca
tccagggatttagtagtcggctatgttaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcacccctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787476_C_P-B Feature FT:CDS FJ787476_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX-3). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
ttgagatctcctcgacaccgccactgctttgtatcgggaggccttggagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctatcctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatcaagca
tccagggatttagtagtcggctatgttaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcacccctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787477_C_P-B Feature FT:CDS FJ787477_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LWM-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggaaatttggatgatcaagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaaggggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ899779_C_P-B Feature FT:CDS FJ899779_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C185-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaggca
tccagggatttagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899784_C_P-B Feature FT:CDS FJ899784_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttaccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggccatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899785_C_P-B Feature FT:CDS FJ899785_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttaccttctgacttctttccttctgt
tcgagacctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggatgatccagca
tccagggaattagtagtcggccatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899786_C_P-B Feature FT:CDS FJ899786_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215-7). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactcccttttttaccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctgttgtatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggatgatccagca
tccagggaattagtagtcggccatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899787_C_P-B Feature FT:CDS FJ899787_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215-9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttaccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggacgatccagca
tccagggaattagtagtcggccatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgtcgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899790_C_P-B Feature FT:CDS FJ899790_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C232-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaagatcaagca
tccagggacttagtagtcggttatgtcaacgttaacatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttctggaatatttggtgtcttttggagtgtggattcgcactcctcctccatatagac
caccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899791_C_P-B Feature FT:CDS FJ899791_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C232-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaagatcaagca
tccagggacttagtagtcggttatgtcaacgttaacatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttctggaatatttggtgtcttttggagtgtggattcgcactcctcctccatatagac
caccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358136_C_P-B Feature FT:CDS GQ358136_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIHB134). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcc
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctccagcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358137_C_P-B Feature FT:CDS GQ358137_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LBY001). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacacagcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagaagaaggtatcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358138_C_P-B Feature FT:CDS GQ358138_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LBY041). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacacagcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatttagccacttgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358139_C_P-B Feature FT:CDS GQ358139_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FLT032). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacacagcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctaaatcaccgcgtcgcagaagatttcaatctcggtaatctcaatgttag
>gnl|hbvcds|GQ358140_C_P-B Feature FT:CDS GQ358140_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FLT020). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctactgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358141_C_P-B Feature FT:CDS GQ358141_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LBY009). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggcgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tctgacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358142_C_P-B Feature FT:CDS GQ358142_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LAR070). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcgacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358143_C_P-B Feature FT:CDS GQ358143_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CBL027). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagaccccgca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tctgacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactagtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358144_C_P-B Feature FT:CDS GQ358144_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KDI15). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatagggaggccttagaatctccggaacattgttcacctcaccatacgg
cactcaggaaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagttatgttaatgttaatatgggcctaaaaataagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358145_C_P-B Feature FT:CDS GQ358145_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KDI04). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggaggtactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtcaccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggggagttgatgaatctagcaacctggttgggaagtaatttgaaagacccagca
tccagggaattagtagtcagttatgttaatgttaatatgggcctaaaaataagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagaggaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358146_C_P-B Feature FT:CDS GQ358146_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KDI35). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggaggtactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggggagttgatgaatctagcaacctggttgggaagtaatttgaaagacccagca
tccagggaattagtagtcagttatgttaatgttaatatgggcctaaaaataagacaattgttgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358147_C_P-B Feature FT:CDS GQ358147_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KDI43). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggaggtactctcttttttgccttctgactcctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggggagttgatgaatctagcaacctggttgggaagtaatttgaaagacccagca
tccagggaattagtagtcagttatgttaatgttaatatgggcctaaaaataagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgcctcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358148_C_P-B Feature FT:CDS GQ358148_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ALO36). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagaccttctcgacaccgcatctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccaaggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaaaagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctatagac
caccaaatgcccctattttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358149_C_P-B Feature FT:CDS GQ358149_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAN001). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagaccttctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagagactgttcttgaatatttggtgtctttcggagtgtggattcgcactcctcctgcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358150_C_P-B Feature FT:CDS GQ358150_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAN009). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagaccttctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagagaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358151_C_P-B Feature FT:CDS GQ358151_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAN011). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagaccttctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358152_C_P-B Feature FT:CDS GQ358152_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAN037). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagaccttctcgacaccgcctcagctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagagactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377519_C_P-B Feature FT:CDS GQ377519_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J16). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377525_C_P-B Feature FT:CDS GQ377525_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J24). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatcttctcgacaccgcctctgctctccatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcccgca
tccagggaattagtagttagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377537_C_P-B Feature FT:CDS GQ377537_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J48). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377542_C_P-B Feature FT:CDS GQ377542_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J61). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctactcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacatgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377547_C_P-B Feature FT:CDS GQ377547_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J78). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcatatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377550_C_P-B Feature FT:CDS GQ377550_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J81). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttcggacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcccgca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgtacttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|GQ377558_C_P-B Feature FT:CDS GQ377558_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J89). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377561_C_P-B Feature FT:CDS GQ377561_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J96). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgttaacgttaatatgggcctgaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377566_C_P-B Feature FT:CDS GQ377566_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J101). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactacagttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377567_C_P-B Feature FT:CDS GQ377567_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J102). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|GQ377568_C_P-B Feature FT:CDS GQ377568_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J103). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactacagttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377569_C_P-B Feature FT:CDS GQ377569_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J105). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacatgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377582_C_P-B Feature FT:CDS GQ377582_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J131). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctgctcgacaccgctactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
ctctcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggtctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377587_C_P-B Feature FT:CDS GQ377587_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J138). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cagcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377588_C_P-B Feature FT:CDS GQ377588_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J141). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377606_C_P-B Feature FT:CDS GQ377606_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J171). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactgaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagttagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377610_C_P-B Feature FT:CDS GQ377610_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J177). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacgcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggtctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctccggcatatagac
ctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377612_C_P-B Feature FT:CDS GQ377612_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J180). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377622_C_P-B Feature FT:CDS GQ377622_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J207). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377625_C_P-B Feature FT:CDS GQ377625_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J222). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377629_C_P-B Feature FT:CDS GQ377629_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J234). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377638_C_P-B Feature FT:CDS GQ377638_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J250). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377639_C_P-B Feature FT:CDS GQ377639_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J251). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggggagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377641_C_P-B Feature FT:CDS GQ377641_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J254). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctatcctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377643_C_P-B Feature FT:CDS GQ377643_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J258). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377644_C_P-B Feature FT:CDS GQ377644_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J294). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtcgagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacgg
caatcaggcaatgtattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggttatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagaggaagacgcaggtcccctagaagaagaact
ccatcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ475340_C_P-B Feature FT:CDS GQ475340_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KOR36HCC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggtctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ855522_C_P-B Feature FT:CDS GQ855522_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate migrant 23). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ855526_C_P-B Feature FT:CDS GQ855526_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate migrant 103). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=550 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttgggttgagttaatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtaagctatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacctaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatcacaatctccggaatctcaatgtt
>gnl|hbvcds|GQ855532_C_P-B Feature FT:CDS GQ855532_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate migrant 210). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924603_C_P-B Feature FT:CDS GQ924603_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924605_C_P-B Feature FT:CDS GQ924605_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctngaatanttggtntcttttggagtgtggattcgcactcntcctgcatatagac
cnccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcncctcgcagrcgaaggtctcaatcgccgcgtggcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924606_C_P-B Feature FT:CDS GQ924606_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgntctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacgg
cactcaggcaagctattstgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924607_C_P-B Feature FT:CDS GQ924607_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M13). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatggccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924608_C_P-B Feature FT:CDS GQ924608_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M15). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924610_C_P-B Feature FT:CDS GQ924610_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M19). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccggtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924611_C_P-B Feature FT:CDS GQ924611_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M28). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattmtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagac
caccaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924617_C_P-B Feature FT:CDS GQ924617_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M34). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
acgggatcttctcgacaccgcttctgctctgtatcgggaggcattagagtctccggaacattgttcacatcaccatacgg
cactcaggcaagctattctgtgctggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaagttgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcttgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagaccacgaagcaggtcccttagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctccatgttag
>gnl|hbvcds|GQ924621_C_P-B Feature FT:CDS GQ924621_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M39). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttagaagacccagca
tccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924624_C_P-B Feature FT:CDS GQ924624_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M42). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacactgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatcctgca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatacttggtgtcwtttggagtgtggattcgcactcctcctgcatacagac
caccaaatgcccctatcttatccactcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924625_C_P-B Feature FT:CDS GQ924625_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M43). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcgtctaccgagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagctacctgggtgggaggtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|GQ924626_C_P-B Feature FT:CDS GQ924626_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M47). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgatgacttctttccttctgt
tcgagatcttcttgacactgcttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagagaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaattattgtggtttcacrtttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctgctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacaacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctaaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924627_C_P-B Feature FT:CDS GQ924627_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M48). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcatctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924628_C_P-B Feature FT:CDS GQ924628_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M50). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctactat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgcacacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagaccaagca
tccagggatttagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgtccttgaatatctggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaacctcaatgttag
>gnl|hbvcds|GQ924630_C_P-B Feature FT:CDS GQ924630_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M52). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgcctgttgacttctatccttctat
tcgagatctcctcgacaccgcctcagctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cattaaggcaagctattgtgtgttggggtgagttggtgaatctagccacctgggtgggaggtaatttggaagatcaagca
tccagggaattagtagtcggctatgtcaacggtaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggcttcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaacctcaatgttag
>gnl|hbvcds|GQ924631_C_P-B Feature FT:CDS GQ924631_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M53). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttccttctat
tcgagatctcctcgataccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccggca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
ctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924632_C_P-B Feature FT:CDS GQ924632_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M54). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccctataaagaatttggagcttctgtgcagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacatgtttcagctcaccatacgg
ctctcaggcaagctattctgtgttggggtgagttaatgaacctagccacctgggtgggaagtaatttggaagatcaagca
tccagggatttagtagtcagctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagacaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagaccaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|GQ924634_C_P-B Feature FT:CDS GQ924634_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M57). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattttgtgttggggtgaattgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924635_C_P-B Feature FT:CDS GQ924635_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M67). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgcctactgacttctttccttctgt
tcgagatctgctcgacaccgcctctgctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagaccccgca
tccagggaattagtagtcggctatgtcaatgttaatatgggcataaaactcagacaactattgtggtttcacatttcctg
tattacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcaggcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacaaggaagcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatttcaatgtcgggaatgtcaatgttag
>gnl|hbvcds|GQ924637_C_P-B Feature FT:CDS GQ924637_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M69). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacatctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatcttcttgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatactg
cgctcaggcaagctattgtgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagacccagca
tccagggatttagtagtcagctatgtcaatgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctg
tattacttttggaagagaaattgttcttgaatatttggtctctttcggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacgcttccggaaactgctgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgttag
>gnl|hbvcds|GQ924638_C_P-B Feature FT:CDS GQ924638_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M70). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctccgccctgtttcgggaggccttagagtctccggaacattgtacacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagacccagca
tccagggaatcagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacctttcctg
tcttacttttggaagagaagttgttcttgaatatttggtctctttcggagtgtggattcgcactccttctgcatatagac
cacaaaatgcccctatcttatcaacgcttccggaaactactgttgttagaggacgaggcaggtcccctagaagaagaact
ccctcgcgtcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924639_C_P-B Feature FT:CDS GQ924639_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M71). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatcttctcgacaccgcctccgccctgtatcgggaggccttagagtctccggaacattgttcagctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtctctttcggagtgtggattcgcactcctactgcatatagac
caccaaatgcccctatcttatcaacacttccggaaattactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcgtcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924640_C_P-B Feature FT:CDS GQ924640_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M72). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgggatctgctcgacaccgcctctgctctgtatcgggaggccttagagtctccagaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggggagttaatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924641_C_P-B Feature FT:CDS GQ924641_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M76). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcttctgcggagttactctcttttttgcctactgacttctatccttctgt
tcgagatcttctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctatgttggggtgaattgatgaatctagccacctgggtgggaggtaatttggaagaccaagca
tccagggaatcagtagtcagatatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcacatttcctg
tattacttttggaagagaaattgttgttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggagtgtgctgttgttagtcgaaggggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatgtagggaacctcaatgttag
>gnl|hbvcds|GQ924644_C_P-B Feature FT:CDS GQ924644_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M79). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924645_C_P-B Feature FT:CDS GQ924645_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M82). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctacggagttactctcttttttgccttctgacttttttccttctat
tcgagatcttctcgacaccgcctctgctctgtatagggaggccttagagtctccggaacactgtacacctcaccatacgg
cgctcaggcaagctattctgtgttggggtgagttaatgaatcttgccacctgggtggggagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatctcctg
tcttacttttggaagagaagttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcaggcatatagac
catcaaatgcccctatcttatcaacacttccggaaactactgttattagacgaagaagcaggtcccttagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|GQ924646_C_P-B Feature FT:CDS GQ924646_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M83). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatagggaggccttagaatctccggaacattgttcagctcaccatacgg
cactcaggcaagctgttctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatcaagca
tccagggacttagtagtcagctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctggatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagaggaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|GQ924647_C_P-B Feature FT:CDS GQ924647_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M84). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttcctgctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacatcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaagcaatagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacgcttccggaaactactgttgttagaggaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924648_C_P-B Feature FT:CDS GQ924648_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacatatttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagccatgtcaacgttaatatgggcctaaaaatgagacaaatattgtggtttcacatttcctg
tctttgttttgggagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924651_C_P-B Feature FT:CDS GQ924651_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M88). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924653_C_P-B Feature FT:CDS GQ924653_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M90). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924654_C_P-B Feature FT:CDS GQ924654_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M91). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924656_C_P-B Feature FT:CDS GQ924656_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M93). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctgt
ccgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgtacacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagca
tccagggaattagtagtcagctatgttaatgttaatatgggcctaaaattcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgccttgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|GQ924660_C_P-B Feature FT:CDS GQ924660_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M74). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctccgctttgcatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatctggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccacatttcttg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctatagac
caccaaatgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|GU357842_C_P-B Feature FT:CDS GU357842_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C4371). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU434372_C_P-B Feature FT:CDS GU434372_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 011-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggtctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU434373_C_P-B Feature FT:CDS GU434373_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 209-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggtctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU451682_C_P-B Feature FT:CDS GU451682_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate pLL-EGFP). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcctctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815548_C_P-B Feature FT:CDS GU815548_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815549_C_P-B Feature FT:CDS GU815549_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815550_C_P-B Feature FT:CDS GU815550_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatcccgggaatctcaatgttag
>gnl|hbvcds|GU815551_C_P-B Feature FT:CDS GU815551_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815552_C_P-B Feature FT:CDS GU815552_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgagtctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815553_C_P-B Feature FT:CDS GU815553_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815554_C_P-B Feature FT:CDS GU815554_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcaactatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815555_C_P-B Feature FT:CDS GU815555_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815556_C_P-B Feature FT:CDS GU815556_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815557_C_P-B Feature FT:CDS GU815557_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815558_C_P-B Feature FT:CDS GU815558_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-11). Complete genome. [Hepadnaviridae] (length=552 residues).
gtggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctcctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815559_C_P-B Feature FT:CDS GU815559_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815560_C_P-B Feature FT:CDS GU815560_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815561_C_P-B Feature FT:CDS GU815561_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815562_C_P-B Feature FT:CDS GU815562_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815563_C_P-B Feature FT:CDS GU815563_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815564_C_P-B Feature FT:CDS GU815564_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgagtctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815565_C_P-B Feature FT:CDS GU815565_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815566_C_P-B Feature FT:CDS GU815566_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815567_C_P-B Feature FT:CDS GU815567_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815568_C_P-B Feature FT:CDS GU815568_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815569_C_P-B Feature FT:CDS GU815569_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815570_C_P-B Feature FT:CDS GU815570_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815571_C_P-B Feature FT:CDS GU815571_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815572_C_P-B Feature FT:CDS GU815572_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-1). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagac
caccaaatgcccctatcttatcaacacttccggaagctactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|GU815573_C_P-B Feature FT:CDS GU815573_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-2). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815574_C_P-B Feature FT:CDS GU815574_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815575_C_P-B Feature FT:CDS GU815575_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815576_C_P-B Feature FT:CDS GU815576_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815577_C_P-B Feature FT:CDS GU815577_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815578_C_P-B Feature FT:CDS GU815578_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatgtgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815579_C_P-B Feature FT:CDS GU815579_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815581_C_P-B Feature FT:CDS GU815581_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815583_C_P-B Feature FT:CDS GU815583_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815584_C_P-B Feature FT:CDS GU815584_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815585_C_P-B Feature FT:CDS GU815585_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815586_C_P-B Feature FT:CDS GU815586_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815587_C_P-B Feature FT:CDS GU815587_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtatgaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaaattggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815588_C_P-B Feature FT:CDS GU815588_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815589_C_P-B Feature FT:CDS GU815589_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-8). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
ttgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815590_C_P-B Feature FT:CDS GU815590_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815591_C_P-B Feature FT:CDS GU815591_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815593_C_P-B Feature FT:CDS GU815593_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815594_C_P-B Feature FT:CDS GU815594_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815595_C_P-B Feature FT:CDS GU815595_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815596_C_P-B Feature FT:CDS GU815596_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815597_C_P-B Feature FT:CDS GU815597_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815598_C_P-B Feature FT:CDS GU815598_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815599_C_P-B Feature FT:CDS GU815599_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatacttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815600_C_P-B Feature FT:CDS GU815600_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-7). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcctttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815601_C_P-B Feature FT:CDS GU815601_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815602_C_P-B Feature FT:CDS GU815602_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815603_C_P-B Feature FT:CDS GU815603_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815604_C_P-B Feature FT:CDS GU815604_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815605_C_P-B Feature FT:CDS GU815605_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcctctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815606_C_P-B Feature FT:CDS GU815606_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815607_C_P-B Feature FT:CDS GU815607_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815608_C_P-B Feature FT:CDS GU815608_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815609_C_P-B Feature FT:CDS GU815609_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattggcccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815610_C_P-B Feature FT:CDS GU815610_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815611_C_P-B Feature FT:CDS GU815611_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-6). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815612_C_P-B Feature FT:CDS GU815612_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcccctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815613_C_P-B Feature FT:CDS GU815613_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815614_C_P-B Feature FT:CDS GU815614_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815616_C_P-B Feature FT:CDS GU815616_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-11). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815617_C_P-B Feature FT:CDS GU815617_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815618_C_P-B Feature FT:CDS GU815618_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815619_C_P-B Feature FT:CDS GU815619_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttccta
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815620_C_P-B Feature FT:CDS GU815620_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815621_C_P-B Feature FT:CDS GU815621_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815622_C_P-B Feature FT:CDS GU815622_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815623_C_P-B Feature FT:CDS GU815623_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815624_C_P-B Feature FT:CDS GU815624_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-7). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815625_C_P-B Feature FT:CDS GU815625_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815626_C_P-B Feature FT:CDS GU815626_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815627_C_P-B Feature FT:CDS GU815627_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggatttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815628_C_P-B Feature FT:CDS GU815628_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815629_C_P-B Feature FT:CDS GU815629_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815630_C_P-B Feature FT:CDS GU815630_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815631_C_P-B Feature FT:CDS GU815631_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815632_C_P-B Feature FT:CDS GU815632_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815633_C_P-B Feature FT:CDS GU815633_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815634_C_P-B Feature FT:CDS GU815634_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-10). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815635_C_P-B Feature FT:CDS GU815635_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgcgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815636_C_P-B Feature FT:CDS GU815636_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815637_C_P-B Feature FT:CDS GU815637_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815638_C_P-B Feature FT:CDS GU815638_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815639_C_P-B Feature FT:CDS GU815639_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcgcctcatcatacgg
cactcaggcaagctattctgtgttgggttgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815640_C_P-B Feature FT:CDS GU815640_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactcccttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815641_C_P-B Feature FT:CDS GU815641_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaaggggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815642_C_P-B Feature FT:CDS GU815642_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815643_C_P-B Feature FT:CDS GU815643_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815644_C_P-B Feature FT:CDS GU815644_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815645_C_P-B Feature FT:CDS GU815645_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815646_C_P-B Feature FT:CDS GU815646_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1.D1.5-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggattaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815647_C_P-B Feature FT:CDS GU815647_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2.D1.5-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815648_C_P-B Feature FT:CDS GU815648_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3.D1.5-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815649_C_P-B Feature FT:CDS GU815649_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 4.D1.5-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815650_C_P-B Feature FT:CDS GU815650_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 5.D1.5-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815651_C_P-B Feature FT:CDS GU815651_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6.D1.5-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815652_C_P-B Feature FT:CDS GU815652_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 7.D1.5-7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815653_C_P-B Feature FT:CDS GU815653_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 8.D1.5-8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815654_C_P-B Feature FT:CDS GU815654_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 9.D1.5-9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815656_C_P-B Feature FT:CDS GU815656_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 11.D1.5-11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815657_C_P-B Feature FT:CDS GU815657_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 12.D1.5-12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcccg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815658_C_P-B Feature FT:CDS GU815658_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815659_C_P-B Feature FT:CDS GU815659_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctggcttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815660_C_P-B Feature FT:CDS GU815660_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815661_C_P-B Feature FT:CDS GU815661_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815662_C_P-B Feature FT:CDS GU815662_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcgatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815663_C_P-B Feature FT:CDS GU815663_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815664_C_P-B Feature FT:CDS GU815664_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgcgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815665_C_P-B Feature FT:CDS GU815665_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815666_C_P-B Feature FT:CDS GU815666_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815667_C_P-B Feature FT:CDS GU815667_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815668_C_P-B Feature FT:CDS GU815668_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggcgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815669_C_P-B Feature FT:CDS GU815669_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgagtctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815670_C_P-B Feature FT:CDS GU815670_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815672_C_P-B Feature FT:CDS GU815672_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815673_C_P-B Feature FT:CDS GU815673_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttaggcgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815674_C_P-B Feature FT:CDS GU815674_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815675_C_P-B Feature FT:CDS GU815675_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815676_C_P-B Feature FT:CDS GU815676_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcagcgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815677_C_P-B Feature FT:CDS GU815677_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagttattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815678_C_P-B Feature FT:CDS GU815678_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggtttaaaaatcagacaactattgtggtttaacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815679_C_P-B Feature FT:CDS GU815679_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815680_C_P-B Feature FT:CDS GU815680_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815681_C_P-B Feature FT:CDS GU815681_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815683_C_P-B Feature FT:CDS GU815683_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815684_C_P-B Feature FT:CDS GU815684_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815685_C_P-B Feature FT:CDS GU815685_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815686_C_P-B Feature FT:CDS GU815686_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815687_C_P-B Feature FT:CDS GU815687_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815688_C_P-B Feature FT:CDS GU815688_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815689_C_P-B Feature FT:CDS GU815689_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815691_C_P-B Feature FT:CDS GU815691_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815692_C_P-B Feature FT:CDS GU815692_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815693_C_P-B Feature FT:CDS GU815693_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815694_C_P-B Feature FT:CDS GU815694_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815695_C_P-B Feature FT:CDS GU815695_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccgaaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815696_C_P-B Feature FT:CDS GU815696_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccctacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815697_C_P-B Feature FT:CDS GU815697_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815698_C_P-B Feature FT:CDS GU815698_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815699_C_P-B Feature FT:CDS GU815699_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctgttctatgttgggttgaattaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaacggttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815700_C_P-B Feature FT:CDS GU815700_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcgccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815701_C_P-B Feature FT:CDS GU815701_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctgttctatgttgggttgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaacggttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815702_C_P-B Feature FT:CDS GU815702_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815703_C_P-B Feature FT:CDS GU815703_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815704_C_P-B Feature FT:CDS GU815704_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815705_C_P-B Feature FT:CDS GU815705_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaacggttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815706_C_P-B Feature FT:CDS GU815706_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctgttctatgttgggttgaattaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaacggttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815707_C_P-B Feature FT:CDS GU815707_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctgttctatgttgggttgaattaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaacggttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815708_C_P-B Feature FT:CDS GU815708_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815709_C_P-B Feature FT:CDS GU815709_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaacggttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815710_C_P-B Feature FT:CDS GU815710_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctgttctatgttgggttgaattaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaacggttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815711_C_P-B Feature FT:CDS GU815711_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815712_C_P-B Feature FT:CDS GU815712_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggagaccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatacccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815713_C_P-B Feature FT:CDS GU815713_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815715_C_P-B Feature FT:CDS GU815715_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815716_C_P-B Feature FT:CDS GU815716_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815717_C_P-B Feature FT:CDS GU815717_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815718_C_P-B Feature FT:CDS GU815718_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815719_C_P-B Feature FT:CDS GU815719_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815720_C_P-B Feature FT:CDS GU815720_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815721_C_P-B Feature FT:CDS GU815721_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815722_C_P-B Feature FT:CDS GU815722_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-9). Complete genome. [Hepadnaviridae] (length=552 residues).
atgggcattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815723_C_P-B Feature FT:CDS GU815723_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815724_C_P-B Feature FT:CDS GU815724_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815725_C_P-B Feature FT:CDS GU815725_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815726_C_P-B Feature FT:CDS GU815726_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815727_C_P-B Feature FT:CDS GU815727_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815728_C_P-B Feature FT:CDS GU815728_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815729_C_P-B Feature FT:CDS GU815729_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815730_C_P-B Feature FT:CDS GU815730_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815731_C_P-B Feature FT:CDS GU815731_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815732_C_P-B Feature FT:CDS GU815732_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815733_C_P-B Feature FT:CDS GU815733_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815734_C_P-B Feature FT:CDS GU815734_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815735_C_P-B Feature FT:CDS GU815735_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815736_C_P-B Feature FT:CDS GU815736_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815737_C_P-B Feature FT:CDS GU815737_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815738_C_P-B Feature FT:CDS GU815738_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815739_C_P-B Feature FT:CDS GU815739_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttagtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815740_C_P-B Feature FT:CDS GU815740_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815741_C_P-B Feature FT:CDS GU815741_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-4). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815742_C_P-B Feature FT:CDS GU815742_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815743_C_P-B Feature FT:CDS GU815743_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815744_C_P-B Feature FT:CDS GU815744_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815745_C_P-B Feature FT:CDS GU815745_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815746_C_P-B Feature FT:CDS GU815746_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815747_C_P-B Feature FT:CDS GU815747_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcatcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaataggggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815748_C_P-B Feature FT:CDS GU815748_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcatcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaataggggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815749_C_P-B Feature FT:CDS GU815749_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815750_C_P-B Feature FT:CDS GU815750_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-14). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815751_C_P-B Feature FT:CDS GU815751_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgaggtctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815752_C_P-B Feature FT:CDS GU815752_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggcctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815753_C_P-B Feature FT:CDS GU815753_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815754_C_P-B Feature FT:CDS GU815754_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggttgcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815755_C_P-B Feature FT:CDS GU815755_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815756_C_P-B Feature FT:CDS GU815756_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815757_C_P-B Feature FT:CDS GU815757_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815759_C_P-B Feature FT:CDS GU815759_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815760_C_P-B Feature FT:CDS GU815760_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815761_C_P-B Feature FT:CDS GU815761_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgttgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815762_C_P-B Feature FT:CDS GU815762_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815764_C_P-B Feature FT:CDS GU815764_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgttgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815765_C_P-B Feature FT:CDS GU815765_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaacc
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815766_C_P-B Feature FT:CDS GU815766_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815767_C_P-B Feature FT:CDS GU815767_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815768_C_P-B Feature FT:CDS GU815768_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815769_C_P-B Feature FT:CDS GU815769_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815770_C_P-B Feature FT:CDS GU815770_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815771_C_P-B Feature FT:CDS GU815771_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815772_C_P-B Feature FT:CDS GU815772_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815773_C_P-B Feature FT:CDS GU815773_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815774_C_P-B Feature FT:CDS GU815774_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815775_C_P-B Feature FT:CDS GU815775_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggtagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815776_C_P-B Feature FT:CDS GU815776_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-21). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctattgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815777_C_P-B Feature FT:CDS GU815777_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcatcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815778_C_P-B Feature FT:CDS GU815778_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattaatagtcggctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815779_C_P-B Feature FT:CDS GU815779_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815780_C_P-B Feature FT:CDS GU815780_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
catcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815781_C_P-B Feature FT:CDS GU815781_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815782_C_P-B Feature FT:CDS GU815782_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815783_C_P-B Feature FT:CDS GU815783_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU827630_C_P-B Feature FT:CDS GU827630_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CMC104L). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacactgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggacgacccagca
tctagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccttccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM011466_C_P-B Feature FT:CDS HM011466_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcctctgcggagttactctcttttttgccttctgacttctatccttctat
tcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttaatgtctctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggragagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcgtatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|HM011467_C_P-B Feature FT:CDS HM011467_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=549 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcagctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtyaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccatatagac
caccaaatgcccctatcttatcaacacttccggaaaytactgttgttagaggacgcaggtcccctagaagaagaactccc
tcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|HM011469_C_P-B Feature FT:CDS HM011469_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttaatctcttttttgccttctgacttctttccttctat
tcgagaccttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacatkkttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggtaayttggaagacccarca
tccagggaagcagtagtcggctatgttaatgttaatatgggcctaaaactcagacaattattgtggtttcacrtttcctg
tcttacktttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttrttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggrayctcaatgttag
>gnl|hbvcds|HM011470_C_P-B Feature FT:CDS HM011470_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgtacacctcaccatacgg
cactcagacaagttattctgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaagatccagca
tccagggaagcagtagtcagctatgtcaacgttaatatgggcctaaaagtcagacaactattgtggtttcacatttcttg
tcttacttttgggagagaagttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatacagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM011471_C_P-B Feature FT:CDS HM011471_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcgtctattgagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgakttratgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaatcagtagtcagctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgtccttgaatatttggtgtcttttggagtgtggatgcgcactccccctgcatacagac
cacaaaatgcccctatcttatcaacacttccggaaactgctgttattagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|HM011473_C_P-B Feature FT:CDS HM011473_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctymtgacttctntccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgkgtgttggggtgaggtaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgataatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactrctgttattagacmaagaggcaggwcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaayctcaatgttaa
>gnl|hbvcds|HM011474_C_P-B Feature FT:CDS HM011474_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgayttctttccttccgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
caatcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggacgatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaattcagacaactattgtggtttcacatttcctg
tctcacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagaccaagaggcaggtcctctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagamgatctcartctcgggaatcycaatgttag
>gnl|hbvcds|HM011475_C_P-B Feature FT:CDS HM011475_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatygacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgccwctgctttgtatcgggaggccttagagtctccrgaacattgyacwcctcaccatacgg
cactcaggcaagctattstrtgytggggtgagttaatgaayctagccacctgggtgggargwaatytggaagatcmakca
tccagggamkyagtagttrgctatgtcaacgttaatatgggcctaaaamtcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtttggattcgcactcctattgcatatagac
caccaaatgcccctatcttatcaacacttccggaaamtactgttrttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaayctcaatgttag
>gnl|hbvcds|HM011476_C_P-B Feature FT:CDS HM011476_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctattgagttactctcttttttgccttctgacttctttccttctat
tcgagatctccttgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaacctagccacctgggtgggaggtaatttggacgatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcataaaactcagacaacaattgtggtttcatatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagaggaagacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM011477_C_P-B Feature FT:CDS HM011477_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtgragttactctcttttttgccttctgacttctttccttctgw
tsragatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattatacacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggargtaatttggaagatccagsa
tcccgggaagcagtagtcaactatgtcaacgttaatatgggcataaaaatcagacaactwttgtggtttcacatttcctg
tcttacttttggaarammkackgttcttgaatatttggtctcttttggagtgtggatkcgcactcctcctgcatatagrc
cacaaaatgcccctatcttatcwacrcttccggaaactactgttrttagacaaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgttgcagaagatctcaatctcgggaacctcgatgttar
>gnl|hbvcds|HM011478_C_P-B Feature FT:CDS HM011478_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgyksagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgckctgtatcgggaggccttagagtctccggaacattgctcagctcaccatacgg
cactcaggcaagctattttgtgttggggtgagttaatgaatctcgccacctgggtgggaagtaatttggaagatccatca
tccagggaagcagtagtcagctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttgggagagatactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctwctgcatatagac
caccaaatgcccctatcttgtcaacacttccggaaactactgttgttagaggaagacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM011480_C_P-B Feature FT:CDS HM011480_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccagaacattgttcagctcaccatacag
cactcaggcaagctattctgtgttggggtgagttaacgaatctagccacctgggtgggaggtaatttggaagatcaagca
tccagggaattagtagtcggttatgtcaacgataatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtttcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM011482_C_P-B Feature FT:CDS HM011482_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacrydtataaagaatttggagcttctgtggagttactctcttttttgcctmmwgacttctwtccywmtgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacag
yactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaggtaatttggaagatcmagsa
tccagggamkyagtagtcasctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctg
tcttayktttgggagagaaactgttcttgaatatttggtgtcttttggggtgtggattcgcactcctmctgcatatagac
cascaaatgcccctatcttatcaacacttccggaaactactgttrttagaggaagacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|HM011483_C_P-B Feature FT:CDS HM011483_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgcctyttgayttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacatcaccatacgg
cactcaggcaagccattctgtgttggggtgagttaatgaatctagccacctgggtgggargtaatttgcaagatcmasca
tccagggamtyagtagtcaactatgtcaacgttaatatgggcmtaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggmrakmaactgttcttgaatwtttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacmaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagakgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgytag
>gnl|hbvcds|HM011484_C_P-B Feature FT:CDS HM011484_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctgt
tcgagatctcctcgacaccgccnctgctctgtatcgggaggccttagagtctccggaacattgtacasctcaccayacrg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaggtaatttggaagatccmrca
tccagggaagyagtagtcaactatgtcaacgttaacatgggcataaaaatcagacaactattgtggtttcacatttcctg
tcttatgtttgggagagamrytgttcttgaatatttggtctcttttggagtgtggatycgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactrctgttrttagacgaagaagcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaayctcaatgttag
>gnl|hbvcds|HM011487_C_P-B Feature FT:CDS HM011487_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctaccacggagttagtctcttttttgccttctgatttctttccttctat
tcgagatcttcttgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
ctctcaggcaagctrttctctgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggacgatccagca
tccagggaattggtagtcggctatgtcaatgttaatatgggcataaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagacactgttcttgaatatttagtgtcttttggagtgtggattcgcactcctcctccatataggc
caccaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgacgcggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM011490_C_P-B Feature FT:CDS HM011490_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgttgagttactctcttttttgccttctgacttctttccttctat
acgggatcttctcgacaccgcttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatactg
caatcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagaccaagca
tcccgggaattagtagtcggctatgtcaatgttaatatgggcataaaactcagacaactnttgtggtttcacatttcctg
tattacttttggaagagawactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctgctccatatagac
caccaaatgcccctatcttatcaacacttccggagattactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM011492_C_P-B Feature FT:CDS HM011492_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagaccaagcc
tcccgggatttagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM011494_C_P-B Feature FT:CDS HM011494_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacstataaagaatttggagcttctgtggagttactctcttttttgccttckgacttctttccttctrt
tcgagatctcctcgacaccgccwctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cgctcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagttagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggragagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctmctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggwcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctmaatctcgggaatctcaatgttag
>gnl|hbvcds|HM011496_C_P-B Feature FT:CDS HM011496_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggayatygacacstataaagaatttggagcytctgcggagttactctcttttttgccttctgacttctttcctaatat
tcgagatctwctcgacaccgccaatgctctgtatcgrgaggccttrgagtctccggaacactgyacacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagaccaatca
tccagggatttagtagtcggctatgtcaatgttaatatgggcctgaaactcagacaactattgtggttycacatttcttg
ccttacttttggaaaagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttag
>gnl|hbvcds|HM011499_C_P-B Feature FT:CDS HM011499_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttamtctcttttttgccttctgacttctttccttctat
tcgagaccttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacatwkttcasctcaccatacgg
crctcaggcaagctattctgtgttggggtgagttgrtgaatctagccacctgggtgggaagtaatttggamgacccagca
tccagggaakyagtagtcrgctatgtyaatgkyaatatgggcctaaaaatcaggcawctattgtggtttcacatttcctg
tcttacttttggaaragamactgttcttgaatatttggtrtcttttggagtgtggattcgcactcctcctscatatagac
crccaaatgcccctatcttatcaacacttccggaaaytrctgttgttagacracgaggcaggwcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggratccmamtgttag
>gnl|hbvcds|HM011503_C_P-B Feature FT:CDS HM011503_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctgctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgtwcacctcaccatacgg
cactcaggcaagcyattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaagttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgtksttagacgaaggggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggamcctcaatgttag
>gnl|hbvcds|HM011504_C_P-B Feature FT:CDS HM011504_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacatgtttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaagatcctgca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaaatattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacgcttccggaaacttgtgttgttagacaaagaggcaggtccactagaagaagaact
ccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgttag
>gnl|hbvcds|HM153811_C_P-B Feature FT:CDS HM153811_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 712005001256). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggaattactctcttttttgccttctgacttctttccttctat
tcgagatctgctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattggtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|HQ700546_C_P-B Feature FT:CDS HQ700546_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BC_NC_AM263). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttcctaatat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacgg
cactcaggcaagctattctgtgttggggtgaattgatgaatctagccacctgggtsggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatatcaatgttag
>gnl|hbvcds|HQ700548_C_P-B Feature FT:CDS HQ700548_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I_WA1031A). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactaaggcaagctattctgtgttggggcgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700549_C_P-B Feature FT:CDS HQ700549_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I_WA1098A). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacttgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcatatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcacacctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF412801_C_P-B Feature FT:CDS JF412801_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBVJSTZ3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacttgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF436921_C_P-B Feature FT:CDS JF436921_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SZ7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacatcaccatacgg
caatcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcataaaactcagacaattattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctatagac
caccaaatgcccctatcttatcaatgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF775480_C_P-B Feature FT:CDS JF775480_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 10B1). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF775482_C_P-B Feature FT:CDS JF775482_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 10B4). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggcagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JF775483_C_P-B Feature FT:CDS JF775483_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 10B6). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctat
tcgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcc
tccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JF775484_C_P-B Feature FT:CDS JF775484_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 10B10). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF899335_C_P-B Feature FT:CDS JF899335_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 10B1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN406371_C_P-B Feature FT:CDS JN406371_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WHUB1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacatgggtgggaagtaatttggaagatccagca
tcccgggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN792893_C_P-B Feature FT:CDS JN792893_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MN2004). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctctttcttgccttctgacttctttccgtcggt
tcgggatctcctagacaccgccactgctttgtatcgagaagccttagagtctcctgaacatgtctcgcctcaccatacag
cactcaggcaagccattttgtgctggggggacttaatgactctagctacatgggtgggtaataatttagaagatccagca
tccagagacctagtagtcaattatgttaacaataccacgggactaaagatcaggcaattattgtggtttcacatttcctg
tcttacctttgggagagacactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctcgggaatcctaatgttag
>gnl|hbvcds|JN792894_C_P-B Feature FT:CDS JN792894_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MN2009). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctctttcttgccttctgacttctttccgtcggt
tcgggatctcctagacaccgccgctgcgttgtatcgggaagccttagagtctcctgaacattgctcgtatcaccatacag
cactcaggcaagccattttgtgctggggggaattaatgactctagcttcatgggtgggtaataatttacaagatccagca
tccagagacctagtagtcaattatgttaacactaacatgggactaaagatcaggcaattattgtggtttcacgtttcctg
tcttacctttgggagaaacactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaggaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttaa
>gnl|hbvcds|JN792895_C_P-B Feature FT:CDS JN792895_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KM2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggcgctactgtggagttactctcttttttgcctactgacttctttccgtcggt
tcgagatctcctagacaccgccgctgctttgtttcgggaagccttagagtcccctgaacattgctcacctcaccatacag
cactcaggcaagctattttgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaagatcaagca
tccagagacctagtagtcaattatgttaacactaatatgggactaaagatcaggcaattattgtggtttcacgtttcctg
tattatctttgggagagacattgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|JN792896_C_P-B Feature FT:CDS JN792896_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KM2009). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggcgctactgtggagttactctcttttttgcctactgacttctttccgtcggt
tcgagatctcctagacaccgccgctgctttgtttcgggatgccttagagtcccctgaacattgctcacctcaccatacag
caatcaggcaagccattttgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaagatcaagca
tccagagacctagtagtcaattatgttaacactcatatgggactaaagatcaggcaattattgtggtttcacgtttcctg
tattatctttgggagagacattgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JN792897_C_P-B Feature FT:CDS JN792897_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IT2009). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctctttcttgccttctgacttctttccgtcggt
tcgggatctcctagacaccgcctctgctctgtatagggatgccttggagtctccggaacattgctcgcctcaccatacag
caatcaggcaagctattttgtgctggggcgaattaatgactctagctacctgggtgggtaataatttagacgatccagca
tccagagacctagtagtcaattatgttaacactcacatgggactaaagatcaggcaattattgtggtttcacatttcctg
tattacctttgggagagatactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagactccgacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|JN792898_C_P-B Feature FT:CDS JN792898_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IT2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctctttcttgccttctgacttctttccgtcggt
tcgggatctcctagacaccgcctctgctctgtatagggatgccttggagtctccggaacattgctcggctcaccatacag
caatcaggcaagctattttgtgctggggcgaattaatgactctagctacctgggtgggtaataatttagacgatccagca
tccagagacctagtagtcaattatgttaacactcacatgggactaaagatcaggcaattattgtggtttcacatttcctg
tattacctttgggagagatactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagactccgacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|JN792899_C_P-B Feature FT:CDS JN792899_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AT2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccgtcggt
tcgggatctcctagacaccgcctctgctttgtatcgggaagccttagagtctcctgaacattgttcggctcaccatacag
caatcaggcaagctattttgtgctggggggaattaatgactctagcttcctgggtgggtagtaatttaaatgatccagct
tccagagacctagtagtcaattatgttaacattaacatgggactaaagatcaggcaattattgtggtatcacatttcctg
tattacctttgggagagacactgttctcgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JN792900_C_P-B Feature FT:CDS JN792900_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AT2009). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccgtcggt
tcgggatctcctagacaccgccactgctttgtatcgggaagccttagagtctactgaacattgctcgtatcaccatacag
cactcaggcaagctattttgtgctggggggaattaatgactctagcttcctgggtgggtaataatttagacgatccagct
tccagagacctagtagtcaattatgttaacactaacatgggactaaagatcaggcaattattgtggtatcacctttcctg
tcttacctttgggagagacactgttcacgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JN792901_C_P-B Feature FT:CDS JN792901_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AD2009). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactacggagttactctctttcttgccttctgacttctatccgtcggt
tcgagatctcctagacaccgccgctgctttgtatcgagatgccttagagtctcctgaacattgctcgcctcaccatacag
cactcaggcaagctgctttgtgctggggggaattaatgactctagctacctgggtgggtaataatttaaacgatccagca
tccagagacctagtagtaaattatgttaacactaatatgggactaaagatcaggcaattattgtggtttcacatttcctg
tcttacctttgggagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaggaagaact
ccctcgcctcgcagacgacgatctaaatctccgcgtcgcagaagatctcactctcgggaatcccaatgttag
>gnl|hbvcds|JN792902_C_P-B Feature FT:CDS JN792902_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AD2004). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactacggagttactctcttttttgccttctgacttctttccgtcggt
tcgagatctcctagacaccgccgctgctttgtatcgagatgccttagagtctcctgaacattgctcgcctcaccatacag
cactcaggcaagctgctttgtgctggggggaattaatgactctagctacctgggtgggtaataatttagacgatccagca
tccagagacctagtagtaaattatgttaacactaatatgggactaaagatcaggcaattattgtggtttcacatttcctg
tcttacctttgggagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctggaagaagaact
ccctcgcctcgcagacgacgatctaaatctccgcgtcgcagaagatctcactctcgggaatcccaatgttag
>gnl|hbvcds|JN827419_C_P-B Feature FT:CDS JN827419_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2539). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagcaattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ027311_C_P-B Feature FT:CDS JQ027311_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgygmmrttactctcttttttgcctgctgacttctttccttctgt
tcacgaccttctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
camtcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggamgacccasma
tccagagaattagtagtcggctatgttaatgttaatatgggcctaaaaytcagacaactattgtggtttcacatctcctg
tcttayktttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacmaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagkcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcycaatgttag
>gnl|hbvcds|JQ027312_C_P-B Feature FT:CDS JQ027312_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgayccgtataaagaatttggagcttctgtggagttamtctcttttttgcctactgacttctttcctartgt
tcgagatcttctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgtacacctcaccacacgg
cactcaggcaagttattttgtgttggggtgagttaatgaatttagccacctgggtgggaagcaatttggacgatcmaaca
tccagggaagcagtagtcaactatgtcaacgttaatatgggcctaaaaaccagacaactrttatggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttrgtgtcttttggagtgtggattcgcactcctccygsatatagac
cacmaaatgcccctatcttatcaacacttccggaaactgctgttgttagacraagakgcaggtccyctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaayctcaatgttag
>gnl|hbvcds|JQ027313_C_P-B Feature FT:CDS JQ027313_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggmgcttcakyggagttactctcttttttgcctsmtgayttctttccttcgay
tcgagatctcmtcgacaccgcctctgctctgtaycgggaggccttagagtctcckgaacattgttcacatcaccatacgg
crctcaggcaagctattctgtgttgggtkgagttaatgaatctagccacctgggtgggaggtaatttggaagatccagca
tccagggaattagtagtcaaccatgtcaacrttaatatgggcmtaaaaatcagacaactaytgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgamtwtttggtgtcttttggagtgtggattcgcactcctcckgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ027315_C_P-B Feature FT:CDS JQ027315_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacctgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctactcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacgg
ctctcaggcaagctattgtgtgttggggtgagttgatgaatttagccacctgggtgggaggtaatttggaagatcaagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cascaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JQ027316_C_P-B Feature FT:CDS JQ027316_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcctctgcggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttggaagagaagttgttcttgaatatttggtctctttcggagtgtggattcgcactcctactgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ027325_C_P-B Feature FT:CDS JQ027325_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgyggagttactctcttttttgccttctgacttttttccttccat
tcgagatctcctcgacaccgccactgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaggtaatttggaagatcaagca
tccagggacttagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggaargaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JQ027329_C_P-B Feature FT:CDS JQ027329_C_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacggtaatatgggcctraaaatcagacaactattgtggtttcacatttcctg
tcttacttttggragagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caycaaatgcccctatcttatcaacacttccggaaactrctgttgttagacgaagaagcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcttgatgttag
>gnl|hbvcds|JQ027330_C_P-B Feature FT:CDS JQ027330_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccastataaagaatttggagcttctgtggagttactctcatttttgccgtctgacttctttccttctrt
tcgagatctcctcgayaccgcctctgctctgtatcgggaggctttagagtctccggaacatgtttcacctcaccatacrg
cmctcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccggca
tccagggaattagtagtcrgctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctg
tattacttttggragagaaaytgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
ctcaaaatgcccctatcttatcaacacttccggaaactactgttgttagaccaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JQ027331_C_P-B Feature FT:CDS JQ027331_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccastataaagaatttggagcttctgtggagttactctcatttttgccgtctgacttctttccttctrt
tcgagatctcctcgayaccgcctctgctctgtatcgggaggctttagagtctccggaacatgtttcacctcaccatacrg
cmctcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccggca
tccagggaattagtagtcrgctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctg
tattacttttggragagaaaytgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
ctcaaaatgcccctatcttatcaacacttccggaaactactgttgttagaccaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JQ027334_C_P-B Feature FT:CDS JQ027334_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagaccttctcgacaccgcctcagctctgtaccgggaagccttagagtctccggaacattgtacacctcaccatacag
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatctggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcagccatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|JQ040125_C_P-B Feature FT:CDS JQ040125_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgttaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcatcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ040128_C_P-B Feature FT:CDS JQ040128_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 69). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataragaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgcgctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggratctcaatgttag
>gnl|hbvcds|JQ040138_C_P-B Feature FT:CDS JQ040138_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 240). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacctgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgctwctgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatctagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggragagaaactgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ040147_C_P-B Feature FT:CDS JQ040147_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 280). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ040157_C_P-B Feature FT:CDS JQ040157_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G187). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgayttctttccttctat
tcgagatctcctcgacaccgmcwctgctctgtatcgggaggccttagagwctccggaacattgttcacctcaccatacrg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ040169_C_P-B Feature FT:CDS JQ040169_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G237). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacmcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctgctcgacaccgcctctgcgttgcatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ040170_C_P-B Feature FT:CDS JQ040170_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G238). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ040171_C_P-B Feature FT:CDS JQ040171_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G239). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctckcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ040173_C_P-B Feature FT:CDS JQ040173_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G244). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ341459_C_P-B Feature FT:CDS JQ341459_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno01). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctccttgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccccgcatatagac
caccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341460_C_P-B Feature FT:CDS JQ341460_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno02). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctatcgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341461_C_P-B Feature FT:CDS JQ341461_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno03). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctatcctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341462_C_P-B Feature FT:CDS JQ341462_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno04). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttgragcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatacgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341463_C_P-B Feature FT:CDS JQ341463_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno05). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctrt
tcragatctcctcgacaccgcctctgcgctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttgggktgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgkggattcgcactcctcctgcatatagac
cacaaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagakgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341464_C_P-B Feature FT:CDS JQ341464_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno06). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagaccttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagcaacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaanngcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaakctcgggaatctcaatgt
>gnl|hbvcds|JQ341465_C_P-B Feature FT:CDS JQ341465_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno07). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341466_C_P-B Feature FT:CDS JQ341466_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno08). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctatgtatcgggaggccttagagtctccggaacattgttcakctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgtgaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaanngcccctatcttatcaacacttccggaaactrctgttgttagacaaagacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgt
>gnl|hbvcds|JQ341467_C_P-B Feature FT:CDS JQ341467_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno10). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcaat
tcgagatctcctcgacaccgcatctgctctgyatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattstgtgttggggtgagktaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcwgaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341468_C_P-B Feature FT:CDS JQ341468_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno11). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgaccygtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccktctrt
tcgagatctmctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattstgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccatca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaamtcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cagcaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341469_C_P-B Feature FT:CDS JQ341469_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno12). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctattgagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggacgatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagac
caccaanngcccctatcttatcaacacttccggagactactgttgttagaggaagaagcagggcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341470_C_P-B Feature FT:CDS JQ341470_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno15). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctrttctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341471_C_P-B Feature FT:CDS JQ341471_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno16). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagayctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggtctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgtacttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cgccaanngcccctatcttatcaacrcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgt
>gnl|hbvcds|JQ341472_C_P-B Feature FT:CDS JQ341472_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno17). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caycaanngcccctatcttatcaacacttccggaaactrctgttgttagacgamgnkgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggratctcaatgt
>gnl|hbvcds|JQ341473_C_P-B Feature FT:CDS JQ341473_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno18). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacmcgtataaagaattyggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattstgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagttagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341474_C_P-B Feature FT:CDS JQ341474_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno19). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctgctcgacactgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacgg
ctctcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggragagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaanngcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggycccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgt
>gnl|hbvcds|JQ341475_C_P-B Feature FT:CDS JQ341475_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno20). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacmcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcgat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctcaggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattartagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctaaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341476_C_P-B Feature FT:CDS JQ341476_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno21). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
caatcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaattcagacaactattgtggtttcacgtttcctg
tcttacttttgggagacaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatacagac
caccaanngcccctatcttatcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341477_C_P-B Feature FT:CDS JQ341477_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno22). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgaattaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttagtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341479_C_P-B Feature FT:CDS JQ341479_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno24). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggacgatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
ccttacttttgggagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcagtctcgggaacctcaatgt
>gnl|hbvcds|JQ341480_C_P-B Feature FT:CDS JQ341480_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno25). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccsgaacattgttcacctcaccatacgg
cactcaggcaagctattctatgttggggtgagttaatgaatctagccacctgggtgggaggtaatttggaagatccagca
tccagggaagcagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgt
>gnl|hbvcds|JQ341481_C_P-B Feature FT:CDS JQ341481_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno26). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaattcggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgctcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgttaacgttaatatgggcctaaaaatcagacaactattgtggtttcatatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341482_C_P-B Feature FT:CDS JQ341482_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno27). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttaragtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcc
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341483_C_P-B Feature FT:CDS JQ341483_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno29). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaanngcccctatcttatcaacacttccggaaactactgttgttagacgamgnggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341484_C_P-B Feature FT:CDS JQ341484_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno30). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttagaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgt
>gnl|hbvcds|JQ341485_C_P-B Feature FT:CDS JQ341485_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno31). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgtgcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
ctccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341486_C_P-B Feature FT:CDS JQ341486_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno32). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgactccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaanngcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgt
>gnl|hbvcds|JQ341487_C_P-B Feature FT:CDS JQ341487_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno33). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacmcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcatctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcrgctatgtcaaygttaatatgggcctaaaamtcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttsttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacmaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggactcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341488_C_P-B Feature FT:CDS JQ341488_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno34). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctrt
tcgagatctcctcgacaccgcctctgctctgtatagggaggccttagagtctccggaacattgttcacctcaccatacgg
camtcaggcaagctattctgtgttgggktgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgtyaatatgggcctaaaaatcagacaacttttgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctycatatagac
cacaaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctyaatgt
>gnl|hbvcds|JQ341489_C_P-B Feature FT:CDS JQ341489_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno35). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacactgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgkggattcgcactcctcctgcatatagac
cacmaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341490_C_P-B Feature FT:CDS JQ341490_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno36). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgt
>gnl|hbvcds|JQ341491_C_P-B Feature FT:CDS JQ341491_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno38). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgyggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggragagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaygcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341492_C_P-B Feature FT:CDS JQ341492_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno39). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttaatctcttttttgcctgctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctcctgaacattgtacacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctrgccacctgggtgggaagtaatttggacgatccagsa
tccagggaattagtagtcagctatgtcaacgttaatatgggcataaaaatcagacaaatactgtggtttcacatttcctg
ycttacttttgggagagacgttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctatagac
cacaaanngcccctatcytatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagawctcaatctcgggaacatcaatgt
>gnl|hbvcds|JQ341493_C_P-B Feature FT:CDS JQ341493_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno41). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacgcstataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagaccttctcgacaccgcctctgctctgtaccgggaggccttagagtctccggaacatgtttcacctcaccatacgg
camtcaggcaagctattctgtgttggggtgagttgatgaatctagccwcctgggtgggargtaatttggaagacccagca
tccagggaattagtagtcggttatgtcaaygttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaanngcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtcccytagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcggggatctcaatgt
