HBVdb

Dataset for nucleotide sequence PreS2 of genotype A

[Download (right click)] [Alignment] [Repertoires]

1542 sequence(s)

>gnl|hbvcds|AB014370_PreS2_P-A Feature FT:CDS AB014370_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 11D11HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaaactctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB064314_PreS2_P-A Feature FT:CDS AB064314_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgggtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB076678_PreS2_P-A Feature FT:CDS AB076678_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala14). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctcgcacatctcgtcaacctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB076679_PreS2_P-A Feature FT:CDS AB076679_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala35). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaatttcacagctttccaacaagccctacaagatcccagagtcaggggcatatatcttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgt
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggttccacccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgcttgatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcctgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
taaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB076680_PreS2_P-A Feature FT:CDS AB076680_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala12). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagaggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatactgtctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacaactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB076681_PreS2_P-A Feature FT:CDS AB076681_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala15). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atacagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggacctgtgtcttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB076682_PreS2_P-A Feature FT:CDS AB076682_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala22). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaaatcttcaacaagccctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB076683_PreS2_P-A Feature FT:CDS AB076683_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala23). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccaaagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcagggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB076685_PreS2_P-A Feature FT:CDS AB076685_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala30). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggaccccwgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagagggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattgcaggatccacaacaaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttyccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB076686_PreS2_P-A Feature FT:CDS AB076686_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala9). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB076687_PreS2_P-A Feature FT:CDS AB076687_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagtttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcagaaacactcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgt
tgaacatggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagaatctagacttgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcagc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB076688_PreS2_P-A Feature FT:CDS AB076688_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala4). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB076689_PreS2_P-A Feature FT:CDS AB076689_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala8). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggcccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB076690_PreS2_P-A Feature FT:CDS AB076690_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala13). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaagggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggcccacccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB116076_PreS2_P-A Feature FT:CDS AB116076_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-USA1911). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
caaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcaaccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgcttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB116077_PreS2_P-A Feature FT:CDS AB116077_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-USA2126). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcatgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgtttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB116078_PreS2_P-A Feature FT:CDS AB116078_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-USA712). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB116079_PreS2_P-A Feature FT:CDS AB116079_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TR1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB116080_PreS2_P-A Feature FT:CDS AB116080_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TR2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB116081_PreS2_P-A Feature FT:CDS AB116081_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TR3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB116082_PreS2_P-A Feature FT:CDS AB116082_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaaactctgcaagataccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccgactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgc
cgaacatggagaacatcacatcaggactcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggcgaagtctgtacagcatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB116083_PreS2_P-A Feature FT:CDS AB116083_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN36). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagccctgcaagatcccagagtcaggggcctgtatattcctgctggtggctc
cagttcaggaactctcaaccctgttcccaatattgcctctcacatatcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgagtcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB116084_PreS2_P-A Feature FT:CDS AB116084_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN81). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagccctgcaagatcccagagtcaggggcctgtatattcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB116085_PreS2_P-A Feature FT:CDS AB116085_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN83). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctgtccaccaagctctgcaagatcccagagtcaggggcctgtatattcctgctggtggctc
cagttcaggaacactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggntcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaaccttctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagcacgggaccttgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
taaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagttattcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB116086_PreS2_P-A Feature FT:CDS AB116086_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-IND18). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgaagtggaattccacaactttccaccaagctctgcaagatcccagagtcaggagcctgtatcttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggcgaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB116087_PreS2_P-A Feature FT:CDS AB116087_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-IND8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaattccacagctttccaccaaactctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB116088_PreS2_P-A Feature FT:CDS AB116088_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-NEP30). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcac
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgggtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaayttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggttctgggggccaaatctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|AB116089_PreS2_P-A Feature FT:CDS AB116089_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-NEP39). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcgaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccacgtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB116090_PreS2_P-A Feature FT:CDS AB116090_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-NEP40). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB116091_PreS2_P-A Feature FT:CDS AB116091_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH1). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaattccacagcttttcgccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcntggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagcacgggaacctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB116092_PreS2_P-A Feature FT:CDS AB116092_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH20). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcac
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaagggaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttggggtttcg
caaaattcctatgggagtgggcctcagtccgtttctcttgtctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggcttttagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tacaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB116093_PreS2_P-A Feature FT:CDS AB116093_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH25). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaactttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacactcaaccctgttcccaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgtgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggccacccgtgtgtcntggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB116094_PreS2_P-A Feature FT:CDS AB116094_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcgccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagcacgggaacctgcagaacctgcacgactcctgctcaaggcaactc
tacgtttccctcatgttgctgtacaaaacctacgggtggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgcttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tatacctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB126580_PreS2_P-A Feature FT:CDS AB126580_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-RU204). Complete genome. [Hepadnaviridae] (length=846 residues).
aagcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaagacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaatccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB194950_PreS2_P-A Feature FT:CDS AB194950_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMR983). Complete genome. [Hepadnaviridae] (length=846 residues).
ataaagtggaattccccagctttccaccaagctctgcaagatcccagagtcaagggcctgtattttcctgctggtggctc
cagttcaggaacagtaagccctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB194951_PreS2_P-A Feature FT:CDS AB194951_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMR82). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaaatttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtcaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggggtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccattgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttggctttgggcatacatttaa
>gnl|hbvcds|AB194952_PreS2_P-A Feature FT:CDS AB194952_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMR711). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaaagttccaccaaactctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtcaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgc
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205118_PreS2_P-A Feature FT:CDS AB205118_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TJ1-1-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccctccaccaagctctgcaggaacccagagtcaggggtccgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacgtctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggaccaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB222707_PreS2_P-A Feature FT:CDS AB222707_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate UZTBV102). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctacttccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggcatacatttaa
>gnl|hbvcds|AB241114_PreS2_P-A Feature FT:CDS AB241114_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PhHCC01). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagaatcaggggcctgtattttcctgctggtggctc
cacttcaggaacagtcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB241115_PreS2_P-A Feature FT:CDS AB241115_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PhCH09). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaactttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctacttccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB246335_PreS2_P-A Feature FT:CDS AB246335_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagaatcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggakcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB246336_PreS2_P-A Feature FT:CDS AB246336_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcggtggaattccacaactttccaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgtctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|AB246337_PreS2_P-A Feature FT:CDS AB246337_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB246338_PreS2_P-A Feature FT:CDS AB246338_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB263406_PreS2_P-A Feature FT:CDS AB263406_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MonB04-023E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgg
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaactacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB300366_PreS2_P-A Feature FT:CDS AB300366_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB300367_PreS2_P-A Feature FT:CDS AB300367_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB362931_PreS2_P-A Feature FT:CDS AB362931_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcaaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB453979_PreS2_P-A Feature FT:CDS AB453979_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB453980_PreS2_P-A Feature FT:CDS AB453980_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB453981_PreS2_P-A Feature FT:CDS AB453981_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB453982_PreS2_P-A Feature FT:CDS AB453982_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB453983_PreS2_P-A Feature FT:CDS AB453983_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcaaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggcttttagctatatggatgatgtggtattgggggcgaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB453984_PreS2_P-A Feature FT:CDS AB453984_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB453986_PreS2_P-A Feature FT:CDS AB453986_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttccggaacactcaaccctgttccaactattgcctctcacatatcgtcaacctcctcgaggattggggaccctgcgg
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaccacccgtgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaaatctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB453987_PreS2_P-A Feature FT:CDS AB453987_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH9). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB453988_PreS2_P-A Feature FT:CDS AB453988_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH10). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaactttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
taaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccattgtttggctttcagctatatggatgatgtggtactgggggcaaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|AB453989_PreS2_P-A Feature FT:CDS AB453989_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaactttccaccaaactctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagagggggccaccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtgctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaaatctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB480036_PreS2_P-A Feature FT:CDS AB480036_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgcctttcaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB480038_PreS2_P-A Feature FT:CDS AB480038_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB480039_PreS2_P-A Feature FT:CDS AB480039_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB480040_PreS2_P-A Feature FT:CDS AB480040_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatyttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcktggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccattgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB480041_PreS2_P-A Feature FT:CDS AB480041_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcatgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB549213_PreS2_P-A Feature FT:CDS AB549213_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggcatacatttaa
>gnl|hbvcds|AB697487_PreS2_P-A Feature FT:CDS AB697487_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaatttcaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697488_PreS2_P-A Feature FT:CDS AB697488_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgnctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697489_PreS2_P-A Feature FT:CDS AB697489_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697491_PreS2_P-A Feature FT:CDS AB697491_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697492_PreS2_P-A Feature FT:CDS AB697492_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697493_PreS2_P-A Feature FT:CDS AB697493_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697495_PreS2_P-A Feature FT:CDS AB697495_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No10). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697496_PreS2_P-A Feature FT:CDS AB697496_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697497_PreS2_P-A Feature FT:CDS AB697497_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No14). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697498_PreS2_P-A Feature FT:CDS AB697498_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No15). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697499_PreS2_P-A Feature FT:CDS AB697499_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No16). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697501_PreS2_P-A Feature FT:CDS AB697501_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No19). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697503_PreS2_P-A Feature FT:CDS AB697503_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No22). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697504_PreS2_P-A Feature FT:CDS AB697504_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No23). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697505_PreS2_P-A Feature FT:CDS AB697505_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No25). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697506_PreS2_P-A Feature FT:CDS AB697506_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No28). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697507_PreS2_P-A Feature FT:CDS AB697507_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No29). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697508_PreS2_P-A Feature FT:CDS AB697508_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No31). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697509_PreS2_P-A Feature FT:CDS AB697509_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No32). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697511_PreS2_P-A Feature FT:CDS AB697511_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No36). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaatagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttrtcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgttaccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697512_PreS2_P-A Feature FT:CDS AB697512_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No37). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgtctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB775198_PreS2_P-A Feature FT:CDS AB775198_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB10-0707). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB775199_PreS2_P-A Feature FT:CDS AB775199_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB10-0708). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaarctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB775200_PreS2_P-A Feature FT:CDS AB775200_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB12-0925). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB775201_PreS2_P-A Feature FT:CDS AB775201_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB12-0929). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB786643_PreS2_P-A Feature FT:CDS AB786643_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20401). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=840 residues).
tggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttc
aggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaaca
tggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaca
ataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgca
gtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttta
tcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgt
cctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtt
tccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaat
acctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcc
cccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatacc
gctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786645_PreS2_P-A Feature FT:CDS AB786645_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20403). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=840 residues).
tggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttc
aggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatatcctcgaggactggggaccctgcgccgaaca
tggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaca
ataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgca
gtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttta
tcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgt
cctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtt
tccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaat
acctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcc
cccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatacc
gctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786646_PreS2_P-A Feature FT:CDS AB786646_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20404). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=840 residues).
tggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttc
aggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaaca
tggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaca
ataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgca
gtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttta
tcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgt
cctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtt
tccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaat
acctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcc
cccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatacc
gctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786647_PreS2_P-A Feature FT:CDS AB786647_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20405). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=840 residues).
tggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttc
aggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaaca
tggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaca
ataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgca
gtccccaacctccaatcactcaccaacctcctgtcctcaaatttgtcctggttatcgctggatgtgtctgcggcgtttta
tcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgt
cctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtt
tccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaat
acctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcc
cccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatacc
gctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786648_PreS2_P-A Feature FT:CDS AB786648_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20406). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=840 residues).
tggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttc
aggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaaca
tggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaca
ataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgca
gtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttta
tcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgt
cctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtt
tccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaat
acctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcc
cccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatacc
gctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786649_PreS2_P-A Feature FT:CDS AB786649_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20407). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=840 residues).
tggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttc
aggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaaca
tggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaca
ataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgca
gtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttta
tcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgt
cctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtt
tccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaat
acctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcc
cccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatacc
gctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786651_PreS2_P-A Feature FT:CDS AB786651_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20409). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=840 residues).
tggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttc
aggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgtgccgaaca
tggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaca
ataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgca
gtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttta
tcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgt
cctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtt
tccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaat
acctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcc
cccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatacc
gctgttaccaattttcttttgtctttgggtatacttttaa
>gnl|hbvcds|AB786652_PreS2_P-A Feature FT:CDS AB786652_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20410). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=840 residues).
tggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttc
aggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaaca
tggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaca
ataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgca
gtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttta
tcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgt
cctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtt
tccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaat
acctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcc
cccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatacc
gctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786654_PreS2_P-A Feature FT:CDS AB786654_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20412). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=840 residues).
tggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttc
aggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaaca
tggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaca
ataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgca
gtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttta
tcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgt
cctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtt
tccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaat
acctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcc
cccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatacc
gctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786655_PreS2_P-A Feature FT:CDS AB786655_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20413). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=840 residues).
tggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttc
aggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaaca
tggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaca
ataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgca
gtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttta
tcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgcccgtttgt
cctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtt
tccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaat
acctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcc
cccactgtttggcttttagctatatggatgatgtggtactgggggccaaatctgtacaacatcttgagtccctttatacc
gctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786656_PreS2_P-A Feature FT:CDS AB786656_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20417). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=840 residues).
tggaattccacggctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttc
aggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaaca
tggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaca
ataccgcagagtctagacttgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgca
gtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttta
tcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgcccgtttgt
cctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtt
tccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaat
acctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcc
cccactgtttggcttttagctatatggatgatgtggtactgggggccaaatctgtacaacatcttgagtccctttatacc
gctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786657_PreS2_P-A Feature FT:CDS AB786657_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20419). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=840 residues).
tggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttc
aggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaaca
tggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaca
ataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgca
gtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttta
tcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgt
cctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtt
tccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaat
acctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcc
cccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatacc
gctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786658_PreS2_P-A Feature FT:CDS AB786658_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20420). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=840 residues).
tggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttc
aggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaaca
tggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaca
ataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgca
gtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttta
tcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgt
cctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtt
tccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaat
acctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcc
cccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatacc
gctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786659_PreS2_P-A Feature FT:CDS AB786659_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20421). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=840 residues).
tggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttc
aggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgtcgaaca
tggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaca
ataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgca
gtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttta
tcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgt
cctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtt
tccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaat
acctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcc
cccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacc
gctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786660_PreS2_P-A Feature FT:CDS AB786660_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20422). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=840 residues).
tggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctccagttc
aggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaaca
tggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaca
ataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgca
gtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttta
tcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgt
cctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtt
tccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaat
acctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcc
cccactgtttggctttcagctatatggatgatgtggtactgggggcgaagtctgtacaacatcttgagtccctttatacc
gctgttaccaattttcttttgtctttgggtatacattaaa
>gnl|hbvcds|AB786661_PreS2_P-A Feature FT:CDS AB786661_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20425). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=840 residues).
tggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggtctgtattttcctgctggtggctccagttc
aggaacactcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgtcgaaca
tggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcaca
ataccgcagagtctagactcgtggtggacttctctcaattttctagggggcccagccgtgtgtcttggccaaaattcgca
gtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttta
tcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgt
cctctaattccaggatccacaaccaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactctatgtt
tccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaat
acctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcc
cccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacc
gctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786662_PreS2_P-A Feature FT:CDS AB786662_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20427). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=840 residues).
tggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttc
aggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaaca
tggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaca
ataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcttggccaaaattcgca
gtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttta
tcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgt
cctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtt
tccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaat
acctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcc
cccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatacc
gctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786663_PreS2_P-A Feature FT:CDS AB786663_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20429). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=840 residues).
tggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttc
aggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgtcgaaca
tggagaacatcacatccggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaca
ataccgcagagtctagactcgtggtggacttctctcaattttctagggggcccacccgtgtgtcttggccaaaattcgca
gttcccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttta
tcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgt
cctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtt
tccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaat
acctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcc
cccactgtttggctttcagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccctttatacc
gctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB937791_PreS2_P-A Feature FT:CDS AB937791_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB05-0890). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaactttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB937792_PreS2_P-A Feature FT:CDS AB937792_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1205). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB937793_PreS2_P-A Feature FT:CDS AB937793_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-0302). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB937794_PreS2_P-A Feature FT:CDS AB937794_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-0666). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB937795_PreS2_P-A Feature FT:CDS AB937795_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1191). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaccgctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcagggacactcaaccctgttccaaatattgcctctcacatctcatcaatctccttgaagactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctamttccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatrtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatwcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB937796_PreS2_P-A Feature FT:CDS AB937796_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1196). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaactttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB937797_PreS2_P-A Feature FT:CDS AB937797_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1204). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtatcttcctgctggtggctc
cagttcagamacagtaaaccctgctccgaatattgcctctcacatctcgtcamtctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcagggttcctaggaccccggctcgtgttacaggcggggttttycttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctcyaatttgtcytggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgccgctatgcctcatcttcttattggttcttctggattatcaaggtatattgccc
gtttgtcctctaattccaggatcaacakcaaacartacgggasgrtgcaaaayctgcacgaytcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatattgtattgggggccaaatctgtacagcatcgtgagtccctt
tatactgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB937798_PreS2_P-A Feature FT:CDS AB937798_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB14-0383). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcgaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF043560_PreS2_P-A Feature FT:CDS AF043560_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF043580_PreS2_P-A Feature FT:CDS AF043580_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF090838_PreS2_P-A Feature FT:CDS AF090838_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaagaccccaaagtcaggggtctgtattttcctgctggtggctc
cagttcagaaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF090839_PreS2_P-A Feature FT:CDS AF090839_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagccctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF090840_PreS2_P-A Feature FT:CDS AF090840_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF090841_PreS2_P-A Feature FT:CDS AF090841_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagttctgcaagaccccagagtcaggggtctgtattttcctgctggtggctt
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF090842_PreS2_P-A Feature FT:CDS AF090842_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgtgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacagcatcttgagtccctt
tataccggtgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF143298_PreS2_P-A Feature FT:CDS AF143298_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBx, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgactattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgttgccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF143302_PreS2_P-A Feature FT:CDS AF143302_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=840 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgcccgctggtggctccagttc
aggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaaca
tggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaca
ataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgca
gtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttta
tcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgt
cctctaattccaggatcaacaacaaccagtacgggaccgtgcaaaacctgcacgactcctgctcaaggcaactctatgtt
tccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaat
acctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcc
cccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatacc
gctgtgaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF297621_PreS2_P-A Feature FT:CDS AF297621_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 78). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtaaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctctcatctcgtcaatctcctcgacgactggggaccctgtgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagttccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccactgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF297622_PreS2_P-A Feature FT:CDS AF297622_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 79). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttgcaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatagagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttagtaggg
atttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF297624_PreS2_P-A Feature FT:CDS AF297624_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 80). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF297625_PreS2_P-A Feature FT:CDS AF297625_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 84). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttgcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttcccaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgt
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtacccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF536524_PreS2_P-A Feature FT:CDS AF536524_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccctccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaagacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtattcatttaa
>gnl|hbvcds|AF537371_PreS2_P-A Feature FT:CDS AF537371_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacggaaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcaccgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF537372_PreS2_P-A Feature FT:CDS AF537372_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgagaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaatgccaggatcaacgacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tacgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AJ012207_PreS2_P-A Feature FT:CDS AJ012207_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctacaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AJ309369_PreS2_P-A Feature FT:CDS AJ309369_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient X104). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagcactgcaggatcccagagtcaggggtccgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctaggctcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccggtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AJ309370_PreS2_P-A Feature FT:CDS AJ309370_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient X104). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagcactgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggc
gttttaccatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AJ309371_PreS2_P-A Feature FT:CDS AJ309371_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient X104). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagcactgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AJ344115_PreS2_P-A Feature FT:CDS AJ344115_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBsAg negative patient X27). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaagacccctgctcgggttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
attttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctcaaactacaagatcaacaacaaccagtacgggatcatgcaaaacctgcacgattcctgctcgcggcaaatc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caagctacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AJ627226_PreS2_P-A Feature FT:CDS AJ627226_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 20952). Non-functional genomic sequence. [Hepadnaviridae] (length=837 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcagggatcctgctggtggctccagttcagg
aacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatgg
agaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaata
ccgcagagtctagactcgtggtggacttctctcaattttctaggggggccacccgtgtgtcttggccaaaattcgcagtc
cccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatca
tattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcct
ctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttcc
ctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacc
tatgggagtgggcctcagtccgtttctcttggctcaatttactagtgccatttgttcagtggttcgtagggctttccccc
actgtttggcttttagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgct
gtaaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AJ627227_PreS2_P-A Feature FT:CDS AJ627227_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 21077). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccaaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcataataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaycaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggwccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagytatatggatgatgtggtmttggggaccagatctgtacagcatcgtgaggccctt
twtaccgctgttaccaattttcttttgtctctgggtatacatataa
>gnl|hbvcds|AM180624_PreS2_P-A Feature FT:CDS AM180624_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CAE168). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaagccctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaaaacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcarggtatgttgcyc
gtttgtcctctaattccaggatccamaaccaccagtacgggaccctgcagaacctgcacgactcctgcacaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AM184125_PreS2_P-A Feature FT:CDS AM184125_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate O64). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaagaacagtaagccctgttcagaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgcacaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM184126_PreS2_P-A Feature FT:CDS AM184126_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N35). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctacaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaagccctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgcacaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctatacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AM282986_PreS2_P-A Feature FT:CDS AM282986_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaatatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggaacaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaaccttcggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AM295795_PreS2_P-A Feature FT:CDS AM295795_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AM295797_PreS2_P-A Feature FT:CDS AM295797_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AM295798_PreS2_P-A Feature FT:CDS AM295798_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AM295799_PreS2_P-A Feature FT:CDS AM295799_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AM410963_PreS2_P-A Feature FT:CDS AM410963_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AM494718_PreS2_P-A Feature FT:CDS AM494718_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CAR204). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggrgtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY034878_PreS2_P-A Feature FT:CDS AY034878_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBVKL). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctcaaatttgtcctgggtatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatattgatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY128092_PreS2_P-A Feature FT:CDS AY128092_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY152726_PreS2_P-A Feature FT:CDS AY152726_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 8.22). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctcagaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctagaacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaatgccaggatcaacaacaacaagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tacgttgccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgaggccctt
tataccgctgttactaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY161138_PreS2_P-A Feature FT:CDS AY161138_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=849 residues).
