HBVdb

Dataset for nucleotide sequence X of genotype A

[Download (right click)] [Alignment] [Repertoires]

986 sequence(s)

>gnl|hbvcds|AB014370_X_P-A Feature FT:CDS AB014370_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 11D11HCC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB064314_X_P-A Feature FT:CDS AB064314_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaaatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcactatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB076678_X_P-A Feature FT:CDS AB076678_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB076679_X_P-A Feature FT:CDS AB076679_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala35). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB116076_X_P-A Feature FT:CDS AB116076_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-USA1911). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgcccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaagatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB116077_X_P-A Feature FT:CDS AB116077_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-USA2126). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB116078_X_P-A Feature FT:CDS AB116078_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-USA712). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaagatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB116079_X_P-A Feature FT:CDS AB116079_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TR1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB116080_X_P-A Feature FT:CDS AB116080_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TR2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB116081_X_P-A Feature FT:CDS AB116081_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TR3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggacttccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccaacaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB116082_X_P-A Feature FT:CDS AB116082_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggatgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccaccaggtcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB116083_X_P-A Feature FT:CDS AB116083_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN36). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcgcgaggccgcttgggactgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccaccaaatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagaccgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB116084_X_P-A Feature FT:CDS AB116084_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN81). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacacccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB116085_X_P-A Feature FT:CDS AB116085_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN83). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcntcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB116086_X_P-A Feature FT:CDS AB116086_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-IND18). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggtcgcttgggactctatcgtcccctgctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatattcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB116087_X_P-A Feature FT:CDS AB116087_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-IND8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggatgtttcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaa
>gnl|hbvcds|AB116088_X_P-A Feature FT:CDS AB116088_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-NEP30). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgcggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccctcaggtcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcagcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB116089_X_P-A Feature FT:CDS AB116089_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-NEP39). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgcggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccaccaggtcctgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcagcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB116090_X_P-A Feature FT:CDS AB116090_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-NEP40). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB116091_X_P-A Feature FT:CDS AB116091_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcngcgctgaatcccgcgg
acgacccttcgcggggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB116092_X_P-A Feature FT:CDS AB116092_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccttcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB116093_X_P-A Feature FT:CDS AB116093_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgcggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaaagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB116094_X_P-A Feature FT:CDS AB116094_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB126580_X_P-A Feature FT:CDS AB126580_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-RU204). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB194950_X_P-A Feature FT:CDS AB194950_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMR983). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccaccagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggctcaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcttgcaactttttcacctctgcctaa
>gnl|hbvcds|AB194951_X_P-A Feature FT:CDS AB194951_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMR82). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctctcggggccggttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB194952_X_P-A Feature FT:CDS AB194952_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMR711). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctctcggggccggttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaagatttttgtat
taggaggctgtaggcataaattggtctgcgcaccattctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB205118_X_P-A Feature FT:CDS AB205118_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TJ1-1-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggcctatctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggaactgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB222707_X_P-A Feature FT:CDS AB222707_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate UZTBV102). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB241114_X_P-A Feature FT:CDS AB241114_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PhHCC01). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB241115_X_P-A Feature FT:CDS AB241115_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PhCH09). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccatcagcgctgaatcccgcgg
acgacccctcgcgcggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB246317_X_P-A Feature FT:CDS AB246317_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate TA112). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcgtggag
accaccatgaacgcccatcagatactgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaagatttttgtat
taggaggctgtaggcataaattggtctgcgcaccattatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB246335_X_P-A Feature FT:CDS AB246335_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB246336_X_P-A Feature FT:CDS AB246336_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcgcgaggtcgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB246337_X_P-A Feature FT:CDS AB246337_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactttctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB246338_X_P-A Feature FT:CDS AB246338_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggcctatctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB300366_X_P-A Feature FT:CDS AB300366_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgattcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggacttccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB300367_X_P-A Feature FT:CDS AB300367_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB362931_X_P-A Feature FT:CDS AB362931_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgtttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB453979_X_P-A Feature FT:CDS AB453979_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB453980_X_P-A Feature FT:CDS AB453980_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB453981_X_P-A Feature FT:CDS AB453981_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggcctatctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB453982_X_P-A Feature FT:CDS AB453982_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB453983_X_P-A Feature FT:CDS AB453983_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgtttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB453984_X_P-A Feature FT:CDS AB453984_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgattcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaagatttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB453986_X_P-A Feature FT:CDS AB453986_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactagattaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB453987_X_P-A Feature FT:CDS AB453987_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagcggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaagatttatgtat
taggaggctgtaggcataaattggtctgcgcaccaccatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB453988_X_P-A Feature FT:CDS AB453988_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcgcggggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB453989_X_P-A Feature FT:CDS AB453989_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgttccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB480036_X_P-A Feature FT:CDS AB480036_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggcctatctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB480038_X_P-A Feature FT:CDS AB480038_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB480039_X_P-A Feature FT:CDS AB480039_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgattcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggacttccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB480040_X_P-A Feature FT:CDS AB480040_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttrcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB480041_X_P-A Feature FT:CDS AB480041_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB549213_X_P-A Feature FT:CDS AB549213_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB697487_X_P-A Feature FT:CDS AB697487_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacaaccga
ccttgaggcatacttcaaagactgtktgtttaargactgggaggagytgggggaggagattaggttaaaggtctttgtay
taggaggctgtaggcataaattggtctgykcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB697488_X_P-A Feature FT:CDS AB697488_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttrcataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB697489_X_P-A Feature FT:CDS AB697489_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB697491_X_P-A Feature FT:CDS AB697491_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB697492_X_P-A Feature FT:CDS AB697492_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggacttccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB697493_X_P-A Feature FT:CDS AB697493_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB697495_X_P-A Feature FT:CDS AB697495_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB697496_X_P-A Feature FT:CDS AB697496_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB697497_X_P-A Feature FT:CDS AB697497_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB697498_X_P-A Feature FT:CDS AB697498_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No15). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgykcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB697499_X_P-A Feature FT:CDS AB697499_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB697501_X_P-A Feature FT:CDS AB697501_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No19). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB697503_X_P-A Feature FT:CDS AB697503_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No22). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB697504_X_P-A Feature FT:CDS AB697504_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No23). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB697505_X_P-A Feature FT:CDS AB697505_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
trggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB697506_X_P-A Feature FT:CDS AB697506_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggcctatctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB697507_X_P-A Feature FT:CDS AB697507_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No29). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggcctatctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB697508_X_P-A Feature FT:CDS AB697508_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No31). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB697509_X_P-A Feature FT:CDS AB697509_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No32). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB697511_X_P-A Feature FT:CDS AB697511_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No36). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB697512_X_P-A Feature FT:CDS AB697512_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No37). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB775198_X_P-A Feature FT:CDS AB775198_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB10-0707). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB775199_X_P-A Feature FT:CDS AB775199_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB10-0708). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB775200_X_P-A Feature FT:CDS AB775200_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB12-0925). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB775201_X_P-A Feature FT:CDS AB775201_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB12-0929). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB937791_X_P-A Feature FT:CDS AB937791_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB05-0890). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcgcgaggtcgcttgggactgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB937792_X_P-A Feature FT:CDS AB937792_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1205). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB937793_X_P-A Feature FT:CDS AB937793_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-0302). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB937794_X_P-A Feature FT:CDS AB937794_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-0666). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB937795_X_P-A Feature FT:CDS AB937795_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1191). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagattctgcccaaggtcttacataagtggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB937796_X_P-A Feature FT:CDS AB937796_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1196). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcgcgaggtcgcttgggactgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB937797_X_P-A Feature FT:CDS AB937797_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1204). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccatcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcacgtcagaccctgcccaaggtcttacataagagaactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AB937798_X_P-A Feature FT:CDS AB937798_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB14-0383). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF043560_X_P-A Feature FT:CDS AF043560_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF043580_X_P-A Feature FT:CDS AF043580_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacncggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF090838_X_P-A Feature FT:CDS AF090838_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggaactgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgctcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF090839_X_P-A Feature FT:CDS AF090839_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF090840_X_P-A Feature FT:CDS AF090840_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF090841_X_P-A Feature FT:CDS AF090841_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF090842_X_P-A Feature FT:CDS AF090842_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgagggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF143298_X_P-A Feature FT:CDS AF143298_X_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBx, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=468 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtcttgtttg
tattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF143302_X_P-A Feature FT:CDS AF143302_X_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF297621_X_P-A Feature FT:CDS AF297621_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 78). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF297622_X_P-A Feature FT:CDS AF297622_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 79). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccaccaaatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF297623_X_P-A Feature FT:CDS AF297623_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 83). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctctcggggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaaagatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF297624_X_P-A Feature FT:CDS AF297624_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 80). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggtcgcttgggactctgtcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF297625_X_P-A Feature FT:CDS AF297625_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 84). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtcttcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF536524_X_P-A Feature FT:CDS AF536524_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF537371_X_P-A Feature FT:CDS AF537371_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AF537372_X_P-A Feature FT:CDS AF537372_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagactaggttaatgatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AJ012207_X_P-A Feature FT:CDS AJ012207_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AJ309369_X_P-A Feature FT:CDS AJ309369_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient X104). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagagtaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgccaaa
>gnl|hbvcds|AJ309370_X_P-A Feature FT:CDS AJ309370_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient X104). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagagtaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AJ309371_X_P-A Feature FT:CDS AJ309371_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient X104). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atgactgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagagtaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AJ344115_X_P-A Feature FT:CDS AJ344115_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBsAg negative patient X27). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgttctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatttttgtgt
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AJ627226_X_P-A Feature FT:CDS AJ627226_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 20952). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgtccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttatataagaggactattggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AJ627227_X_P-A Feature FT:CDS AJ627227_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 21077). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcgrcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctctcgtccccttctccgtctgccgttccagccgtccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagactaggttgaagstctttgtat
tgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctar
>gnl|hbvcds|AJ627228_X_P-A Feature FT:CDS AJ627228_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 34408). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctag
>gnl|hbvcds|AM180624_X_P-A Feature FT:CDS AM180624_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CAE168). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggrmtctaccgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtgtttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaa
>gnl|hbvcds|AM184125_X_P-A Feature FT:CDS AM184125_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate O64). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacatcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AM184126_X_P-A Feature FT:CDS AM184126_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N35). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcacgcgg
acgacccctctcggggtcgcttgggactctatcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AM282986_X_P-A Feature FT:CDS AM282986_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AM295795_X_P-A Feature FT:CDS AM295795_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AM295796_X_P-A Feature FT:CDS AM295796_X_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AM295797_X_P-A Feature FT:CDS AM295797_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AM295798_X_P-A Feature FT:CDS AM295798_X_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AM295799_X_P-A Feature FT:CDS AM295799_X_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AM410963_X_P-A Feature FT:CDS AM410963_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AM494718_X_P-A Feature FT:CDS AM494718_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CAR204). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY034878_X_P-A Feature FT:CDS AY034878_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBVKL). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcag
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctttgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY128092_X_P-A Feature FT:CDS AY128092_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY152726_X_P-A Feature FT:CDS AY152726_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 8.22). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagtaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY161138_X_P-A Feature FT:CDS AY161138_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttgggactgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY161139_X_P-A Feature FT:CDS AY161139_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgcggccgcttgggactgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactccccgcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY161142_X_P-A Feature FT:CDS AY161142_X_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgcggtcgcttggggctgtatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgcattctcatctgccggtccgtgtgcacttcgcgtcacctctgcacgttgcatggag
accaccgtgaactcccatcaggtcttgcccaaggtcttatataagtggactcttggactctccgcgatgtcaacgaccga
ccttaaggcctacttaaaagactgtgtgtttaaagaccgggaggagttgggggaggagattaggttaaaggtctttgtgt
taggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY161143_X_P-A Feature FT:CDS AY161143_X_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgcggtcgcttggggctgtatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgcattctcatctgccggtccgtgtgcacttcgcgtcacctctgcacgttgcatggag