>gnl|hbvcds|JQ341494_C_P-B Feature FT:CDS JQ341494_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno43). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacmcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgataccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcaccgcaccatacgg
cactcaggcaagctattstgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcgtttggagtgtggattcgcactcctcctgcatatagac
caccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgw
>gnl|hbvcds|JQ341495_C_P-B Feature FT:CDS JQ341495_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno44). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgyggagttactctcttttttgccttctgacttctttcctactat
tcgagatctcctcgacaccgcctctgctctrtatcgggaggccttagagtctccggaacattgtacacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaacytagccacctgggtgggargtaatttggacgatccagca
tccagggaakyagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactgttgtggtttcacatttcctg
tcttayktttgggagacaaacygttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaanngcccctatcttatcaacacttccggaaactactgttrttagacaacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcgggaacatcaatgt
>gnl|hbvcds|JQ341496_C_P-B Feature FT:CDS JQ341496_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno45). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341497_C_P-B Feature FT:CDS JQ341497_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno46). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggacgatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttgggagasaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacmaanngcccctatcttatcaacacttccggaaactactgttgttagasraagaggcaggwcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcartctcgggaatctcaatgt
>gnl|hbvcds|JQ341498_C_P-B Feature FT:CDS JQ341498_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno47). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctwmtst
tcgagatctcctcgacactgcctctgctctgtatcgggaggccttagagtctccggaacattgttcasctcaccatacrg
caatcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaattcagacaactattgtggtttcacatttcctg
tcttacttttgggagagawaytgttcttgamtatttrgtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacmaanngcccctatcttatcaacacttccggaaactrctgttgttagaccaagaggcaggtccwctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341499_C_P-B Feature FT:CDS JQ341499_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno48). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctrcggagttactctcttttttgccttctgacttctatccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacatkgtacacctcaccatacgg
cactcaggcaagctattctgtgttggggtgaattgatgaatctagccacctgggtgggaagtaatttggaagacccarga
tccagggaakyagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagacattgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaanngcccctatcttatcaacacttccggaaactactgttattagacaacgaggcaggacccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341500_C_P-B Feature FT:CDS JQ341500_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno49). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccstataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgyatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctatwstgtgttgggktgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgkggattcgcactcctcctgcatatagac
cacmaanngcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341501_C_P-B Feature FT:CDS JQ341501_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno50). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcttttttgcctactgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctgaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341502_C_P-B Feature FT:CDS JQ341502_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno51). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttgggrtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatyagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgcatatagac
cacmaanngcccctatcttatcaacacttccggaaactactgttgttagacgacgakgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgt
>gnl|hbvcds|JQ341503_C_P-B Feature FT:CDS JQ341503_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno52). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggaggttctgtggagttactctcttttttgccttctgacttctttcctactat
tcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
caatcaggcaagctattctgtgttggggcgagttaatgaatctagccacctgggtgggaggtaatttggacgatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgactatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaanngcccctatcttatcaatgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgt
>gnl|hbvcds|JQ341504_C_P-B Feature FT:CDS JQ341504_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno53). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctgctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttgggktgagttgatgaatctagccacctgggtgggargtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgkggattcgcactcctcctgcatatagac
cacmaanngcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341505_C_P-B Feature FT:CDS JQ341505_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno54). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctrt
tcgagatctcctcgacaccgcctctgctctgtatcgagaggccttagagtctcckgaacatkktwcacctcacyatacgg
crctcaggcaagctattgtgtgttggggtgagttgatgaatytagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcmtaaaaatcagacaactattgtggtttcacmyttcctg
tmttayktttggaagagawattgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cagcaanngcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggamyctcaatgt
>gnl|hbvcds|JQ341508_C_P-B Feature FT:CDS JQ341508_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno58). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgttgagttactctctttyttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctgttctgtgttggggtgagttgatgaatctagccacctgggtgggaggwaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctraaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgcatatagac
caccaanngcccctatcytatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggamyctcaatgt
>gnl|hbvcds|JQ341509_C_P-B Feature FT:CDS JQ341509_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno60). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacmcstataamgawtttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccactgctctgtatcgrgaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaayttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaanngcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcagtctcgggaacctcaatgt
>gnl|hbvcds|JQ341510_C_P-B Feature FT:CDS JQ341510_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno61). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgcatatagac
caccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341515_C_P-B Feature FT:CDS JQ341515_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cgeno12). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcwat
tcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactaaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaasacccagca
tccagggaattartagtaagctatgtcaatgttaatatgggcctaaaamtcagacaamtattgtggtttcacatttcctg
tcttacttttggaaragawactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctmccgcttacagac
caccaanngcccctatcttatcaacacttccggaaactactgttgttagaygacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341530_C_P-B Feature FT:CDS JQ341530_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cgeno39). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatcttgccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaanngcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ429079_C_P-B Feature FT:CDS JQ429079_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 08.10.002). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcccgggaattagtagtcagcyatgtcaatgttaatatgggcctaaaawtcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgcatatagac
caccaaatgcccctatcytatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ429080_C_P-B Feature FT:CDS JQ429080_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 09.40.033). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctkctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacttgggtgggaagtaatttggaagatccagct
tcccgagaattagtagttggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcyyaatgttag
>gnl|hbvcds|JQ429081_C_P-B Feature FT:CDS JQ429081_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 09.80.055). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctggagagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgctcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcc
tcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ429082_C_P-B Feature FT:CDS JQ429082_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 09.41.591). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tcccgggaattggtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ688405_C_P-B Feature FT:CDS JQ688405_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBVB2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707734_C_P-B Feature FT:CDS JQ707734_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707735_C_P-B Feature FT:CDS JQ707735_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707736_C_P-B Feature FT:CDS JQ707736_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_11). Partial genome (Contains: HBx). [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|JQ707737_C_P-B Feature FT:CDS JQ707737_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707738_C_P-B Feature FT:CDS JQ707738_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_14). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707739_C_P-B Feature FT:CDS JQ707739_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_17). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707740_C_P-B Feature FT:CDS JQ707740_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_18). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707741_C_P-B Feature FT:CDS JQ707741_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_19). Partial genome (Contains: HBx). [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacagcgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|JQ707742_C_P-B Feature FT:CDS JQ707742_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707743_C_P-B Feature FT:CDS JQ707743_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_20-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707744_C_P-B Feature FT:CDS JQ707744_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_22). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707745_C_P-B Feature FT:CDS JQ707745_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_23). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707746_C_P-B Feature FT:CDS JQ707746_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_24-6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707747_C_P-B Feature FT:CDS JQ707747_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_25). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707748_C_P-B Feature FT:CDS JQ707748_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_26). Partial genome (Contains: HBx). [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|JQ707749_C_P-B Feature FT:CDS JQ707749_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_27). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707750_C_P-B Feature FT:CDS JQ707750_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_28). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaattcggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707751_C_P-B Feature FT:CDS JQ707751_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_30). Partial genome (Contains: HBx). [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|JQ707752_C_P-B Feature FT:CDS JQ707752_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_31). Partial genome (Contains: HBx). [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|JQ707753_C_P-B Feature FT:CDS JQ707753_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_32). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707754_C_P-B Feature FT:CDS JQ707754_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_33). Partial genome (Contains: HBx). [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaacaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|JQ707755_C_P-B Feature FT:CDS JQ707755_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_38). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707756_C_P-B Feature FT:CDS JQ707756_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_39). Partial genome (Contains: HBx). [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|JQ707757_C_P-B Feature FT:CDS JQ707757_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_40). Partial genome (Contains: HBx). [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|JQ707758_C_P-B Feature FT:CDS JQ707758_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_41). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707759_C_P-B Feature FT:CDS JQ707759_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_43). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707760_C_P-B Feature FT:CDS JQ707760_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_44). Partial genome (Contains: HBx). [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagttgtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|JQ707761_C_P-B Feature FT:CDS JQ707761_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_45). Partial genome (Contains: HBx). [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|JQ707762_C_P-B Feature FT:CDS JQ707762_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_46). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacacagccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707763_C_P-B Feature FT:CDS JQ707763_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_47). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707764_C_P-B Feature FT:CDS JQ707764_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_48). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707765_C_P-B Feature FT:CDS JQ707765_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707766_C_P-B Feature FT:CDS JQ707766_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707767_C_P-B Feature FT:CDS JQ707767_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ801471_C_P-B Feature FT:CDS JQ801471_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AIDS7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgttaacgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ801474_C_P-B Feature FT:CDS JQ801474_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AIDS16). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcttctattgagttactctcttttttgccttctgacttttttccttctgt
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
caatcaggcaagctattctatgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatcaagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaattcagacaactattgtggtttcacatttcctg
tattacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctgctccatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaaggggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ801479_C_P-B Feature FT:CDS JQ801479_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AIDS22). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcgtttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ801494_C_P-B Feature FT:CDS JQ801494_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CONTROL1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagcttctgctgagttactctcttttttgccttctgacttttttccttctat