atgcagtggaattccacaactttccaccaagctctacaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctggtgctatgcctcatcttcttattggttcttctggattatcaaggtatgttg
ctcgtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaa
ctctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctt
tcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgta
gggctttcccccactgtttggctttcagctatgtggatgatctggtactgggggccaagtctgtacaacatcttgagtcc
ctttataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY161139_PreS2_P-A Feature FT:CDS AY161139_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaactttccaccaagctctacaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatctggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY230117_PreS2_P-A Feature FT:CDS AY230117_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccatcaagctttgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctactcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggaagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctgcaatcactcaccaacctcctgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcct
gtttgtcctctaattccaggatcaacaactaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccatcatgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatttggtattgggggccaaatctgtgcaacatcgtgaggccctt
tataccgctgttatcaattttctgttgtctctgggtatacatttaa
>gnl|hbvcds|AY230118_PreS2_P-A Feature FT:CDS AY230118_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgccccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggaagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctgcaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccatcatgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatttggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY232836_PreS2_P-A Feature FT:CDS AY232836_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgtggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggaagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctgcaatcactcaccaacctcctgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcctgttgctgtacgaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatttggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttacaaattttctgttgtctctgggtattcatttaa
>gnl|hbvcds|AY232837_PreS2_P-A Feature FT:CDS AY232837_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggaagcacacgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcactggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggaatatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatttggtattgggggccaaatctgttcagcatcgcgaggccctg
tataccgctgttaccaattttcttatgtccctgggtatacatttaa
>gnl|hbvcds|AY232838_PreS2_P-A Feature FT:CDS AY232838_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgtggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggaagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctgcaatcactcaccaacctcctgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcctgttgctgtacgaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatttggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttacaaattttctgttgtctctgggtattcatttaa
>gnl|hbvcds|AY232839_PreS2_P-A Feature FT:CDS AY232839_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggaagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctgcaatcactcaccaacctcctgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcctgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatttggtattgggggccaagtctgtacagcatcgtgtgtccctt
tacaccgctgttacaaattttctgttgtctctgggtattcatttaa
>gnl|hbvcds|AY232840_PreS2_P-A Feature FT:CDS AY232840_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggaagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctgcaatcactcaccaacctcctgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcctgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatttggtattgggggccaagtctgtacagcatcgtgagtccctt
tacaccgctgttacaaattttctgttgtctctgggtattcatttaa
>gnl|hbvcds|AY233274_PreS2_P-A Feature FT:CDS AY233274_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 0962). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatactgcctctcacatctcgccaatctcctcgaggactggggaccctgcgt
ggaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaatttcctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233275_PreS2_P-A Feature FT:CDS AY233275_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 163). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacacacaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaagactggggaccctgcgt
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatctacaacaacgagtacgggaccttgcaagacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233276_PreS2_P-A Feature FT:CDS AY233276_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1839). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcatctcacatctcgtcaatctcctcgaggactggggaccctgcgc
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccagggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233278_PreS2_P-A Feature FT:CDS AY233278_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttcaaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233279_PreS2_P-A Feature FT:CDS AY233279_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 28). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcatctcacatctcgtcaatctcctcgaggactggggaccctgcgc
tgaacatggagaacatcacatcaggattcctagggcccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233280_PreS2_P-A Feature FT:CDS AY233280_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgcgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY233281_PreS2_P-A Feature FT:CDS AY233281_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 303). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacacacaaccctgttccaaatattgcctctcacatctcgccaatctcctcgaagactggggaccctgcgt
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatctacaacaacgagtacgggaccttgcaagacctgcacgactcctgctcaaaacaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233282_PreS2_P-A Feature FT:CDS AY233282_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 306). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaatactcaaccctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgt
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttgtcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatattgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233283_PreS2_P-A Feature FT:CDS AY233283_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4038). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatactgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgt
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233284_PreS2_P-A Feature FT:CDS AY233284_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 5283). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacacacaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaagactggggaccctgcgt
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggcacacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatctacaacaacgagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233285_PreS2_P-A Feature FT:CDS AY233285_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 795). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaatcccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaccactcaaccctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgt
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccccgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233286_PreS2_P-A Feature FT:CDS AY233286_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 818). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaagacccctgctcgggttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgccc
gtttgtcctctacttccaggatcaacaacaaccagtacggggccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaacacctacggatggaaattgcacctgtattcccatcccatcgtcctggactttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccgctgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY233287_PreS2_P-A Feature FT:CDS AY233287_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 8225). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcatctcacatctcgtcaatctcctcgaggattggggaccctgcgc
tgaacatggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcccgtcctccaatttgtcctggttatcgcgggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggtctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgcttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233288_PreS2_P-A Feature FT:CDS AY233288_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 823). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctttcacatctcgtcaatctcctcgaggattggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233289_PreS2_P-A Feature FT:CDS AY233289_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 833). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaatactcaaccctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgt
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctactgctatgcctcatcttcttattggttcttctggattaccagggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233290_PreS2_P-A Feature FT:CDS AY233290_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 85). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaccgctttccaccaagctctgcaagatcccagagtcaggggcctgtatttccctgctggtggctc
cagttcaggaatactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgacgactggggaccctgtgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagacttgtggtggacttctctcaattttccagggggcccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccaccatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacaccttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY373428_PreS2_P-A Feature FT:CDS AY373428_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaactttccaccaagctctacaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttacttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY373429_PreS2_P-A Feature FT:CDS AY373429_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaactactgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgc
cgaacatggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcaggtatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AY373432_PreS2_P-A Feature FT:CDS AY373432_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcagaatcccaaagacaggggtctgtatcttcctgctggtggctc
cagttcaggaacactcaaccctgttccaactattgcctctcacatatcgtcaatctcctcgaggattggggaccctgcga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AY707087_PreS2_P-A Feature FT:CDS AY707087_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-N10). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaatatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggaacaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaaccttcggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY738139_PreS2_P-A Feature FT:CDS AY738139_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacattaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttggcc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagttggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttactaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY738140_PreS2_P-A Feature FT:CDS AY738140_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtcttttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacattacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattctcaaagtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagttggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttactaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY738141_PreS2_P-A Feature FT:CDS AY738141_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtcttttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacattacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattctcaaaatatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagttggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttactaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY738142_PreS2_P-A Feature FT:CDS AY738142_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtcttttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacattacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattctcaaagtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagttggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ccttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttactaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY738143_PreS2_P-A Feature FT:CDS AY738143_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacattaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttggcc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagttggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttactaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY862867_PreS2_P-A Feature FT:CDS AY862867_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H4-zhus). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggttc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY862868_PreS2_P-A Feature FT:CDS AY862868_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H4-zhus). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY902775_PreS2_P-A Feature FT:CDS AY902775_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MTB162). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY903452_PreS2_P-A Feature FT:CDS AY903452_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaaattgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY934763_PreS2_P-A Feature FT:CDS AY934763_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ik3346). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacggggccttgcagaagctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcatgggctttcg
gaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY934764_PreS2_P-A Feature FT:CDS AY934764_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9210699). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaatagtaaaccctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcatgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtatgg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AY934765_PreS2_P-A Feature FT:CDS AY934765_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 24306). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaatactcaaccctgttccaaatattgcctcgcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caagatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY934766_PreS2_P-A Feature FT:CDS AY934766_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 24233). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgg
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggctcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY934767_PreS2_P-A Feature FT:CDS AY934767_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 27178). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaatactcaaccctgttcccaatattgcctcgcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY934768_PreS2_P-A Feature FT:CDS AY934768_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 25830). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaatactcaaccctgttccaaatattgcctcgcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtactggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatggttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY934769_PreS2_P-A Feature FT:CDS AY934769_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 23719). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaatactcaaccctgttccaaatattgcctcgcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY934770_PreS2_P-A Feature FT:CDS AY934770_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 953642). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaatactcaaccctgttccaagtattgcctcgcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY934771_PreS2_P-A Feature FT:CDS AY934771_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 27439). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctacaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaatacctcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattrtcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY934772_PreS2_P-A Feature FT:CDS AY934772_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1908). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggcccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctgattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
taaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY934773_PreS2_P-A Feature FT:CDS AY934773_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9414346). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgt
cgaacatggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttrtcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY934774_PreS2_P-A Feature FT:CDS AY934774_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9615549). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ020002_PreS2_P-A Feature FT:CDS DQ020002_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 380). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaggatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ020003_PreS2_P-A Feature FT:CDS DQ020003_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 5780). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ131121_PreS2_P-A Feature FT:CDS DQ131121_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate M-A). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctagtacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ298161_PreS2_P-A Feature FT:CDS DQ298161_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccattgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
cccacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggaagcacccgtgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctgctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccatcatgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatttggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ298162_PreS2_P-A Feature FT:CDS DQ298162_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcagggctcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggaagcacacgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcct
gtttgtcctctaattccaggatcaacaactaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccatcatgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatttggtattgggggccaaatctgtgcaacatcgtgaggccctt
tataccgctgttatcaattttctgttgtctctgggtatacatttaa
>gnl|hbvcds|DQ298163_PreS2_P-A Feature FT:CDS DQ298163_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggaagcacacgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcctgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatttggtattgggggccaagtctgtacagcatcgtgagtccctt
tacaccgctgttacaaattttctgttgtctctgggtattcatttaa
>gnl|hbvcds|DQ298164_PreS2_P-A Feature FT:CDS DQ298164_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtga
ggaacatggagaacatcacatcaggactcctaggacccctactcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggaagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctgcaatcactcaccaacctcctgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcctgttgctgtacgaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatttggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttacaaattttctgttgtctctgggtattcatttaa
>gnl|hbvcds|DQ298165_PreS2_P-A Feature FT:CDS DQ298165_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggactcctaggacccctactcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggaagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacccgcaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcctgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatttggtattgggggccaagtctgtacagcatcgtgtgtccctt
tacaccgctgttacaaattttctgttgtctctgggtattcatttaa
>gnl|hbvcds|DQ315784_PreS2_P-A Feature FT:CDS DQ315784_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EI03101). Non-functional genomic sequence. [Hepadnaviridae] (length=843 residues).
atgcagtgttccacagctttccaccaagctctgcaagatgttagaaacagggccctgaatcttcctgctggtggctccag
ttcaggaacactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgccga
acatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctc
acaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattc
gcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtt
ttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtt
tgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctat
gtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaa
aatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctt
tcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttat
accgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ315785_PreS2_P-A Feature FT:CDS DQ315785_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EI0386). Non-functional genomic sequence. [Hepadnaviridae] (length=843 residues).
atgcagtgttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctccag
ttcaggaacactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgccga
acatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctc
acaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattc
gcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtt
ttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtt
tgtcctctaattccaggatcaacaacaaccagcacgggaccttgcaaaacctgcacgactcctgctcaaggcaactctat
gtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaa
aatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctt
tcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttat
accgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ315786_PreS2_P-A Feature FT:CDS DQ315786_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EI057). Non-functional genomic sequence. [Hepadnaviridae] (length=843 residues).
atgcagtgttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctccag
ttcagggactctcaaccctgttcccaatattgcctctcacatatcgtcaatctcctcgaggactggggaccctgcgccga
acatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctc
acaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattc
gcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctcgatgtgtctgcggcgtt
ttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtt
tgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctat
gtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaa
aatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctt
tcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttat
accgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ788725_PreS2_P-A Feature FT:CDS DQ788725_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate serum 07/92). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccgtccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgccccatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ788728_PreS2_P-A Feature FT:CDS DQ788728_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate serum 05/96). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=840 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgcctgctggtggctccagttc
aggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaaca
tggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaca
ataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgca
gtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcatttta
tcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgt
cctctaattccaggatcaacaacaaccagtacgggaccgtgcaaaacctgcacgactcctgctcaaggcaactctatgtt
tccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaat
acctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcc
cccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatacc
gctgtgaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EF103278_PreS2_P-A Feature FT:CDS EF103278_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ran60). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaaactctgcaagatcccagagtcaggggcctgtattctcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctcgcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgcagctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtctctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtcactt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF208113_PreS2_P-A Feature FT:CDS EF208113_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient B, serum 05/93). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
attttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcaccgtgagtccctt
tatactgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU054331_PreS2_C-A Feature FT:CDS EU054331_PreS2_C-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctacaagatcccagagtcaggggcctgtattttcctgcggggtgctc
cagttcaggaacagtaagccctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgcacaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcggtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU086721_PreS2_P-A Feature FT:CDS EU086721_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HRO/w4601-2002). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU159676_PreS2_P-A Feature FT:CDS EU159676_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Irish-1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU185786_PreS2_P-A Feature FT:CDS EU185786_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU11). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttcctccaagytctsgaggrtccctgagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgsctctcacatctcgtcwatctccgmgaggactggggaccctgtga
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagaatctagactcgtggtggacttctctcaattttctagggggakcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattgggtcctctggattatcaaggtattttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtasaawacctacggatgraarttgcacctgtaywscsrtcccatcgtcctgggcttkcg
caaaatacctatgggagtggggctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattskgggccaagtctgtacagcatcgtgagtmcctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU185787_PreS2_P-A Feature FT:CDS EU185787_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccmmagaatctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattgggtcttctggattatcaaggtattttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaarttgcacctgtaywscsatcccatcgtcctgggcttkcg
caaaatacctatgggagtggggctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtasagcatcgtgagtmcctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU185788_PreS2_P-A Feature FT:CDS EU185788_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU19). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagartctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattgggtcttctggattatcaaggtattttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaarttgcacctgtaywscsatcccatcgtcctgggcttkcg
caaaatacctatgggagtggggctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtmcstt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU185789_PreS2_P-A Feature FT:CDS EU185789_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactgkggaccctgtga
cgaacatggagaacatyayatcaggactcctaggacccctgctygtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagaatctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattgggtcttctggattatcaaggtattttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaarttgcacctgtaywscsrtcccatcgtcctgggcttkcg
caaaatacctatgggagtggggctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtmcctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU304331_PreS2_P-A Feature FT:CDS EU304331_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA84). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atacaatggaattccacagttttccaccaagctctgaaagatcccagagtcaggggactgtattttcctgctggtggctc
cagttcagaaacactcaaccctgttccmaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaaatctgtacaacatcttgagtccctt
tatgcckctgttacnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
>gnl|hbvcds|EU366129_PreS2_P-A Feature FT:CDS EU366129_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA92). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagccctgcaagatcccagagtaaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctkgatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagcgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaaatctgctcaacaccttgaagccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU410082_PreS2_P-A Feature FT:CDS EU410082_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ph81). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414132_PreS2_P-A Feature FT:CDS EU414132_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU414133_PreS2_P-A Feature FT:CDS EU414133_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU594383_PreS2_P-A Feature FT:CDS EU594383_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctacaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttctgtctctgggtatacatttaa
>gnl|hbvcds|EU594384_PreS2_P-A Feature FT:CDS EU594384_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU594385_PreS2_P-A Feature FT:CDS EU594385_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagctatatggatgatatggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU594386_PreS2_P-A Feature FT:CDS EU594386_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggtttttctggattatcaaggtatgttgccc
gtttgtcctataattccaggatcaacaacaaccagtacgggaccatgcaaaacatgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU594387_PreS2_P-A Feature FT:CDS EU594387_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU594388_PreS2_P-A Feature FT:CDS EU594388_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU594389_PreS2_P-A Feature FT:CDS EU594389_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU594390_PreS2_P-A Feature FT:CDS EU594390_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU594391_PreS2_P-A Feature FT:CDS EU594391_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattctctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU594392_PreS2_P-A Feature FT:CDS EU594392_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU594393_PreS2_P-A Feature FT:CDS EU594393_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatccaagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU594394_PreS2_P-A Feature FT:CDS EU594394_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU594395_PreS2_P-A Feature FT:CDS EU594395_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU747320_PreS2_P-A Feature FT:CDS EU747320_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate V51). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctatatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagattctagactcgtggtggaattctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859898_PreS2_P-A Feature FT:CDS EU859898_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P45). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859899_PreS2_P-A Feature FT:CDS EU859899_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P44). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859900_PreS2_P-A Feature FT:CDS EU859900_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P42). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaaggggatcacccgtgtgtcttgggcaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859901_PreS2_P-A Feature FT:CDS EU859901_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P37). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859902_PreS2_P-A Feature FT:CDS EU859902_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P32). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859903_PreS2_P-A Feature FT:CDS EU859903_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P40). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859904_PreS2_P-A Feature FT:CDS EU859904_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P39). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859905_PreS2_P-A Feature FT:CDS EU859905_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P38). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859906_PreS2_P-A Feature FT:CDS EU859906_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P30). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859907_PreS2_P-A Feature FT:CDS EU859907_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P29). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggatctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctgggtatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859908_PreS2_P-A Feature FT:CDS EU859908_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P28). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859909_PreS2_P-A Feature FT:CDS EU859909_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P31). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859910_PreS2_P-A Feature FT:CDS EU859910_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P27). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859911_PreS2_P-A Feature FT:CDS EU859911_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P26). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859912_PreS2_P-A Feature FT:CDS EU859912_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P23). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859913_PreS2_P-A Feature FT:CDS EU859913_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P24). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859914_PreS2_P-A Feature FT:CDS EU859914_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P20). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859915_PreS2_P-A Feature FT:CDS EU859915_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P07). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859916_PreS2_P-A Feature FT:CDS EU859916_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P03). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859917_PreS2_P-A Feature FT:CDS EU859917_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P13). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859918_PreS2_P-A Feature FT:CDS EU859918_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P17). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859919_PreS2_P-A Feature FT:CDS EU859919_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P19). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859920_PreS2_P-A Feature FT:CDS EU859920_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P21). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859921_PreS2_P-A Feature FT:CDS EU859921_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P08). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaaccttcaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859922_PreS2_P-A Feature FT:CDS EU859922_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P09). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859923_PreS2_P-A Feature FT:CDS EU859923_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P15). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgcctttcaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859924_PreS2_P-A Feature FT:CDS EU859924_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P16). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859925_PreS2_P-A Feature FT:CDS EU859925_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P22). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859926_PreS2_P-A Feature FT:CDS EU859926_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P06). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859927_PreS2_P-A Feature FT:CDS EU859927_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P25). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859928_PreS2_P-A Feature FT:CDS EU859928_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P01). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859929_PreS2_P-A Feature FT:CDS EU859929_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P43). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859930_PreS2_P-A Feature FT:CDS EU859930_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C126). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859931_PreS2_P-A Feature FT:CDS EU859931_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C96). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859932_PreS2_P-A Feature FT:CDS EU859932_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C69). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859933_PreS2_P-A Feature FT:CDS EU859933_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C67). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859934_PreS2_P-A Feature FT:CDS EU859934_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C60). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatgcaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859935_PreS2_P-A Feature FT:CDS EU859935_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C14). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859936_PreS2_P-A Feature FT:CDS EU859936_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C10). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859937_PreS2_P-A Feature FT:CDS EU859937_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C40). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859938_PreS2_P-A Feature FT:CDS EU859938_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C133). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccacgtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859939_PreS2_P-A Feature FT:CDS EU859939_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C130). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctacaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccacgtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859940_PreS2_P-A Feature FT:CDS EU859940_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C122). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859941_PreS2_P-A Feature FT:CDS EU859941_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C153). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859942_PreS2_P-A Feature FT:CDS EU859942_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C110). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859943_PreS2_P-A Feature FT:CDS EU859943_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C109). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtca
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859944_PreS2_P-A Feature FT:CDS EU859944_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C105). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctacaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859945_PreS2_P-A Feature FT:CDS EU859945_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C102). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU859946_PreS2_P-A Feature FT:CDS EU859946_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C155). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859947_PreS2_P-A Feature FT:CDS EU859947_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C85). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctacttccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859948_PreS2_P-A Feature FT:CDS EU859948_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C151). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859949_PreS2_P-A Feature FT:CDS EU859949_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C152). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859950_PreS2_P-A Feature FT:CDS EU859950_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C64). Non-functional genomic sequence. [Hepadnaviridae] (length=840 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtcttcctgctggtggctccagttc
aggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaaca
tggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaca
ataccgcagagtctaaactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaagattcgca
gtccccaacctccaatcactcaccaacctcctgtcctcgaatttgtcctggttatcgctggatgtgtctgcggcgtttta
tcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgt
cctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtt
tccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaat
acctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcc
cccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatacc
gctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859951_PreS2_P-A Feature FT:CDS EU859951_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C62). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859952_PreS2_P-A Feature FT:CDS EU859952_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C56). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaaccttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgtac
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctcgactcgtggtggacttctctcaattttctagggggatcacccgcgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggaaccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctattaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|EU859953_PreS2_P-A Feature FT:CDS EU859953_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C55). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttctcattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859954_PreS2_P-A Feature FT:CDS EU859954_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C42). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859955_PreS2_P-A Feature FT:CDS EU859955_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C39). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaagctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859956_PreS2_P-A Feature FT:CDS EU859956_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C35). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaagctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ349224_PreS2_P-A Feature FT:CDS FJ349224_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H71). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ349296_PreS2_P-A Feature FT:CDS FJ349296_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctacaagatcccagagtcaggggcctgtattttcctgctggtgggtc
cagttcaggaacagtcagccctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692554_PreS2_P-A Feature FT:CDS FJ692554_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_24063). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaaactctacaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgctc
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcaaaagctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctctgggcatacatttaa
>gnl|hbvcds|FJ692557_PreS2_P-A Feature FT:CDS FJ692557_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48004). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692558_PreS2_P-A Feature FT:CDS FJ692558_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48008). Complete genome. [Hepadnaviridae] (length=846 residues).