accaccgtgaactcccatcaggtcttgcccaaggtcttatataagtggactcttggactctccgcgatgtcaacgaccga
ccttaaggcctacttaaaagactgtgtgtttaaagaccgggaggagttgggggaggagattaggttaaaggtctttgtgt
taggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY161144_X_P-A Feature FT:CDS AY161144_X_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgcggtcgcttggggctgtatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgcattctcatctgccggtccgtgtgcacttcgcgtcacctctgcacgttgcatggag
accaccgtgaactcccatcaggtcttgcccaaggtcttatataagtggactcttggactctccgcgatgtcaacgaccga
ccttaaggcctacttaaaagactgtgtgtttaaagaccgggaggagttgggggaggagattaggttaaaggtctttgtgt
taggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY233274_X_P-A Feature FT:CDS AY233274_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 0962). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY233275_X_P-A Feature FT:CDS AY233275_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 163). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcagcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY233276_X_P-A Feature FT:CDS AY233276_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1839). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccagcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY233278_X_P-A Feature FT:CDS AY233278_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgagggacgtccttcgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggtcgcttgggactctatcgtcccctactccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttcacatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY233279_X_P-A Feature FT:CDS AY233279_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgttccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcctaaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY233280_X_P-A Feature FT:CDS AY233280_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggcctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY233281_X_P-A Feature FT:CDS AY233281_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 303). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcccgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaggatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcagcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY233282_X_P-A Feature FT:CDS AY233282_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 306). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacggccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY233283_X_P-A Feature FT:CDS AY233283_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4038). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY233284_X_P-A Feature FT:CDS AY233284_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 5283). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttggggctctctcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY233285_X_P-A Feature FT:CDS AY233285_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 795). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY233286_X_P-A Feature FT:CDS AY233286_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 818). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgccccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtcagtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagcggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY233287_X_P-A Feature FT:CDS AY233287_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 8225). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY233288_X_P-A Feature FT:CDS AY233288_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 823). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accatcgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY233289_X_P-A Feature FT:CDS AY233289_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 833). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY233290_X_P-A Feature FT:CDS AY233290_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 85). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttggggatctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggacttttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccattatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY373428_X_P-A Feature FT:CDS AY373428_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttgggactgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactccccgcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY373429_X_P-A Feature FT:CDS AY373429_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY373432_X_P-A Feature FT:CDS AY373432_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY707087_X_P-A Feature FT:CDS AY707087_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-N10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY738139_X_P-A Feature FT:CDS AY738139_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcgtggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccaygcaactttttcacctctgcctaa
>gnl|hbvcds|AY738140_X_P-A Feature FT:CDS AY738140_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccatcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcgtggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccaygcaactttttcacctctgcctaa
>gnl|hbvcds|AY738141_X_P-A Feature FT:CDS AY738141_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcgtggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccaygcaactttttcacctctgcctaa
>gnl|hbvcds|AY738142_X_P-A Feature FT:CDS AY738142_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcgtggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcctggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccaygcaactttttcacctctgcctaa
>gnl|hbvcds|AY738143_X_P-A Feature FT:CDS AY738143_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcgtggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccaygcaactttttcacctctgcctaa
>gnl|hbvcds|AY862867_X_P-A Feature FT:CDS AY862867_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H4-zhus). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtccgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY862868_X_P-A Feature FT:CDS AY862868_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H4-zhus). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgttgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY902775_X_P-A Feature FT:CDS AY902775_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MTB162). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY903452_X_P-A Feature FT:CDS AY903452_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccaccaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY934763_X_P-A Feature FT:CDS AY934763_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ik3346). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctatcgtccccttctccgtctgccgtaccgaccgacgacggggcgaacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY934764_X_P-A Feature FT:CDS AY934764_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9210699). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagcggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY934765_X_P-A Feature FT:CDS AY934765_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 24306). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctgtgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY934766_X_P-A Feature FT:CDS AY934766_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 24233). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY934767_X_P-A Feature FT:CDS AY934767_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 27178). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggcctctatcgtccccttctccgtctgccgtaccatccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY934768_X_P-A Feature FT:CDS AY934768_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 25830). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY934769_X_P-A Feature FT:CDS AY934769_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 23719). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcag
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaargactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY934770_X_P-A Feature FT:CDS AY934770_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 953642). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctgtgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY934771_X_P-A Feature FT:CDS AY934771_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 27439). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggatgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaaaggtctatgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY934772_X_P-A Feature FT:CDS AY934772_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1908). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttgggtctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtataaagactgggaggtgttgggggaggagattaggttaatgatctgtgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY934773_X_P-A Feature FT:CDS AY934773_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9414346). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggar
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|AY934774_X_P-A Feature FT:CDS AY934774_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9615549). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagcggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ020002_X_P-A Feature FT:CDS DQ020002_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 380). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
gccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctgtgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ020003_X_P-A Feature FT:CDS DQ020003_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 5780). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctatgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ298161_X_P-A Feature FT:CDS DQ298161_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccgcggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggaactgggggaggagaataggttaatgatttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ298162_X_P-A Feature FT:CDS DQ298162_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggcggctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacgtcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggaactgggggaggagaataggttaatgatttatgtat
taagaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ298163_X_P-A Feature FT:CDS DQ298163_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggaactgggggaggagaataggttaatgatttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ298164_X_P-A Feature FT:CDS DQ298164_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggaactgggggaggagaataggttaatgatttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ298165_X_P-A Feature FT:CDS DQ298165_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggaactgggggaggagaataggttaatgatttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ315784_X_P-A Feature FT:CDS DQ315784_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EI03101). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ315785_X_P-A Feature FT:CDS DQ315785_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EI0386). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacatcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgcggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcttcatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ315786_X_P-A Feature FT:CDS DQ315786_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EI057). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggatactacgagggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcgcgaggccgcttgggactgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ788725_X_P-A Feature FT:CDS DQ788725_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate serum 07/92). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|DQ788728_X_P-A Feature FT:CDS DQ788728_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate serum 05/96). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgcgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagactaggttaatgatccttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF103278_X_P-A Feature FT:CDS EF103278_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ran60). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtccttagtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtccgccgtaccgtccgacctcggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcacctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|EF208113_X_P-A Feature FT:CDS EF208113_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient B, serum 05/93). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcccgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagactaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU054331_X_C-A Feature FT:CDS EU054331_X_C-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcacgcgg
acgacccctctcggggccctttggtcatttctcgtccccttctctgtctaacattccgaacgaccacggagcgcacctct
cattccactgcctacccgtctgtgccttctcatctgacggaccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgaccatcagatgctgcgcaagttgttacataaaagagctgttggactcccagcaatatcaacagccga
ccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtat
taagaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU086721_X_P-A Feature FT:CDS EU086721_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HRO/w4601-2002). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU185786_X_P-A Feature FT:CDS EU185786_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU11). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU185787_X_P-A Feature FT:CDS EU185787_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU185788_X_P-A Feature FT:CDS EU185788_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU19). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU185789_X_P-A Feature FT:CDS EU185789_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU366129_X_P-A Feature FT:CDS EU366129_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA92). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaagatttttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaa
>gnl|hbvcds|EU410082_X_P-A Feature FT:CDS EU410082_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ph81). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagcggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggttaaagatttttatgt
aaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU414133_X_P-A Feature FT:CDS EU414133_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacaaaagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccctgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594383_X_P-A Feature FT:CDS EU594383_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594384_X_P-A Feature FT:CDS EU594384_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594385_X_P-A Feature FT:CDS EU594385_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594386_X_P-A Feature FT:CDS EU594386_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594387_X_P-A Feature FT:CDS EU594387_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594388_X_P-A Feature FT:CDS EU594388_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594389_X_P-A Feature FT:CDS EU594389_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaaatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594390_X_P-A Feature FT:CDS EU594390_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594391_X_P-A Feature FT:CDS EU594391_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtgt
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594392_X_P-A Feature FT:CDS EU594392_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594393_X_P-A Feature FT:CDS EU594393_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594394_X_P-A Feature FT:CDS EU594394_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU594395_X_P-A Feature FT:CDS EU594395_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU747320_X_P-A Feature FT:CDS EU747320_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate V51). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
aacaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859898_X_P-A Feature FT:CDS EU859898_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P45). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859899_X_P-A Feature FT:CDS EU859899_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P44). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859900_X_P-A Feature FT:CDS EU859900_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P42). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaagactcttggactcccagcaatgtcaacgaccga
ccttgaggcgtacttcaaagactgtgtgtttaagcactgggaggagctgggggaagagaataggttaaaggtctttgtat
taggaggctgtaagcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859901_X_P-A Feature FT:CDS EU859901_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P37). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaaatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaagaactgggggaagaaataaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctggccaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859902_X_P-A Feature FT:CDS EU859902_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P32). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859903_X_P-A Feature FT:CDS EU859903_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P40). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccaccaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859904_X_P-A Feature FT:CDS EU859904_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P39). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859905_X_P-A Feature FT:CDS EU859905_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P38). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859906_X_P-A Feature FT:CDS EU859906_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P30). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtagccataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859907_X_P-A Feature FT:CDS EU859907_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P29). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859908_X_P-A Feature FT:CDS EU859908_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859909_X_P-A Feature FT:CDS EU859909_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P31). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859910_X_P-A Feature FT:CDS EU859910_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P27). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859911_X_P-A Feature FT:CDS EU859911_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P26). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859912_X_P-A Feature FT:CDS EU859912_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P23). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859913_X_P-A Feature FT:CDS EU859913_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859914_X_P-A Feature FT:CDS EU859914_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859915_X_P-A Feature FT:CDS EU859915_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P07). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859916_X_P-A Feature FT:CDS EU859916_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P03). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859917_X_P-A Feature FT:CDS EU859917_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P13). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaaagtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859918_X_P-A Feature FT:CDS EU859918_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859919_X_P-A Feature FT:CDS EU859919_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P19). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859920_X_P-A Feature FT:CDS EU859920_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P21). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859921_X_P-A Feature FT:CDS EU859921_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P08). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859922_X_P-A Feature FT:CDS EU859922_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P09). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859923_X_P-A Feature FT:CDS EU859923_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P15). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859924_X_P-A Feature FT:CDS EU859924_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859925_X_P-A Feature FT:CDS EU859925_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P22). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859926_X_P-A Feature FT:CDS EU859926_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P06). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859927_X_P-A Feature FT:CDS EU859927_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtttccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859928_X_P-A Feature FT:CDS EU859928_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P01). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859929_X_P-A Feature FT:CDS EU859929_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P43). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859930_X_P-A Feature FT:CDS EU859930_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C126). Complete genome. [Hepadnaviridae] (length=471 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccacgcccatcagatcctgcccaaggtcttacataagaggactcttggacttccagcaatgtcaac
gaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtct
ttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859931_X_P-A Feature FT:CDS EU859931_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C96). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859932_X_P-A Feature FT:CDS EU859932_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C69). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactttctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859933_X_P-A Feature FT:CDS EU859933_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C67). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859934_X_P-A Feature FT:CDS EU859934_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C60). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctaccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggaactgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859935_X_P-A Feature FT:CDS EU859935_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859936_X_P-A Feature FT:CDS EU859936_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859937_X_P-A Feature FT:CDS EU859937_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C40). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859938_X_P-A Feature FT:CDS EU859938_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C133). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859939_X_P-A Feature FT:CDS EU859939_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C130). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859940_X_P-A Feature FT:CDS EU859940_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C122). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859941_X_P-A Feature FT:CDS EU859941_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C153). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggagaagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859942_X_P-A Feature FT:CDS EU859942_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C110). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859943_X_P-A Feature FT:CDS EU859943_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C109). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859944_X_P-A Feature FT:CDS EU859944_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C105). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactgtctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859945_X_P-A Feature FT:CDS EU859945_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C102). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859946_X_P-A Feature FT:CDS EU859946_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C155). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaaatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859947_X_P-A Feature FT:CDS EU859947_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C85). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859948_X_P-A Feature FT:CDS EU859948_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C151). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagctcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagaataggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859949_X_P-A Feature FT:CDS EU859949_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C152). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagctcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taagaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859950_X_P-A Feature FT:CDS EU859950_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C64). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859951_X_P-A Feature FT:CDS EU859951_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C62). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859952_X_P-A Feature FT:CDS EU859952_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C56). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggtcgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactctcatcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttaaggactgggaggagtcgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859953_X_P-A Feature FT:CDS EU859953_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C55). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859954_X_P-A Feature FT:CDS EU859954_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C42). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859955_X_P-A Feature FT:CDS EU859955_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C39). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|EU859956_X_P-A Feature FT:CDS EU859956_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C35). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ349222_X_P-A Feature FT:CDS FJ349222_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H20). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaagatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ349224_X_P-A Feature FT:CDS FJ349224_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H71). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagctcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692554_X_P-A Feature FT:CDS FJ692554_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_24063). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcctatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtgtttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692555_X_P-A Feature FT:CDS FJ692555_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_24074). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692557_X_P-A Feature FT:CDS FJ692557_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48004). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692558_X_P-A Feature FT:CDS FJ692558_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48008). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttcgcggggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccaacctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692559_X_P-A Feature FT:CDS FJ692559_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48032). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccaccagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692561_X_P-A Feature FT:CDS FJ692561_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48040). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttcgcggggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagaytaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcmtcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692562_X_P-A Feature FT:CDS FJ692562_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48044). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaattggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgacaacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccaycagwtcctgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692563_X_P-A Feature FT:CDS FJ692563_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48049). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttcgcggggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttagactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttggggaaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692564_X_P-A Feature FT:CDS FJ692564_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48074). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgcggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692565_X_P-A Feature FT:CDS FJ692565_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48077). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgcggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692566_X_P-A Feature FT:CDS FJ692566_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48090). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttcgcgaggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692567_X_P-A Feature FT:CDS FJ692567_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48113). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgcggtcgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692570_X_P-A Feature FT:CDS FJ692570_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50010). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttcgaggggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgactacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692571_X_P-A Feature FT:CDS FJ692571_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50011). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggar
accaccgtgaacgcccatcagakcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaawgrtytttgtat
taggaggctgtaggcataaattggtytgcgcaccatcagcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692572_X_P-A Feature FT:CDS FJ692572_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50013). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttcacggggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgmttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaagatttatgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692573_X_P-A Feature FT:CDS FJ692573_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50014). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctctacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692574_X_P-A Feature FT:CDS FJ692574_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50015). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttcgcggggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692575_X_P-A Feature FT:CDS FJ692575_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50020). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcmtcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692576_X_P-A Feature FT:CDS FJ692576_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50022). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcgcggggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692577_X_P-A Feature FT:CDS FJ692577_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50024). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttcgcggggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacacccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692578_X_P-A Feature FT:CDS FJ692578_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50083). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692579_X_P-A Feature FT:CDS FJ692579_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50084). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692580_X_P-A Feature FT:CDS FJ692580_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50085). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692581_X_P-A Feature FT:CDS FJ692581_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50086). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692582_X_P-A Feature FT:CDS FJ692582_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50088). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692583_X_P-A Feature FT:CDS FJ692583_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50089). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692584_X_P-A Feature FT:CDS FJ692584_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50090). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692585_X_P-A Feature FT:CDS FJ692585_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50091). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692586_X_P-A Feature FT:CDS FJ692586_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50099). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgcggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692587_X_P-A Feature FT:CDS FJ692587_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50115). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccacttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaagatttttgtat
taggaggctgtaggcataaattggtctgcgcaccatttccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692588_X_P-A Feature FT:CDS FJ692588_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50119). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgcggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692590_X_P-A Feature FT:CDS FJ692590_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50152). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgcggtcgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accgccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692591_X_P-A Feature FT:CDS FJ692591_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50167). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgcggtcgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accgccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692592_X_P-A Feature FT:CDS FJ692592_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50175). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692593_X_P-A Feature FT:CDS FJ692593_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48054). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692595_X_P-A Feature FT:CDS FJ692595_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48093). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692596_X_P-A Feature FT:CDS FJ692596_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48103). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692597_X_P-A Feature FT:CDS FJ692597_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48125). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggggcrcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagwycytgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctytgcctaa
>gnl|hbvcds|FJ692598_X_P-A Feature FT:CDS FJ692598_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50018). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttayataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaagatttttgtat
taggaggctgtaggcataaattggtctgcgcaccatcwtcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692599_X_P-A Feature FT:CDS FJ692599_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50033). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692600_X_P-A Feature FT:CDS FJ692600_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50034). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692601_X_P-A Feature FT:CDS FJ692601_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50035). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagaytaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692602_X_P-A Feature FT:CDS FJ692602_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50041). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcacgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692603_X_P-A Feature FT:CDS FJ692603_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50050). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgcctgccgtaccggccgwccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagagtaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcttcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692604_X_P-A Feature FT:CDS FJ692604_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50052). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692605_X_P-A Feature FT:CDS FJ692605_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50059). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgagtgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692606_X_P-A Feature FT:CDS FJ692606_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50061). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692607_X_P-A Feature FT:CDS FJ692607_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50068). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggtctctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692608_X_P-A Feature FT:CDS FJ692608_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50075). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccattggatcctgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692609_X_P-A Feature FT:CDS FJ692609_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50098). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccattctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692610_X_P-A Feature FT:CDS FJ692610_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50104). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgytaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatyctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692611_X_P-A Feature FT:CDS FJ692611_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50127). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggcccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692612_X_P-A Feature FT:CDS FJ692612_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50132). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggtctctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaawgrtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ692613_X_P-A Feature FT:CDS FJ692613_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50156). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggtctctatcgtccgcttctccgtctgccgtaccaaccgtccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcttgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ904411_X_P-A Feature FT:CDS FJ904411_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A55). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccatcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FJ904434_X_P-A Feature FT:CDS FJ904434_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate B21). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtatttaaggactgggaggagctgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FM199974_X_P-A Feature FT:CDS FM199974_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttgggactctakcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaa
>gnl|hbvcds|FM199975_X_P-A Feature FT:CDS FM199975_X_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagaytaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FM199976_X_P-A Feature FT:CDS FM199976_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagabcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaagatttatgtat
taggaggctgtaggcataaattggtctgcgcaccatcmtcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FM199977_X_P-A Feature FT:CDS FM199977_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaattggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgttccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagtttaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcattttgcaactttttcacctctgcctaa
>gnl|hbvcds|FM199978_X_P-A Feature FT:CDS FM199978_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttgggactctatcgtccccttctccgtctaccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcggatcctgcccaaggtcttacataagaggactcttnnnnnnnnnnnnnnnnnnnnnnccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FM199979_X_P-A Feature FT:CDS FM199979_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FM199980_X_P-A Feature FT:CDS FM199980_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggcckcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FM199981_X_P-A Feature FT:CDS FM199981_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctscctaa
>gnl|hbvcds|FN545825_X_P-A Feature FT:CDS FN545825_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctctcggggccgcttgggtctgtatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccaacatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FN545826_X_P-A Feature FT:CDS FN545826_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttatataagaggactcttggactcccagcaatgtcaatgaccga
ccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcttcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FN545828_X_P-A Feature FT:CDS FN545828_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttctcggggccgcttgggcctctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagaycttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccaccatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FN545829_X_P-A Feature FT:CDS FN545829_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgmgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctctcggggccgcttgggcctctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttcacatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtytttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaa
>gnl|hbvcds|FN545830_X_P-A Feature FT:CDS FN545830_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggcctatatcgtccccttctccgtctgccgtatcgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FN545831_X_P-A Feature FT:CDS FN545831_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcgacgctgaatcccgcgg
acgacccctctcggggccgcttggggctctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagtttaggctaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccattatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FN545832_X_P-A Feature FT:CDS FN545832_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggcctctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatttttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FN545833_X_P-A Feature FT:CDS FN545833_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggcctctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttatataagaggactcttggactcccagccatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FN545834_X_P-A Feature FT:CDS FN545834_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggcctctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcayctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttatataagaggactcttggactcccagccatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaawgrtytwtgtat
taggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FN545835_X_P-A Feature FT:CDS FN545835_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggcctctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtyttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccaccatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FN545836_X_P-A Feature FT:CDS FN545836_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtyttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FN545837_X_P-A Feature FT:CDS FN545837_X_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagtaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|FN545838_X_P-A Feature FT:CDS FN545838_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcttgcaactttttcacctctgcctaa
>gnl|hbvcds|FN545839_X_P-A Feature FT:CDS FN545839_X_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaattggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggcctctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|FN545840_X_P-A Feature FT:CDS FN545840_X_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggcctctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccaccagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatttttgtat
taggaggctgtaggcataaattggtctgcgcaccatcttcatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ161813_X_P-A Feature FT:CDS GQ161813_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GU1021). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagcggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ184323_X_P-A Feature FT:CDS GQ184323_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1121). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactcccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcgggcccgcctgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ184324_X_P-A Feature FT:CDS GQ184324_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1122). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcctgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ331046_X_P-A Feature FT:CDS GQ331046_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-188). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatctgatcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ331047_X_P-A Feature FT:CDS GQ331047_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-56). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggtcgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactctcatcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttaaggactgggaggagtcgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ414522_X_P-A Feature FT:CDS GQ414522_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477461_X_P-A Feature FT:CDS GQ477461_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477462_X_P-A Feature FT:CDS GQ477462_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggarctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccctgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477463_X_P-A Feature FT:CDS GQ477463_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactttatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaagatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagttccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477464_X_P-A Feature FT:CDS GQ477464_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccttgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477465_X_P-A Feature FT:CDS GQ477465_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagaataggttaatgatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477466_X_P-A Feature FT:CDS GQ477466_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggatctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttatataagcggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagactaggttaatgatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477467_X_P-A Feature FT:CDS GQ477467_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477468_X_P-A Feature FT:CDS GQ477468_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtgt
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477469_X_P-A Feature FT:CDS GQ477469_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P19). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctatcgtccccttctccgtctgccgttccagccgtccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcggatcttgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477470_X_P-A Feature FT:CDS GQ477470_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P20). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477472_X_P-A Feature FT:CDS GQ477472_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477473_X_P-A Feature FT:CDS GQ477473_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P27). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477474_X_P-A Feature FT:CDS GQ477474_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P28). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477475_X_P-A Feature FT:CDS GQ477475_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P29). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtgccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477476_X_P-A Feature FT:CDS GQ477476_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P30). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagactaggttaatgatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477477_X_P-A Feature FT:CDS GQ477477_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P31). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477478_X_P-A Feature FT:CDS GQ477478_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P34). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477479_X_P-A Feature FT:CDS GQ477479_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P40). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatccagcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtttgtttaaagactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477480_X_P-A Feature FT:CDS GQ477480_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P41). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgtccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagaataggttaatgatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477482_X_P-A Feature FT:CDS GQ477482_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P46). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477484_X_P-A Feature FT:CDS GQ477484_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P54). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477486_X_P-A Feature FT:CDS GQ477486_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P57). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaccgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagtaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477487_X_P-A Feature FT:CDS GQ477487_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P60). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcttttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgattcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactctcggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagaataggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatctccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477488_X_P-A Feature FT:CDS GQ477488_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P64). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccacgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477490_X_P-A Feature FT:CDS GQ477490_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P74). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggaatctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagagaactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477491_X_P-A Feature FT:CDS GQ477491_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P75). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacacaagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccacgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477493_X_P-A Feature FT:CDS GQ477493_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P79). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgattcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaagatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccctgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477494_X_P-A Feature FT:CDS GQ477494_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P80). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaagctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477495_X_P-A Feature FT:CDS GQ477495_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P89). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477496_X_P-A Feature FT:CDS GQ477496_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P94). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477497_X_P-A Feature FT:CDS GQ477497_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P98). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477499_X_P-A Feature FT:CDS GQ477499_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P105). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggtctctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaagatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477500_X_P-A Feature FT:CDS GQ477500_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P107). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactttctcgtccccttctccgtctgccgttccagccgactacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatacaactttttcacctctgcctaa
>gnl|hbvcds|GQ477501_X_P-A Feature FT:CDS GQ477501_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P116). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggaactgggggaggagattaggttaatgatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477502_X_P-A Feature FT:CDS GQ477502_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P123). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagagtaggttaatgatttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477503_X_P-A Feature FT:CDS GQ477503_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P130). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GQ477504_X_P-A Feature FT:CDS GQ477504_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P131). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccctgcaactttttcacctctgcctaa
>gnl|hbvcds|GU563545_X_P-A Feature FT:CDS GU563545_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgtaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU563546_X_P-A Feature FT:CDS GU563546_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-66). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU563547_X_P-A Feature FT:CDS GU563547_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-23). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggaggattggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcttgcaactttttcacctctgcctaa
>gnl|hbvcds|GU563548_X_P-A Feature FT:CDS GU563548_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-108). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU563550_X_P-A Feature FT:CDS GU563550_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-204). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactttatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatcatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU563551_X_P-A Feature FT:CDS GU563551_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-124). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttacatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaagatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|GU563553_X_P-A Feature FT:CDS GU563553_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU563554_X_P-A Feature FT:CDS GU563554_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU563555_X_P-A Feature FT:CDS GU563555_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-35). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU563557_X_P-A Feature FT:CDS GU563557_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-78). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaagctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU563558_X_P-A Feature FT:CDS GU563558_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-90). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|GU563562_X_P-A Feature FT:CDS GU563562_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-189). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctggggaaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HE576988_X_P-A Feature FT:CDS HE576988_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P5.9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HE576989_X_P-A Feature FT:CDS HE576989_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P2.2.11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM011485_X_P-A Feature FT:CDS HM011485_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcrgcgctgaatcccgcgg
acgacccctcgcgcggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttacatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttayataagcggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttgaaggtgtttgttt
taggaggctgtaggmataaattggtctgcgcaccatcatcatgtaactttttcacctctgcctaa
>gnl|hbvcds|HM535200_X_P-A Feature FT:CDS HM535200_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 947 Harare). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatccgatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|HM535205_X_P-A Feature FT:CDS HM535205_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 72 Mutare). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN182318_X_P-A Feature FT:CDS JN182318_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaaggctgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggcctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatnnnnctttttcacctctgcctaa
>gnl|hbvcds|JN182319_X_P-A Feature FT:CDS JN182319_X_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccaccagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttnnnnnnnnnnnnn
>gnl|hbvcds|JN182321_X_P-A Feature FT:CDS JN182321_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
acggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacacccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttggggggggagattaggttaagggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN182322_X_P-A Feature FT:CDS JN182322_X_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctnnnnnnnnnnnnnnnnnnnctttttcacctctgcctaa
>gnl|hbvcds|JN182323_X_P-A Feature FT:CDS JN182323_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagaccgtgtgtttaaagactgggaggagttgggggaggagactaggttaaaggtctttgtat
taggaggctgtaggcataaattggtnnnnnnnnnnnnnnnnnnnnnctttttcacctctgcctaa
>gnl|hbvcds|JN182324_X_P-A Feature FT:CDS JN182324_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN182325_X_P-A Feature FT:CDS JN182325_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN182327_X_P-A Feature FT:CDS JN182327_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaacttttnnnnnnnnnnnnnn
>gnl|hbvcds|JN182328_X_P-A Feature FT:CDS JN182328_X_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN182330_X_P-A Feature FT:CDS JN182330_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN182331_X_P-A Feature FT:CDS JN182331_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattagattaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN182332_X_P-A Feature FT:CDS JN182332_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN182333_X_P-A Feature FT:CDS JN182333_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JN182334_X_P-A Feature FT:CDS JN182334_X_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaacttttnnnnnnnnnnnnnn
>gnl|hbvcds|JQ023660_X_P-A Feature FT:CDS JQ023660_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1160). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ023661_X_P-A Feature FT:CDS JQ023661_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1158). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ023662_X_P-A Feature FT:CDS JQ023662_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1164). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ023663_X_P-A Feature FT:CDS JQ023663_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1159). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ687529_X_P-A Feature FT:CDS JQ687529_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Srb 176). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ687533_X_P-A Feature FT:CDS JQ687533_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Srb 210). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707299_X_P-A Feature FT:CDS JQ707299_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707300_X_P-A Feature FT:CDS JQ707300_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707301_X_P-A Feature FT:CDS JQ707301_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707302_X_P-A Feature FT:CDS JQ707302_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C13). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707303_X_P-A Feature FT:CDS JQ707303_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707304_X_P-A Feature FT:CDS JQ707304_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C15). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707305_X_P-A Feature FT:CDS JQ707305_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C16). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707306_X_P-A Feature FT:CDS JQ707306_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C17). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgataggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcctcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagaataggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707307_X_P-A Feature FT:CDS JQ707307_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C18). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707308_X_P-A Feature FT:CDS JQ707308_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C19). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707309_X_P-A Feature FT:CDS JQ707309_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaacactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707310_X_P-A Feature FT:CDS JQ707310_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707311_X_P-A Feature FT:CDS JQ707311_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C21). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707312_X_P-A Feature FT:CDS JQ707312_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C22). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707313_X_P-A Feature FT:CDS JQ707313_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C23). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707314_X_P-A Feature FT:CDS JQ707314_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707315_X_P-A Feature FT:CDS JQ707315_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707316_X_P-A Feature FT:CDS JQ707316_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C26). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707317_X_P-A Feature FT:CDS JQ707317_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C27). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagaataggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707318_X_P-A Feature FT:CDS JQ707318_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagaataggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707319_X_P-A Feature FT:CDS JQ707319_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707320_X_P-A Feature FT:CDS JQ707320_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C30). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707321_X_P-A Feature FT:CDS JQ707321_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C31). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707322_X_P-A Feature FT:CDS JQ707322_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C32). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaaccaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707323_X_P-A Feature FT:CDS JQ707323_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C33). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707324_X_P-A Feature FT:CDS JQ707324_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C34). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707325_X_P-A Feature FT:CDS JQ707325_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C35). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707326_X_P-A Feature FT:CDS JQ707326_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C36). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707327_X_P-A Feature FT:CDS JQ707327_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C37). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707328_X_P-A Feature FT:CDS JQ707328_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C38). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707329_X_P-A Feature FT:CDS JQ707329_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C39). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttgtcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707330_X_P-A Feature FT:CDS JQ707330_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707331_X_P-A Feature FT:CDS JQ707331_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C40). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaaccaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707332_X_P-A Feature FT:CDS JQ707332_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C41). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707333_X_P-A Feature FT:CDS JQ707333_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C42). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707334_X_P-A Feature FT:CDS JQ707334_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C43). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707335_X_P-A Feature FT:CDS JQ707335_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C44). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707336_X_P-A Feature FT:CDS JQ707336_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C45). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707337_X_P-A Feature FT:CDS JQ707337_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C46). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707338_X_P-A Feature FT:CDS JQ707338_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C47). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707339_X_P-A Feature FT:CDS JQ707339_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C48). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707340_X_P-A Feature FT:CDS JQ707340_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C5). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgtccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcacttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707341_X_P-A Feature FT:CDS JQ707341_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707342_X_P-A Feature FT:CDS JQ707342_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707343_X_P-A Feature FT:CDS JQ707343_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707344_X_P-A Feature FT:CDS JQ707344_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707345_X_P-A Feature FT:CDS JQ707345_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C1). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707346_X_P-A Feature FT:CDS JQ707346_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707347_X_P-A Feature FT:CDS JQ707347_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C13). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707348_X_P-A Feature FT:CDS JQ707348_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtccgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707349_X_P-A Feature FT:CDS JQ707349_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C15). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707350_X_P-A Feature FT:CDS JQ707350_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707351_X_P-A Feature FT:CDS JQ707351_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707352_X_P-A Feature FT:CDS JQ707352_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707353_X_P-A Feature FT:CDS JQ707353_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C21). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttccgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707354_X_P-A Feature FT:CDS JQ707354_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C22-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707355_X_P-A Feature FT:CDS JQ707355_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707356_X_P-A Feature FT:CDS JQ707356_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707357_X_P-A Feature FT:CDS JQ707357_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C29-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707358_X_P-A Feature FT:CDS JQ707358_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C33). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707359_X_P-A Feature FT:CDS JQ707359_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C35). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707360_X_P-A Feature FT:CDS JQ707360_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C36). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatttttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707361_X_P-A Feature FT:CDS JQ707361_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C37). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707362_X_P-A Feature FT:CDS JQ707362_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C39). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagacaatgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707363_X_P-A Feature FT:CDS JQ707363_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707364_X_P-A Feature FT:CDS JQ707364_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C41). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707365_X_P-A Feature FT:CDS JQ707365_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C43). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707366_X_P-A Feature FT:CDS JQ707366_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C44). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707367_X_P-A Feature FT:CDS JQ707367_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C46). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707368_X_P-A Feature FT:CDS JQ707368_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C47). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707369_X_P-A Feature FT:CDS JQ707369_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C48). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707370_X_P-A Feature FT:CDS JQ707370_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707371_X_P-A Feature FT:CDS JQ707371_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707372_X_P-A Feature FT:CDS JQ707372_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707373_X_P-A Feature FT:CDS JQ707373_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707374_X_P-A Feature FT:CDS JQ707374_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C15). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtcagtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707375_X_P-A Feature FT:CDS JQ707375_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C17-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707376_X_P-A Feature FT:CDS JQ707376_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707377_X_P-A Feature FT:CDS JQ707377_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C21). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707378_X_P-A Feature FT:CDS JQ707378_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C22). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707379_X_P-A Feature FT:CDS JQ707379_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C24-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707380_X_P-A Feature FT:CDS JQ707380_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C27). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707381_X_P-A Feature FT:CDS JQ707381_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707382_X_P-A Feature FT:CDS JQ707382_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707383_X_P-A Feature FT:CDS JQ707383_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C31). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccaacaatgtcaacgaccga
ccttgaggcctacttcaaagactctgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707384_X_P-A Feature FT:CDS JQ707384_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C32). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707385_X_P-A Feature FT:CDS JQ707385_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C33). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707386_X_P-A Feature FT:CDS JQ707386_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C34). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707387_X_P-A Feature FT:CDS JQ707387_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C36). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707388_X_P-A Feature FT:CDS JQ707388_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C37). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707389_X_P-A Feature FT:CDS JQ707389_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C38). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707390_X_P-A Feature FT:CDS JQ707390_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C39). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707391_X_P-A Feature FT:CDS JQ707391_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707392_X_P-A Feature FT:CDS JQ707392_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C40). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707393_X_P-A Feature FT:CDS JQ707393_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C42). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707394_X_P-A Feature FT:CDS JQ707394_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C44). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707395_X_P-A Feature FT:CDS JQ707395_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C46). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707396_X_P-A Feature FT:CDS JQ707396_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C47). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707397_X_P-A Feature FT:CDS JQ707397_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C48). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
tacgaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707398_X_P-A Feature FT:CDS JQ707398_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707399_X_P-A Feature FT:CDS JQ707399_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707400_X_P-A Feature FT:CDS JQ707400_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707401_X_P-A Feature FT:CDS JQ707401_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C10). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcacacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgagaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707402_X_P-A Feature FT:CDS JQ707402_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C11-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707403_X_P-A Feature FT:CDS JQ707403_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagaataggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707404_X_P-A Feature FT:CDS JQ707404_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707405_X_P-A Feature FT:CDS JQ707405_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C18). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctttaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707406_X_P-A Feature FT:CDS JQ707406_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C19). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707407_X_P-A Feature FT:CDS JQ707407_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C20-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707408_X_P-A Feature FT:CDS JQ707408_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C23). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707409_X_P-A Feature FT:CDS JQ707409_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C26-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707410_X_P-A Feature FT:CDS JQ707410_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707411_X_P-A Feature FT:CDS JQ707411_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccagcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707412_X_P-A Feature FT:CDS JQ707412_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C32). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707413_X_P-A Feature FT:CDS JQ707413_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C34). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707414_X_P-A Feature FT:CDS JQ707414_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C35). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707415_X_P-A Feature FT:CDS JQ707415_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C40). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707416_X_P-A Feature FT:CDS JQ707416_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C41). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707417_X_P-A Feature FT:CDS JQ707417_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C44). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707418_X_P-A Feature FT:CDS JQ707418_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C47). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707419_X_P-A Feature FT:CDS JQ707419_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C48). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707420_X_P-A Feature FT:CDS JQ707420_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707531_X_P-A Feature FT:CDS JQ707531_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707532_X_P-A Feature FT:CDS JQ707532_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggaatctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactatgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707533_X_P-A Feature FT:CDS JQ707533_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagctgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707534_X_P-A Feature FT:CDS JQ707534_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707535_X_P-A Feature FT:CDS JQ707535_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C13). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707536_X_P-A Feature FT:CDS JQ707536_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707537_X_P-A Feature FT:CDS JQ707537_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C15). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707538_X_P-A Feature FT:CDS JQ707538_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707539_X_P-A Feature FT:CDS JQ707539_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707540_X_P-A Feature FT:CDS JQ707540_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C18). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707541_X_P-A Feature FT:CDS JQ707541_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C19). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707542_X_P-A Feature FT:CDS JQ707542_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C21). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707543_X_P-A Feature FT:CDS JQ707543_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C22). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactatgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707544_X_P-A Feature FT:CDS JQ707544_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C23). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707545_X_P-A Feature FT:CDS JQ707545_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707546_X_P-A Feature FT:CDS JQ707546_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C26). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707547_X_P-A Feature FT:CDS JQ707547_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C27). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707548_X_P-A Feature FT:CDS JQ707548_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707549_X_P-A Feature FT:CDS JQ707549_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C29). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707550_X_P-A Feature FT:CDS JQ707550_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707551_X_P-A Feature FT:CDS JQ707551_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C30). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactatgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707552_X_P-A Feature FT:CDS JQ707552_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C31). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707553_X_P-A Feature FT:CDS JQ707553_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C32). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707554_X_P-A Feature FT:CDS JQ707554_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C33). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707555_X_P-A Feature FT:CDS JQ707555_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C34). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707556_X_P-A Feature FT:CDS JQ707556_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C35). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707557_X_P-A Feature FT:CDS JQ707557_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C36). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707558_X_P-A Feature FT:CDS JQ707558_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C38). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707559_X_P-A Feature FT:CDS JQ707559_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcytgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707560_X_P-A Feature FT:CDS JQ707560_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C40). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctaccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaagatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707561_X_P-A Feature FT:CDS JQ707561_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C41). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcacgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707562_X_P-A Feature FT:CDS JQ707562_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C42). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707563_X_P-A Feature FT:CDS JQ707563_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C43). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707564_X_P-A Feature FT:CDS JQ707564_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C44). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707565_X_P-A Feature FT:CDS JQ707565_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C45). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707566_X_P-A Feature FT:CDS JQ707566_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C46). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707567_X_P-A Feature FT:CDS JQ707567_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C47). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707568_X_P-A Feature FT:CDS JQ707568_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C48). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtttgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707569_X_P-A Feature FT:CDS JQ707569_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707570_X_P-A Feature FT:CDS JQ707570_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C6). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtaaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707571_X_P-A Feature FT:CDS JQ707571_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C7). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtaaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707572_X_P-A Feature FT:CDS JQ707572_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707573_X_P-A Feature FT:CDS JQ707573_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707574_X_P-A Feature FT:CDS JQ707574_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C10). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707575_X_P-A Feature FT:CDS JQ707575_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C13). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707576_X_P-A Feature FT:CDS JQ707576_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707577_X_P-A Feature FT:CDS JQ707577_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C15). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707578_X_P-A Feature FT:CDS JQ707578_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707579_X_P-A Feature FT:CDS JQ707579_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707580_X_P-A Feature FT:CDS JQ707580_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C18). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707581_X_P-A Feature FT:CDS JQ707581_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C19). Complete genome. [Hepadnaviridae] (length=465 residues).
gtggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccataagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707582_X_P-A Feature FT:CDS JQ707582_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C2). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtttgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707583_X_P-A Feature FT:CDS JQ707583_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C21). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707584_X_P-A Feature FT:CDS JQ707584_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C22). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707585_X_P-A Feature FT:CDS JQ707585_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C23). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707586_X_P-A Feature FT:CDS JQ707586_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707587_X_P-A Feature FT:CDS JQ707587_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707588_X_P-A Feature FT:CDS JQ707588_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C26). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707589_X_P-A Feature FT:CDS JQ707589_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C27). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgagactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707590_X_P-A Feature FT:CDS JQ707590_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707591_X_P-A Feature FT:CDS JQ707591_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C29). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707592_X_P-A Feature FT:CDS JQ707592_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctgggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707593_X_P-A Feature FT:CDS JQ707593_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C33). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707594_X_P-A Feature FT:CDS JQ707594_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C34). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707595_X_P-A Feature FT:CDS JQ707595_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C35). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707596_X_P-A Feature FT:CDS JQ707596_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C36). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707597_X_P-A Feature FT:CDS JQ707597_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C37). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707598_X_P-A Feature FT:CDS JQ707598_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C38). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtttgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707599_X_P-A Feature FT:CDS JQ707599_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707600_X_P-A Feature FT:CDS JQ707600_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C40). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgagggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707601_X_P-A Feature FT:CDS JQ707601_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C41). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707602_X_P-A Feature FT:CDS JQ707602_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C42). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707603_X_P-A Feature FT:CDS JQ707603_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C43). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707604_X_P-A Feature FT:CDS JQ707604_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C44). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcag
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707605_X_P-A Feature FT:CDS JQ707605_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C45). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707606_X_P-A Feature FT:CDS JQ707606_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C48). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707607_X_P-A Feature FT:CDS JQ707607_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707608_X_P-A Feature FT:CDS JQ707608_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707609_X_P-A Feature FT:CDS JQ707609_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707610_X_P-A Feature FT:CDS JQ707610_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707611_X_P-A Feature FT:CDS JQ707611_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagacagtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707612_X_P-A Feature FT:CDS JQ707612_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C13). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707613_X_P-A Feature FT:CDS JQ707613_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C15). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactatgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707614_X_P-A Feature FT:CDS JQ707614_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707615_X_P-A Feature FT:CDS JQ707615_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C18). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707616_X_P-A Feature FT:CDS JQ707616_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707617_X_P-A Feature FT:CDS JQ707617_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C21). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgctacacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707618_X_P-A Feature FT:CDS JQ707618_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C22). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactatgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707619_X_P-A Feature FT:CDS JQ707619_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C23). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707620_X_P-A Feature FT:CDS JQ707620_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707621_X_P-A Feature FT:CDS JQ707621_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C26). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707622_X_P-A Feature FT:CDS JQ707622_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C27). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatactgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707623_X_P-A Feature FT:CDS JQ707623_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707624_X_P-A Feature FT:CDS JQ707624_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707625_X_P-A Feature FT:CDS JQ707625_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C30). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactatatgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707626_X_P-A Feature FT:CDS JQ707626_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C31). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707627_X_P-A Feature FT:CDS JQ707627_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C32). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707628_X_P-A Feature FT:CDS JQ707628_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C33). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707629_X_P-A Feature FT:CDS JQ707629_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C34). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707630_X_P-A Feature FT:CDS JQ707630_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C35). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707631_X_P-A Feature FT:CDS JQ707631_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C36-6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707632_X_P-A Feature FT:CDS JQ707632_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggcctcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707633_X_P-A Feature FT:CDS JQ707633_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C41). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707634_X_P-A Feature FT:CDS JQ707634_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C42). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttcctgccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707635_X_P-A Feature FT:CDS JQ707635_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C45). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707636_X_P-A Feature FT:CDS JQ707636_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C46). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707637_X_P-A Feature FT:CDS JQ707637_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C5-5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707638_X_P-A Feature FT:CDS JQ707638_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707639_X_P-A Feature FT:CDS JQ707639_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C13-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707640_X_P-A Feature FT:CDS JQ707640_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707641_X_P-A Feature FT:CDS JQ707641_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707642_X_P-A Feature FT:CDS JQ707642_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgatccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707643_X_P-A Feature FT:CDS JQ707643_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C20-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707644_X_P-A Feature FT:CDS JQ707644_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C22). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactatgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707645_X_P-A Feature FT:CDS JQ707645_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707646_X_P-A Feature FT:CDS JQ707646_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C26). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtattacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707647_X_P-A Feature FT:CDS JQ707647_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C27). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707648_X_P-A Feature FT:CDS JQ707648_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactatgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707649_X_P-A Feature FT:CDS JQ707649_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707650_X_P-A Feature FT:CDS JQ707650_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C30). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactatatgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707651_X_P-A Feature FT:CDS JQ707651_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C33). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707652_X_P-A Feature FT:CDS JQ707652_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C34). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707653_X_P-A Feature FT:CDS JQ707653_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C38). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707654_X_P-A Feature FT:CDS JQ707654_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C40). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707655_X_P-A Feature FT:CDS JQ707655_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C41). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707656_X_P-A Feature FT:CDS JQ707656_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C43). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707658_X_P-A Feature FT:CDS JQ707658_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_13). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707659_X_P-A Feature FT:CDS JQ707659_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacatacgaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707661_X_P-A Feature FT:CDS JQ707661_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_18). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707662_X_P-A Feature FT:CDS JQ707662_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_19). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707663_X_P-A Feature FT:CDS JQ707663_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707664_X_P-A Feature FT:CDS JQ707664_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_20). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707665_X_P-A Feature FT:CDS JQ707665_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_21). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707667_X_P-A Feature FT:CDS JQ707667_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707669_X_P-A Feature FT:CDS JQ707669_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707670_X_P-A Feature FT:CDS JQ707670_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_29). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707672_X_P-A Feature FT:CDS JQ707672_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_32). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707674_X_P-A Feature FT:CDS JQ707674_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_38). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707675_X_P-A Feature FT:CDS JQ707675_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_41). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707676_X_P-A Feature FT:CDS JQ707676_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_42). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JQ707681_X_P-A Feature FT:CDS JQ707681_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_9-12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX096952_X_P-A Feature FT:CDS JX096952_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 11-10165). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX096953_X_P-A Feature FT:CDS JX096953_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 12-8957). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX154579_X_P-A Feature FT:CDS JX154579_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBVFLS36). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttgggcctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX154580_X_P-A Feature FT:CDS JX154580_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBVFLS46). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttgggcctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX154581_X_P-A Feature FT:CDS JX154581_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBVFLS51). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttgggcctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX154582_X_P-A Feature FT:CDS JX154582_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBVFLS64). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttgggcctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctgtgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|JX310722_X_P-A Feature FT:CDS JX310722_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate D1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccannnnnnnnnnnnnnnnnnnnctctgcctaa
>gnl|hbvcds|JX310723_X_P-A Feature FT:CDS JX310723_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate D5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgtttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccannnnnnnnnnnnnnnnnnnnctctgcctaa
>gnl|hbvcds|KC875251_X_P-A Feature FT:CDS KC875251_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV1). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactgttggactcccagcaatgtcaacgaccga
ccttgaggcctccttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875252_X_P-A Feature FT:CDS KC875252_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV3). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagatgaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875253_X_P-A Feature FT:CDS KC875253_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV23). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggcgcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaatgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875254_X_P-A Feature FT:CDS KC875254_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV12). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattctacgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgactgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaagctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875255_X_P-A Feature FT:CDS KC875255_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV24). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctacgtctgccgtaccgtccgaccacggggcgcacctct
ctttacacggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcaggtcctgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875256_X_P-A Feature FT:CDS KC875256_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV27). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctacgtctgccgtaccgtccgaccacggggcgcacctct
ctttacacggtctccccgtctgtgccttctcacctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcacgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875257_X_P-A Feature FT:CDS KC875257_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV14). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgagggacgtcctttgtttacgtcccgtcagcgctgaatcccccgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccgtcaggtcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875258_X_P-A Feature FT:CDS KC875258_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV66). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875259_X_P-A Feature FT:CDS KC875259_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV73). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggatccttcgagggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattacgttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KC875260_X_P-A Feature FT:CDS KC875260_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV5). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggagtctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaatgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagcttggggaggagattaggttaaaggtgtttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF214657_X_P-A Feature FT:CDS KF214657_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2008-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF214658_X_P-A Feature FT:CDS KF214658_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2009-6). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcacacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF214659_X_P-A Feature FT:CDS KF214659_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2009-2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgccgggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF214660_X_P-A Feature FT:CDS KF214660_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2008-9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctgcgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactcccatcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF214661_X_P-A Feature FT:CDS KF214661_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2008-8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtttcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcctgtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF214662_X_P-A Feature FT:CDS KF214662_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2008-14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggatttgggggaggagagtaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF214663_X_P-A Feature FT:CDS KF214663_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2007-11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF214665_X_P-A Feature FT:CDS KF214665_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2008-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtac
taggaggctgtaggcataaattggtctgctcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF214666_X_P-A Feature FT:CDS KF214666_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2010-7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttatataagaggactcttggactctcagcaatgtcaatgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF922406_X_P-A Feature FT:CDS KF922406_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3791v1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF922407_X_P-A Feature FT:CDS KF922407_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3791v2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF922408_X_P-A Feature FT:CDS KF922408_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3791v3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF922409_X_P-A Feature FT:CDS KF922409_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3791v4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF922414_X_P-A Feature FT:CDS KF922414_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcggaacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccctcgaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagtcgggggaggagatgaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF922415_X_P-A Feature FT:CDS KF922415_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcggaacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccctcgaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagtcgggggaggagatgaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF922416_X_P-A Feature FT:CDS KF922416_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcggaacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccctcgaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagtcgggggaggagatgaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF922417_X_P-A Feature FT:CDS KF922417_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v4). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcggaacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccctcgaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagtcgggggaggagatgaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF922418_X_P-A Feature FT:CDS KF922418_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcggaacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccctcgaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagtcgggggaggagatgaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF922419_X_P-A Feature FT:CDS KF922419_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v6). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcggaacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccctcgaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagtcgggggaggagatgaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF922420_X_P-A Feature FT:CDS KF922420_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcggaacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccctcgaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagtcgggggaggagatgaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF922421_X_P-A Feature FT:CDS KF922421_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcggaacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccctcgaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagtcgggggaggagatgaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF922424_X_P-A Feature FT:CDS KF922424_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4070v1). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
acctccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF922425_X_P-A Feature FT:CDS KF922425_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4070v2). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
acctccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF922426_X_P-A Feature FT:CDS KF922426_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4312v1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF922427_X_P-A Feature FT:CDS KF922427_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4312v2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF922428_X_P-A Feature FT:CDS KF922428_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4312v3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF922429_X_P-A Feature FT:CDS KF922429_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3274v1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgcggtcgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtattacataaaaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF922430_X_P-A Feature FT:CDS KF922430_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3274v2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgcggtcgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtattacataaaaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF922431_X_P-A Feature FT:CDS KF922431_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3274v3). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgcggtcgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtattacataaaaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF922433_X_P-A Feature FT:CDS KF922433_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3658v1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaaagatttatgtat
taggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF922434_X_P-A Feature FT:CDS KF922434_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3658v2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcaggtcttgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF922435_X_P-A Feature FT:CDS KF922435_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N060v1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF922436_X_P-A Feature FT:CDS KF922436_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N060v2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcctgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KF922437_X_P-A Feature FT:CDS KF922437_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N060v3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ010776_X_P-A Feature FT:CDS KJ010776_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3358v1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ010777_X_P-A Feature FT:CDS KJ010777_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3358v2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ010778_X_P-A Feature FT:CDS KJ010778_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3358v3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ586809_X_P-A Feature FT:CDS KJ586809_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgattcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843166_X_P-A Feature FT:CDS KJ843166_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag04). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgtttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843172_X_P-A Feature FT:CDS KJ843172_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagactaggttaaagatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843173_X_P-A Feature FT:CDS KJ843173_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag11). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccggccgcccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843182_X_P-A Feature FT:CDS KJ843182_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag21). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgattcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843183_X_P-A Feature FT:CDS KJ843183_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag22). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843184_X_P-A Feature FT:CDS KJ843184_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag23). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactgtctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaaatcctgcccacggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtangnataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843186_X_P-A Feature FT:CDS KJ843186_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgattcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatatttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843188_X_P-A Feature FT:CDS KJ843188_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag27). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgtttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843192_X_P-A Feature FT:CDS KJ843192_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag31). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgtttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843214_X_P-A Feature FT:CDS KJ843214_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag55). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgtttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843215_X_P-A Feature FT:CDS KJ843215_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag56). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgtttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactttcaggaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843216_X_P-A Feature FT:CDS KJ843216_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag57). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgtttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactttcaggaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843217_X_P-A Feature FT:CDS KJ843217_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag62). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgattcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ843218_X_P-A Feature FT:CDS KJ843218_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag63). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccggccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ854685_X_P-A Feature FT:CDS KJ854685_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 116-SE-BRA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ854686_X_P-A Feature FT:CDS KJ854686_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1356-SE-BRA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgrggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ854687_X_P-A Feature FT:CDS KJ854687_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1377-SE-BRA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcagttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ854688_X_P-A Feature FT:CDS KJ854688_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1379-SE-BRA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ854689_X_P-A Feature FT:CDS KJ854689_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 16202-NE-BRA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccancaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ854690_X_P-A Feature FT:CDS KJ854690_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 16338-NE-BRA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttgggactctatcgtccccttcttcgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
tgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ854691_X_P-A Feature FT:CDS KJ854691_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 16650-NE-BRA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ854692_X_P-A Feature FT:CDS KJ854692_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 17372-NE-BRA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcgcggggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ854694_X_P-A Feature FT:CDS KJ854694_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 17822-NE-BRA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ854695_X_P-A Feature FT:CDS KJ854695_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1814-N-BRA). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcgcgaggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcttgcccaaggtcttayataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttnnnnnnnnnntaa
>gnl|hbvcds|KJ854696_X_P-A Feature FT:CDS KJ854696_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 18158-SE-BRA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ854697_X_P-A Feature FT:CDS KJ854697_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1969-SE-BRA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ854699_X_P-A Feature FT:CDS KJ854699_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 2340-N-BRA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcrgcgctgaatcccgcgg
acgacccctcgcgaggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacttct
ctttacgcagtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaaagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ854700_X_P-A Feature FT:CDS KJ854700_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 313-N-BRA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttgggagtctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ854701_X_P-A Feature FT:CDS KJ854701_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 349-SE-BRA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtatttaaagactgggaggagttaggggaggagactaggttaatgatctatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ854702_X_P-A Feature FT:CDS KJ854702_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 41-CW-BRA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaattggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ854703_X_P-A Feature FT:CDS KJ854703_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 65-SE-BRA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ854704_X_P-A Feature FT:CDS KJ854704_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 66-CW-BRA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgttccgtctgcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaawggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ854705_X_P-A Feature FT:CDS KJ854705_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 67-CW-BRA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ854706_X_P-A Feature FT:CDS KJ854706_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 753-CW-BRA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ854707_X_P-A Feature FT:CDS KJ854707_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 895-N-BRA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacgaggccgcttgggaatctatcgtccccttctccgtctgccgtaccatccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ854708_X_P-A Feature FT:CDS KJ854708_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 16-S-BRA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KJ854709_X_P-A Feature FT:CDS KJ854709_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 24-S-BRA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggcgcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctggcggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtcnnnnnnnnnnnnnnnnnnnnctttttcacctctgcctaa