tcgagatctccttgacaccatctccgctctgcatcgggaggccttagagtctcctgaacattgtacacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttgcaagatccaaca
tccagggaagcagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacctttcctg
tattacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JQ801506_C_P-B Feature FT:CDS JQ801506_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CONTROL13). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagca
tccagggacttagtagtcagctatgtcaacgttaatatgggcctaaaattcagacaaatattgtggtttcacatttcctg
tcttacttttgggagagaagttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcctatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JQ801507_C_P-B Feature FT:CDS JQ801507_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CONTROL15). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ801512_C_P-B Feature FT:CDS JQ801512_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CONTROL20). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ801514_C_P-B Feature FT:CDS JQ801514_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CONTROL22). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ801516_C_P-B Feature FT:CDS JQ801516_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CONTROL24). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctacggagttactctcttttttgccttctgacttctttccttctat
tcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctatgttggggtgagttaatgaatctagccacctgggtgggaggtaatttggaagatccagca
tccagggaagcagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JQ801524_C_P-B Feature FT:CDS JQ801524_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CONTROL32). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaaatattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX026879_C_P-B Feature FT:CDS JX026879_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-NJ-17). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttttttttgccttctgacttctttcc
ttctattcgagacctcctcgacaccgcttctgctctgtatcaggaggccttagagtctccggaacattgttcacctcacc
atacggcactcaggcaagctattctgtgttggggtgagttgatgaatcttgccacctgggtgggaagtaatttggaagat
ccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactatcgtggtttcacat
ttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcat
atagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaaga
agaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX026881_C_P-B Feature FT:CDS JX026881_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-NJ-24). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacgg
cactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggagactactgttgttagacgaaggggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|JX026883_C_P-B Feature FT:CDS JX026883_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-NJ-50). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctactctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgttag
>gnl|hbvcds|JX026886_C_P-B Feature FT:CDS JX026886_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-NJ-73). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacctataaagaatttggagcttctgtggagttaatctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggacgatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JX429897_C_P-B Feature FT:CDS JX429897_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcccctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattttgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX429899_C_P-B Feature FT:CDS JX429899_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-20). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagta
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX429900_C_P-B Feature FT:CDS JX429900_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-24). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtaagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|JX429901_C_P-B Feature FT:CDS JX429901_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-33). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcatctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggacgatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactccttctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JX429902_C_P-B Feature FT:CDS JX429902_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-34). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX429908_C_P-B Feature FT:CDS JX429908_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-58). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatttcaatgttag
>gnl|hbvcds|JX429910_C_P-B Feature FT:CDS JX429910_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-67). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcttctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtggggagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaagatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggattctcaatgttag
>gnl|hbvcds|JX429911_C_P-B Feature FT:CDS JX429911_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-NJ-45). Non-functional genomic sequence. [Hepadnaviridae] (length=555 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctctttttttttgccttctgacttctttccttc
tattcgagacctcctcgacaccgcttctgctctgtatcaggaggccttagagtctccggaacattgttcacctcaccata
cggcactcaggcaagctattctgtgttggggtgagttgatgaatcttgccacctgggtgggaagtaatttggaagatcca
gcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactatcgtggtttcacatttc
ctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatata
gaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaaga
actccctcgcctcgcagacgaaggtctcaattgccgcgtcgcagaagatctcaatctcgggaatctcaatgtcag
>gnl|hbvcds|JX504531_C_P-B Feature FT:CDS JX504531_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-1). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagccattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagagaattggtagtcagctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcatatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX504532_C_P-B Feature FT:CDS JX504532_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctttggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
caatcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcggctatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX504533_C_P-B Feature FT:CDS JX504533_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-16). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctgttttgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagca
tccagagatttagtagtaagctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctg
tctgacttttgggagacaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX504538_C_P-B Feature FT:CDS JX504538_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-HZ-65). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacactgacccgtataaagaatttggagcttctgtggagttactctcttttttaccttctgacttctttccttccat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaattcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX504543_C_P-B Feature FT:CDS JX504543_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WY-NNJ-19). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctaatat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tcccgggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatttttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcgacacttccggaaactactgttattagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JX507210_C_P-B Feature FT:CDS JX507210_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 16). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctctttattgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggatccgcactcctcctgcatatagac
ctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX507213_C_P-B Feature FT:CDS JX507213_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 82). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgyatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
ctcacaggcaagctattgtgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX507215_C_P-B Feature FT:CDS JX507215_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 310). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX661470_C_P-B Feature FT:CDS JX661470_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1221-B12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaactagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactccacctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX661471_C_P-B Feature FT:CDS JX661471_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1202-B1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcctctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX661472_C_P-B Feature FT:CDS JX661472_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1224-B13). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX661473_C_P-B Feature FT:CDS JX661473_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1220-B11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacgtttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX661474_C_P-B Feature FT:CDS JX661474_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1229-B15). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX661475_C_P-B Feature FT:CDS JX661475_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1216-B9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX661476_C_P-B Feature FT:CDS JX661476_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1227-B14). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX661477_C_P-B Feature FT:CDS JX661477_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1209-B5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctatcctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX661478_C_P-B Feature FT:CDS JX661478_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1211-B7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctatcctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX661479_C_P-B Feature FT:CDS JX661479_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1219-B10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
cgccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX661480_C_P-B Feature FT:CDS JX661480_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1210-B6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccggca
tccagggaattagtggtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX661481_C_P-B Feature FT:CDS JX661481_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1214-B8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX661482_C_P-B Feature FT:CDS JX661482_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1204-B2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctat
tcgagatctactcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagca
tccagggaattagtagtcagctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcttg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX661483_C_P-B Feature FT:CDS JX661483_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1205-B3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX661484_C_P-B Feature FT:CDS JX661484_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SH1206-B4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttaccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX869998_C_P-B Feature FT:CDS JX869998_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 317). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagtttatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgtaaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacccctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX869999_C_P-B Feature FT:CDS JX869999_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 14). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaacc
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX870001_C_P-B Feature FT:CDS JX870001_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 90). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctatgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatcaagga
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactrctgttgttagacgaagaggcaggtcccctagaagaagaacc
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX978431_C_P-B Feature FT:CDS JX978431_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate X02). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattttgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtaagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC492739_C_P-B Feature FT:CDS KC492739_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MT). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacgg
cactcaggcaagctattctatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccatacagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaaggggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|KC492740_C_P-B Feature FT:CDS KC492740_C_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Del). Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagcttctgtggacttactctcttttttgccttctgacttctttccttctgt
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacatatttcacctcaccatacgg
cactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccatacagac
cacaaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctggaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|KC510641_C_P-B Feature FT:CDS KC510641_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagacctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC510642_C_P-B Feature FT:CDS KC510642_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatataggc
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC510643_C_P-B Feature FT:CDS KC510643_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC510644_C_P-B Feature FT:CDS KC510644_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattttgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC510646_C_P-B Feature FT:CDS KC510646_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagccattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC510647_C_P-B Feature FT:CDS KC510647_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC510648_C_P-B Feature FT:CDS KC510648_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattttgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC510649_C_P-B Feature FT:CDS KC510649_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagacctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC510650_C_P-B Feature FT:CDS KC510650_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC510651_C_P-B Feature FT:CDS KC510651_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC510652_C_P-B Feature FT:CDS KC510652_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagacctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC510653_C_P-B Feature FT:CDS KC510653_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagccattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC510654_C_P-B Feature FT:CDS KC510654_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC510655_C_P-B Feature FT:CDS KC510655_C_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatataggc
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC510656_C_P-B Featur