ctgmagtggaattccacagctttacacmaaactcagcaagatcccagagtcaggggcctrtatttccctgctggtggctc
cagttcaggaacactcaaccctgttccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgcgc
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcctgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggttctgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttascaattttcttttrtctttgggtatacatttaa
>gnl|hbvcds|FJ692559_PreS2_P-A Feature FT:CDS FJ692559_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48032). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcaaccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692561_PreS2_P-A Feature FT:CDS FJ692561_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48040). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaactttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggccacacgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaaatctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692562_PreS2_P-A Feature FT:CDS FJ692562_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48044). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaaaaatactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggycacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctkgatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgaatccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692563_PreS2_P-A Feature FT:CDS FJ692563_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48049). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttctkttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692564_PreS2_P-A Feature FT:CDS FJ692564_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48074). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaactttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692565_PreS2_P-A Feature FT:CDS FJ692565_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48077). Complete genome. [Hepadnaviridae] (length=846 residues).
atrcagtggaattccacaactttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggwccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatwcatttaa
>gnl|hbvcds|FJ692566_PreS2_P-A Feature FT:CDS FJ692566_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48090). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccacatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692567_PreS2_P-A Feature FT:CDS FJ692567_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48113). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacractttccaycaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctgggtatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtgtggctttcagctatatggatgatgtggtactgggggccaartctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692571_PreS2_P-A Feature FT:CDS FJ692571_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50011). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692572_PreS2_P-A Feature FT:CDS FJ692572_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50013). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatryttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692574_PreS2_P-A Feature FT:CDS FJ692574_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50015). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692575_PreS2_P-A Feature FT:CDS FJ692575_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50020). Complete genome. [Hepadnaviridae] (length=846 residues).
rtgcagtggaattccacagctttccaccaagctctgcaagatcccaaagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggawcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattrtcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatwcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccaytgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacaycttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692576_PreS2_P-A Feature FT:CDS FJ692576_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50022). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaaytccacagctttccaccaarctctgcaagatcccagartcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
tgaatatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaaaactgtacaacatcttgagtccctt
tatactgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692577_PreS2_P-A Feature FT:CDS FJ692577_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50024). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaagactgwacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692578_PreS2_P-A Feature FT:CDS FJ692578_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50083). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692579_PreS2_P-A Feature FT:CDS FJ692579_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50084). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692580_PreS2_P-A Feature FT:CDS FJ692580_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50085). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692581_PreS2_P-A Feature FT:CDS FJ692581_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50086). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692582_PreS2_P-A Feature FT:CDS FJ692582_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50088). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692583_PreS2_P-A Feature FT:CDS FJ692583_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50089). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692584_PreS2_P-A Feature FT:CDS FJ692584_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50090). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692585_PreS2_P-A Feature FT:CDS FJ692585_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50091). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692587_PreS2_P-A Feature FT:CDS FJ692587_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50115). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgt
tgaacatggagaacatcacatcaggattcccaggacccctgctcgagttacaggcggggtytttcttgtggacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggcccacccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgyttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692588_PreS2_P-A Feature FT:CDS FJ692588_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50119). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaactttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacaactcgtcaatctcctcgaggattggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692590_PreS2_P-A Feature FT:CDS FJ692590_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50152). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaactttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692591_PreS2_P-A Feature FT:CDS FJ692591_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50167). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacarctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692592_PreS2_P-A Feature FT:CDS FJ692592_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50175). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaggatccaaaagtcagggccctgtattttcctgctggtggctc
cagttcaggaacgctcaaccctgttccmaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgt
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaawttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccagggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccwcgtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692593_PreS2_P-A Feature FT:CDS FJ692593_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48054). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaaratcccaaagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcgcatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgcwcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
cttttccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgccgtaaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692595_PreS2_P-A Feature FT:CDS FJ692595_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48093). Complete genome. [Hepadnaviridae] (length=846 residues).
atrcagtggaattccacagctttccaccamgctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692596_PreS2_P-A Feature FT:CDS FJ692596_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48103). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacwgctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692597_PreS2_P-A Feature FT:CDS FJ692597_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48125). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagckttccaccaagctytgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692598_PreS2_P-A Feature FT:CDS FJ692598_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50018). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcatctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaatacctcagagtctagacttgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccrayttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaycarggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctrttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692599_PreS2_P-A Feature FT:CDS FJ692599_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50033). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagcgctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
agaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccmtttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692600_PreS2_P-A Feature FT:CDS FJ692600_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50034). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatyacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
yaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692601_PreS2_P-A Feature FT:CDS FJ692601_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50035). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692602_PreS2_P-A Feature FT:CDS FJ692602_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50041). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692603_PreS2_P-A Feature FT:CDS FJ692603_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50050). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaarctctgcaagatcccagagtcaggarcctgtgtcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcmtcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggttgacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcactactcctgctcaaggcaactc
tatgtttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692604_PreS2_P-A Feature FT:CDS FJ692604_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50052). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagcyctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtraaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692605_PreS2_P-A Feature FT:CDS FJ692605_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50059). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaarctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatcttgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttckaggggratctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagwctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692606_PreS2_P-A Feature FT:CDS FJ692606_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50061). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaattccccagttttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattccyargacccccgctcgtgttacaggcggggtctttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtatctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccamcagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692607_PreS2_P-A Feature FT:CDS FJ692607_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50068). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
agaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttytatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692608_PreS2_P-A Feature FT:CDS FJ692608_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50075). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaattccacagctttccaccaagctctgcaagatcccagggtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacacctcgtcaatctcctcgaggactggggaccctgtac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692609_PreS2_P-A Feature FT:CDS FJ692609_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50098). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggatccctaggacccctgctcgtgttacaggcggggtttttcttgtggacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtaccaaacctatggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692610_PreS2_P-A Feature FT:CDS FJ692610_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50104). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaycaarmtctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggatccctaggacccctgctcgtgttacaggcggggtttttcttgtggacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtaccaaacctatggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692611_PreS2_P-A Feature FT:CDS FJ692611_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50127). Complete genome. [Hepadnaviridae] (length=846 residues).