>gnl|hbvcds|KJ854710_X_P-A Feature FT:CDS KJ854710_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 274-SE-BRA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM243029_X_P-A Feature FT:CDS KM243029_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate TAC455). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM519452_X_P-A Feature FT:CDS KM519452_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_G1862T_Mutant_SA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgatccctcacggggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgctgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtttttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM519453_X_P-A Feature FT:CDS KM519453_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_Wild_SA). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgatccctcacggggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgctgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtttttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM519454_X_P-A Feature FT:CDS KM519454_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A2_WT_BEL). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaagttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM606737_X_P-A Feature FT:CDS KM606737_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba13a). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccaacatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM606742_X_P-A Feature FT:CDS KM606742_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM606746_X_P-A Feature FT:CDS KM606746_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba14). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM606748_X_P-A Feature FT:CDS KM606748_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba51). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KM606749_X_P-A Feature FT:CDS KM606749_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba56). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP168422_X_P-A Feature FT:CDS KP168422_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KN136). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggcctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccattggatcctgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaagatttatgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP168423_X_P-A Feature FT:CDS KP168423_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate NRB517). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggcctctatcgtccccttctacgtctaccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttacagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP168424_X_P-A Feature FT:CDS KP168424_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KSM571). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactggcaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcccttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP168425_X_P-A Feature FT:CDS KP168425_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MBS119). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttgkactcccaacaatgtcwgcgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaagttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP168426_X_P-A Feature FT:CDS KP168426_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KSM05). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggacgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaawggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP168427_X_P-A Feature FT:CDS KP168427_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EMB201). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcrg
acgacccctcgcggggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP168428_X_P-A Feature FT:CDS KP168428_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KN195). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcgcgcggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagaataggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP168429_X_P-A Feature FT:CDS KP168429_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KN033). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacatcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcgcgcggccgcttgggaatctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP168430_X_P-A Feature FT:CDS KP168430_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate NRB10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcgcgcggccgcttgggaatctatcgtccccttctccgtctgccgttccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccaccaaatcctgcccaaggtcttacacaagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP168431_X_P-A Feature FT:CDS KP168431_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KSM03). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaattggattcttcgcgggacgtcctttgtttacgtcccgtcrgcgctgaatcccgcgg
acgacccctcgcgcggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccrtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaatgatttttgtat
taggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP168432_X_P-A Feature FT:CDS KP168432_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EMB213). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaattggattcttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcgg
acgacccctcgcgcggccgcttgggaatctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccatctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcagcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP168433_X_P-A Feature FT:CDS KP168433_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate NRB04). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaattggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcgcgcggccgcttgggaatctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccatctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccakcaycatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP168434_X_P-A Feature FT:CDS KP168434_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KSM564). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggacgcttgggtctgtatcgtccccttctccgtctaccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagattctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP168435_X_P-A Feature FT:CDS KP168435_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MBS117). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtgctgccaactggattcttcgcgggacgtcctttgtctacgttccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctatcggccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtccgttccagctcatccgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP274925_X_P-A Feature FT:CDS KP274925_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS-1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP274927_X_P-A Feature FT:CDS KP274927_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS-3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagctcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP274928_X_P-A Feature FT:CDS KP274928_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS-4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP718085_X_P-A Feature FT:CDS KP718085_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-12-1-26). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
amgamccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP718086_X_P-A Feature FT:CDS KP718086_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-03-02-1-60). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
amgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagargactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP718087_X_P-A Feature FT:CDS KP718087_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1897). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgmttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP718088_X_P-A Feature FT:CDS KP718088_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1162). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP718089_X_P-A Feature FT:CDS KP718089_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1249). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP718090_X_P-A Feature FT:CDS KP718090_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1348). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctytgcctaa
>gnl|hbvcds|KP718091_X_P-A Feature FT:CDS KP718091_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1771). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctytgcctaa
>gnl|hbvcds|KP718092_X_P-A Feature FT:CDS KP718092_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1891). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtrctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP718093_X_P-A Feature FT:CDS KP718093_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1202). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaacttttacacctctgcctaa
>gnl|hbvcds|KP718094_X_P-A Feature FT:CDS KP718094_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 8757_TR). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttatttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP718095_X_P-A Feature FT:CDS KP718095_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 8809_TR). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP718096_X_P-A Feature FT:CDS KP718096_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-0004). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcataa
>gnl|hbvcds|KP718097_X_P-A Feature FT:CDS KP718097_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GP13-1943). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP718098_X_P-A Feature FT:CDS KP718098_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3106_HIV). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP718099_X_P-A Feature FT:CDS KP718099_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GP13-378). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP718100_X_P-A Feature FT:CDS KP718100_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 137_HIV). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttatttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP718101_X_P-A Feature FT:CDS KP718101_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GP11-3018). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP718102_X_P-A Feature FT:CDS KP718102_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GP12-1400). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcacttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KP995108_X_P-A Feature FT:CDS KP995108_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 203-Cirrhosis). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctgtgctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccaccaaatcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KR905425_X_P-A Feature FT:CDS KR905425_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICI-24). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttgggactatatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KR905426_X_P-A Feature FT:CDS KR905426_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICI-28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctccacaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaa
>gnl|hbvcds|KR905427_X_P-A Feature FT:CDS KR905427_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICI-30). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgcggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatccggtcctgcccaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KR905429_X_P-A Feature FT:CDS KR905429_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICI-35). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtccttcgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KR905430_X_P-A Feature FT:CDS KR905430_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICI-47). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KR905431_X_P-A Feature FT:CDS KR905431_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICI-77). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT151611_X_P-A Feature FT:CDS KT151611_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 398). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgrggtcgtttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccttgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT151612_X_P-A Feature FT:CDS KT151612_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 500). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgrggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcacctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaaatggtctgcgcaccatcctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT151613_X_P-A Feature FT:CDS KT151613_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 792). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgrggccgcttgggratgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactctcggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT151614_X_P-A Feature FT:CDS KT151614_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 969). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgrrgccgcttgggactgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactcycagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaargactgggaggagytgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT151615_X_P-A Feature FT:CDS KT151615_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 191). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgrrgccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttayataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaargactgggaggagttkggggaggagattaggttaawgrtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT151616_X_P-A Feature FT:CDS KT151616_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 655). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgrrgccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT151617_X_P-A Feature FT:CDS KT151617_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 803). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgrggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcacctrccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaaatggtctgcgcaccatcctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT151618_X_P-A Feature FT:CDS KT151618_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 590). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT347087_X_P-A Feature FT:CDS KT347087_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM265). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcgg
acgacccctcgcgaggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT347088_X_P-A Feature FT:CDS KT347088_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM285). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT347091_X_P-A Feature FT:CDS KT347091_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM3). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatcggccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcggatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT347092_X_P-A Feature FT:CDS KT347092_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM4). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT366466_X_P-A Feature FT:CDS KT366466_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C-EICI.7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttgggactatatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT366467_X_P-A Feature FT:CDS KT366467_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C-EICI.9). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctccacaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaa
>gnl|hbvcds|KT366468_X_P-A Feature FT:CDS KT366468_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C-EICI.27). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT366469_X_P-A Feature FT:CDS KT366469_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C-EICI.28). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT366470_X_P-A Feature FT:CDS KT366470_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C-EICI.31). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT366471_X_P-A Feature FT:CDS KT366471_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C-EICI.50). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749822_X_P-A Feature FT:CDS KT749822_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL19). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgtccacggggcacacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaagatttttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749824_X_P-A Feature FT:CDS KT749824_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL2b). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749825_X_P-A Feature FT:CDS KT749825_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL4a). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749826_X_P-A Feature FT:CDS KT749826_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL4b). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749829_X_P-A Feature FT:CDS KT749829_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL7). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749830_X_P-A Feature FT:CDS KT749830_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL5b). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749831_X_P-A Feature FT:CDS KT749831_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL8). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749832_X_P-A Feature FT:CDS KT749832_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749833_X_P-A Feature FT:CDS KT749833_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL9b). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccatcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749834_X_P-A Feature FT:CDS KT749834_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL9a). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749835_X_P-A Feature FT:CDS KT749835_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL9c). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749836_X_P-A Feature FT:CDS KT749836_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749837_X_P-A Feature FT:CDS KT749837_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL15). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749838_X_P-A Feature FT:CDS KT749838_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749839_X_P-A Feature FT:CDS KT749839_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL5d). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749840_X_P-A Feature FT:CDS KT749840_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL18). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
acccccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749842_X_P-A Feature FT:CDS KT749842_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL4e). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749843_X_P-A Feature FT:CDS KT749843_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL5c). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749844_X_P-A Feature FT:CDS KT749844_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749846_X_P-A Feature FT:CDS KT749846_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL4f). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749847_X_P-A Feature FT:CDS KT749847_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL4d). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749849_X_P-A Feature FT:CDS KT749849_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL4c). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtac
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KT749850_X_P-A Feature FT:CDS KT749850_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL21). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KU605532_X_P-A Feature FT:CDS KU605532_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1486Baseline). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcctaggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KU605533_X_P-A Feature FT:CDS KU605533_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM8787Baseline). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtatcgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtcaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaaatttttcacctctgcataa
>gnl|hbvcds|KU605534_X_P-A Feature FT:CDS KU605534_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM8787F2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtatcgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccggaaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactctatgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KU605535_X_P-A Feature FT:CDS KU605535_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1163Baseline). Complete genome. [Hepadnaviridae] (length=462 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcaactaaaattggtctgcgcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KU605536_X_P-A Feature FT:CDS KU605536_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM4643Baseline). Complete genome. [Hepadnaviridae] (length=462 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaagtctttgtat
taggaggctgtaggcataaattggtctgctctcgctcgcccaaatttttcacctctgcctaa
>gnl|hbvcds|KU605537_X_P-A Feature FT:CDS KU605537_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM4643F1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KU605538_X_P-A Feature FT:CDS KU605538_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM4643F2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KU605539_X_P-A Feature FT:CDS KU605539_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM4643F3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KU736918_X_P-A Feature FT:CDS KU736918_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Tanzania_1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaagatytttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KU736919_X_P-A Feature FT:CDS KU736919_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Tanzania_2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KU736920_X_P-A Feature FT:CDS KU736920_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Sudan_10). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttaygcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX276769_X_P-A Feature FT:CDS KX276769_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcrgcgctgaatcccgcgg
acgacccctcgcggggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaa
>gnl|hbvcds|KX357642_X_P-A Feature FT:CDS KX357642_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JM16ETH). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgttccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX357643_X_P-A Feature FT:CDS KX357643_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MK156ETH). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggcctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaaatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaagatttatgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX357644_X_P-A Feature FT:CDS KX357644_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate AA152ETH). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgttccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcgaagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaagatttatgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX357645_X_P-A Feature FT:CDS KX357645_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate AA162ETH). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX357646_X_P-A Feature FT:CDS KX357646_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BL185ETH). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX357647_X_P-A Feature FT:CDS KX357647_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BL13ETH). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcgaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccaaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccattggatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaagatttatgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX357649_X_P-A Feature FT:CDS KX357649_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate AA86ETH). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgatccctcgcgaggccgcttgggtctctatcgtccccttcttcgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactattggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX357650_X_P-A Feature FT:CDS KX357650_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate AA46ETH). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcgaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagaataaagatctttgtac
taggaggccgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX648547_X_P-A Feature FT:CDS KX648547_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Zi12_103). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaaytggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaawgrtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcwtcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX648548_X_P-A Feature FT:CDS KX648548_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Zi14_091). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX648549_X_P-A Feature FT:CDS KX648549_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Zi14_172). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX827293_X_P-A Feature FT:CDS KX827293_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate geno5.4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX827294_X_P-A Feature FT:CDS KX827294_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate geno6.2). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX827295_X_P-A Feature FT:CDS KX827295_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate geno6.3). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX827296_X_P-A Feature FT:CDS KX827296_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate geno6.5). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX827297_X_P-A Feature FT:CDS KX827297_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate geno9.1). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KX827298_X_P-A Feature FT:CDS KX827298_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate geno9.4). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgagcgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KY003230_X_P-A Feature FT:CDS KY003230_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 20160922). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KY382410_X_P-A Feature FT:CDS KY382410_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A2_wt). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|KY886219_X_P-A Feature FT:CDS KY886219_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|L13994_X_P-A Feature FT:CDS L13994_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atgggtgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctgtgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|LC051141_X_P-A Feature FT:CDS LC051141_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB14-0620). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggtctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagcggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccaccatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|LC074724_X_P-A Feature FT:CDS LC074724_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate p621). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|LC311241_X_P-A Feature FT:CDS LC311241_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate p509). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|LC311242_X_P-A Feature FT:CDS LC311242_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate p90). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|LC311243_X_P-A Feature FT:CDS LC311243_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate p121). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|LC430617_X_P-A Feature FT:CDS LC430617_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 78556-102). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|LC458430_X_P-A Feature FT:CDS LC458430_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JRC-HB01). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|LC458431_X_P-A Feature FT:CDS LC458431_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JRC-HB03). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|LC462120_X_P-A Feature FT:CDS LC462120_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccttgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|LT992441_X_P-A Feature FT:CDS LT992441_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DA195). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggattcttcgcgggacatcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggtttctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcacttcacctntgcacgttgcatggag
accaccgtgaacgcccatcaaatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|M57663_X_P-A Feature FT:CDS M57663_X_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atagctgctaggttgtactgccaactagattcttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttgggactgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccattatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF772344_X_P-A Feature FT:CDS MF772344_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate SV1662). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgagggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF772345_X_P-A Feature FT:CDS MF772345_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1959). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF772346_X_P-A Feature FT:CDS MF772346_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 855_16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccaaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttcacatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttgcataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF772347_X_P-A Feature FT:CDS MF772347_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 970). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaaagatttatgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaa
>gnl|hbvcds|MF772348_X_P-A Feature FT:CDS MF772348_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate SV120). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagatgaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF772349_X_P-A Feature FT:CDS MF772349_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate SV1840). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagancctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF772350_X_P-A Feature FT:CDS MF772350_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 64106). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaagcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF772351_X_P-A Feature FT:CDS MF772351_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1141). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatctgatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF772353_X_P-A Feature FT:CDS MF772353_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate SV580). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgcggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF925361_X_P-A Feature FT:CDS MF925361_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BD-HBV04). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttgcataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF925362_X_P-A Feature FT:CDS MF925362_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BD-HBV05). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttggggctctaccgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
accaccgtgaacgcccgmcagatcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagattaaaggtctttgtac
tgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF925368_X_P-A Feature FT:CDS MF925368_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BD-HBV12). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctttatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcgctgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagattaggttaaagatttttgtat
taggaggctgtaggcataaattggtctgcgcaccatcttcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF925372_X_P-A Feature FT:CDS MF925372_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BD-HBV16). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctctgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF925373_X_P-A Feature FT:CDS MF925373_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BD-HBV17). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgagggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccttcgcgaggccgcttgggactgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF925385_X_P-A Feature FT:CDS MF925385_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BD-HBV29). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF925400_X_P-A Feature FT:CDS MF925400_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BD-HBV46). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggatctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MF925407_X_P-A Feature FT:CDS MF925407_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BD-HBV54). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MH464808_X_P-A Feature FT:CDS MH464808_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA86). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcgg
acgacccctcacggggccgcttrggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccmtcagatcctgcccaaggtcttayataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgrtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcmtcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MH464809_X_P-A Feature FT:CDS MH464809_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA87). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgttccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagctatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtytwtgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MH464810_X_P-A Feature FT:CDS MH464810_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA88). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtatcgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcwccatcatcakgcaactttttcacctctgcctaa
>gnl|hbvcds|MH464811_X_P-A Feature FT:CDS MH464811_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA89). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtygcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaatgatttttgtat
taggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MH464812_X_P-A Feature FT:CDS MH464812_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA90). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtatcgtccgtccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcttcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MH464813_X_P-A Feature FT:CDS MH464813_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA91). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtatcgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MH464814_X_P-A Feature FT:CDS MH464814_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA92). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtatcgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaa
>gnl|hbvcds|MH464815_X_P-A Feature FT:CDS MH464815_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA93). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MH464817_X_P-A Feature FT:CDS MH464817_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA95). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgaggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MH464818_X_P-A Feature FT:CDS MH464818_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA96). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtatcgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MH464825_X_P-A Feature FT:CDS MH464825_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA103). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtatcatccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataaaaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccattctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MH464828_X_P-A Feature FT:CDS MH464828_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA106). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MH464830_X_P-A Feature FT:CDS MH464830_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA108). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtatcgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MH580627_X_P-A Feature FT:CDS MH580627_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 299). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggcctctttcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MH580639_X_P-A Feature FT:CDS MH580639_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 420). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggcctctttcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MH580642_X_P-A Feature FT:CDS MH580642_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 443). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggcctctttcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MH580643_X_P-A Feature FT:CDS MH580643_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 446). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggcctctttcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MH932713_X_P-A Feature FT:CDS MH932713_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Hiroshima GtA CL1). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MK512456_X_P-A Feature FT:CDS MK512456_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw3531). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtcggtgccttctcacctgccggtccgtgtgcacttcgagttacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcttgcccaaggtcttacataagaggactcttggactcccagcaatggcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatactcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MK512457_X_P-A Feature FT:CDS MK512457_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw3173). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatggtcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MK512458_X_P-A Feature FT:CDS MK512458_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw2244). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttgggactctatcgtccccttctccgtctaccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccaccagatcttgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaagatttatgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MK512459_X_P-A Feature FT:CDS MK512459_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw2226). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccaccagatcttgcccaaggtcttacataaaaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtgtttgtat
taggaggctgtaggcataaattggtgtgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MK512461_X_P-A Feature FT:CDS MK512461_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw2157). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcactcgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccaccaaatcctgcccaaggtcttacataagaggactcttggactcccagccatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcttgcaactttttcacctctgcctaa
>gnl|hbvcds|MK512462_X_P-A Feature FT:CDS MK512462_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw2113). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgcgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccgtcatcaagcaactttttcacctctgcctaa
>gnl|hbvcds|MK512463_X_P-A Feature FT:CDS MK512463_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw2086). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaatactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgctcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MK512464_X_P-A Feature FT:CDS MK512464_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw2016). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgttccgtcggctctgaatcccgcgg
acgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcacctgccggtccgtgtgcacttcgagtcacctctgcacgttgcatggag
accaccgtgaacgcccatcaggtcttgcccaaggtcttatataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggatgagattaggttaatggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MK512465_X_P-A Feature FT:CDS MK512465_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw2003). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttctcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttgggactttatcgtcctcttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaagtatctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MK512466_X_P-A Feature FT:CDS MK512466_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-226). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttccatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctatttat
taagaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MK512468_X_P-A Feature FT:CDS MK512468_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-203). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctcctaggttgttatgccaaccggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MK512469_X_P-A Feature FT:CDS MK512469_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-136). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactaccaacaggattcttcgctggacgtcctttgtttacgttccgtcggcgctgaatcccgcgc
ccgacccctccaggtgcctcctgggacaggatcgtccccttctccgtctgccataccgtcctatcacggggcacacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
cctggaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MK512470_X_P-A Feature FT:CDS MK512470_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-126). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcacgtcggcgctgaatcccgcgg
acgacccctccaggagacgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggatcgtgtgcacttcgattcacctctgcacgttgcatggcg
accaacgtgaacgcccatcagatcctgcccaaagtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MK512471_X_P-A Feature FT:CDS MK512471_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-120). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttctcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcgcgggggcgcttgggactctaccgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggctaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcttgcaactttttcacctctgcctaa
>gnl|hbvcds|MK512472_X_P-A Feature FT:CDS MK512472_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-65). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtgctgccaattggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctcccggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaagatttttgtat
taggaggctgtaggcataaattggtgtgcgcaccattctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MK512473_X_P-A Feature FT:CDS MK512473_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-48). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctcggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MK512474_X_P-A Feature FT:CDS MK512474_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-37). Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtttatgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MK512475_X_P-A Feature FT:CDS MK512475_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-25). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcccaaggtcttatataagagaactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaagatttatgtat
taggaggctgtaggcataaattggtttgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MK512476_X_P-A Feature FT:CDS MK512476_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-14). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaa
accaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaagatttatgtat
taggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MK512477_X_P-A Feature FT:CDS MK512477_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-03). Partial genome (Contains: HBx, SHBs, HBSP). [Hepadnaviridae] (length=465 residues).
atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctccaggggccgcttgggcctctatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctct
ctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacttctgcacgttgcatggaa
accaccgtgaacgcccatcagatcctgcgcaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccgtgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|MN507849_X_P-A Feature FT:CDS MN507849_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 2488_ocHBVa_GC). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcctaggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|MN544634_X_P-A Feature FT:CDS MN544634_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CG-0018a-01). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagcggactcttggactctcagcaatgtcaacgaccga
ccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagtttggggaggagactaggttaaagatttatgtat
taggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaa
>gnl|hbvcds|V00866_X_P-A Feature FT:CDS V00866_X_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|X02763_X_C-A Feature FT:CDS X02763_X_C-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcacaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|X51970_X_P-A Feature FT:CDS X51970_X_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=465 residues).
atggctactaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|X70185_X_P-A Feature FT:CDS X70185_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A938). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggagtctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|Z35717_X_P-A Feature FT:CDS Z35717_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate hb614). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcg
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
>gnl|hbvcds|Z72478_X_P-A Feature FT:CDS Z72478_X_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A317). Complete genome. [Hepadnaviridae] (length=465 residues).
atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgg
acgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctct
ctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggag
accaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccga
ccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggttaaaggtctttgtat
taggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaa
© 1998-2020Legal notice