ayacagtggaattccacagctttccaccaagctctgcaagatcccacagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgataagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692612_PreS2_P-A Feature FT:CDS FJ692612_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50132). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagcgctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
agaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatwcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctctgggyatacatttaa
>gnl|hbvcds|FJ692613_PreS2_P-A Feature FT:CDS FJ692613_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50156). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaarccctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatattaccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcgtgaggccctt
tatgccgctgttaccaattttcttttgtctctgggcatacatttaa
>gnl|hbvcds|FM199974_PreS2_P-A Feature FT:CDS FM199974_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccamagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatatcgtcaatctcctcgaggactggggaccctgctt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccagggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggcttttagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM199976_PreS2_P-A Feature FT:CDS FM199976_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
rtgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgctt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagacttgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM199977_PreS2_P-A Feature FT:CDS FM199977_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgctt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccarggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatwcatttaa
>gnl|hbvcds|FM199978_PreS2_P-A Feature FT:CDS FM199978_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgctt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccmattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM199979_PreS2_P-A Feature FT:CDS FM199979_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaacaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgctt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM199980_PreS2_P-A Feature FT:CDS FM199980_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgctt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcamctc
tatgtttccctcatgttgctgtacaaaacytacggctggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM199981_PreS2_P-A Feature FT:CDS FM199981_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatatcgtcaatctcctcgaggactggggaccctgctt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatrttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN545825_PreS2_P-A Feature FT:CDS FN545825_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaattccacaactttccaccaagctctgcaagatcccagagtaaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaacccctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtctgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN545826_PreS2_P-A Feature FT:CDS FN545826_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaacatggagaacatcacatcaggattcctaagacccctgctcgggttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgccttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctcaaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacgaccagtacaggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgytgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgtwaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN545828_PreS2_P-A Feature FT:CDS FN545828_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaactttccaccaagctctacaagatcccagggtcaggggcctgtatttccctgctggtggctc
caattcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggrtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcatgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcytggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgactccctt
tttaccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN545829_PreS2_P-A Feature FT:CDS FN545829_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaattccacaactttccaccaagctctgcaggatcccaaggtcaggggcctgtatttccctgctggtggctc
caattcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctccgcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgttcccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN545830_PreS2_P-A Feature FT:CDS FN545830_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
ayccagtggmattccacaactttccaccaagctctgcaagatcccagggtcaggggcctgtatttacctgctggtggctc
caattcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggaytcctaggacmcctgctcgtgttacaggcgggatttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcatggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatccacgaccaccagyacgggaccctgccgaacctgcacgactcctgctcaaggcaactc
tatgtttccctcctgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccctcatcatgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN545831_PreS2_P-A Feature FT:CDS FN545831_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctctgggcatacatttaa
>gnl|hbvcds|FN545832_PreS2_P-A Feature FT:CDS FN545832_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaactttccaccaagctctgcaagatcccagggtcaggggcctgtatttccctgctggtggctc
caattcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgcccgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggawcacacgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtatctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtataaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN545833_PreS2_P-A Feature FT:CDS FN545833_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
attcagtggaattccacaactttccaccaagctctgcaagatcccagggtcaggggcctgtatctccctgctggtggctc
caattcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctrctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccrcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcctgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcrtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctt
tataccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN545834_PreS2_P-A Feature FT:CDS FN545834_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
attcagtggaattccacaactttccaccaagctctgcaagatcccagggtcaggggcctgtatctccctgctggtggctc
caattcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctrctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttrttggttctgctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcctgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaratwcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaycttgagtccctt
tataccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN545835_PreS2_P-A Feature FT:CDS FN545835_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcartggaattccacaactttccaccaagctctacaagatcccagggtcaggggcctgtatttccctgctggtggctc
caattcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcatgggctttcg
caaaatacctatgggggtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN545836_PreS2_P-A Feature FT:CDS FN545836_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctacaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttcwggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatccacaactaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN545837_PreS2_P-A Feature FT:CDS FN545837_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=837 residues).
atccagtggagttccacaacttcccaccaagctctgcaagatcccagggtcaggggccctgctggtggctccaattcagg
aacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgargactggggaccctgcaccgaccatgg
agaacaycacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaata
ccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtc
cccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatca
tattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcct
ctaattccaggatccacaacaaccagcacgggamcctgcaaaacctgcacgactcctgctcaaggcaactctatgtttcc
ctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacc
tatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggtycgtagggctttccccc
actgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttttaccgct
gttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN545838_PreS2_P-A Feature FT:CDS FN545838_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagmtttccaccaagctctgrmagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaagccctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgccc
gtttgtcctccaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggyatacatttaa
>gnl|hbvcds|GQ161813_PreS2_P-A Feature FT:CDS GQ161813_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GU1021). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcatgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|GQ184323_PreS2_P-A Feature FT:CDS GQ184323_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1121). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattacactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggactttcttccattgtctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ184324_PreS2_P-A Feature FT:CDS GQ184324_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1122). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattacactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttctttttggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgacttctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ331046_PreS2_P-A Feature FT:CDS GQ331046_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-188). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtgggagtccacaaccttccaccaagctctgcaagatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctcgactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatctgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggaaccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|GQ331047_PreS2_P-A Feature FT:CDS GQ331047_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-56). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaaccttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgtac
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctcgactcgtggtggacttctctcaattttctagggggatcacccgcgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggaaccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctattaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|GQ414522_PreS2_P-A Feature FT:CDS GQ414522_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477461_PreS2_P-A Feature FT:CDS GQ477461_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477462_PreS2_P-A Feature FT:CDS GQ477462_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgcttgatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggttttgggggccaagtctgtacaacatcgtgaagccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477463_PreS2_P-A Feature FT:CDS GQ477463_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaagatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctgcaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatatccctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactggtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttacatggatgatgtggtattgggggccaagtctgtacaacatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477464_PreS2_P-A Feature FT:CDS GQ477464_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgctttccaccaagctctgcaaaatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcatctcacatatcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctcaaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ477465_PreS2_P-A Feature FT:CDS GQ477465_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P10). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
cattcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477466_PreS2_P-A Feature FT:CDS GQ477466_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P12). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477467_PreS2_P-A Feature FT:CDS GQ477467_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P14). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477468_PreS2_P-A Feature FT:CDS GQ477468_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P16). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcagaacctgcacgactcctgctcaaagcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttga
>gnl|hbvcds|GQ477469_PreS2_P-A Feature FT:CDS GQ477469_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P19). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaatacccgtgtgtcatggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctcaaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaaatctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477470_PreS2_P-A Feature FT:CDS GQ477470_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P20). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atacagtggaattccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttcgaggggaagcacccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgtaaccaattttcttttgtctctgggtatacatytaa
>gnl|hbvcds|GQ477472_PreS2_P-A Feature FT:CDS GQ477472_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P24). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagatctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttaacaagaatc
ctcacaataccgaagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcatgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477473_PreS2_P-A Feature FT:CDS GQ477473_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P27). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagccctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggtaccacccgagtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccacgtctgtgcagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477474_PreS2_P-A Feature FT:CDS GQ477474_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P28). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattacgctgccttccaccgggctctgcaggatcccaaagtcaagggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacacggagaacatcacatcaggattcctaggacccctgcacgtgttacaggcggggttttccttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccgatttgtcctggttatcgctggatgtgtcagcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcatgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ccttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgattccctt
tataccgctgtgaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477475_PreS2_P-A Feature FT:CDS GQ477475_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P29). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggcttttagctatatggatgatgtggtattgggggccaagtctgtgcaacatcgtgaagccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477476_PreS2_P-A Feature FT:CDS GQ477476_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P30). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctacaggatcccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgg
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggggtcaaccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgtctcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagag
ctttcccccactgtttggcttttagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgtaaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477477_PreS2_P-A Feature FT:CDS GQ477477_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P31). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccgtccaccaagatccgcaggaccccaaagtcaggggtctgtgttttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggggaccctgtga
agaacagggagaacatcacatcaggattcctaggacccctgcacgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctcaaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgccatgcctcatcttcttattggttcttctggattatcaaggtatattgccc
gtttgtcctctaattccaggagcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccattgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477478_PreS2_P-A Feature FT:CDS GQ477478_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P34). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgaaggataccagagtcaggggtctgtattctcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgattcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477479_PreS2_P-A Feature FT:CDS GQ477479_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P40). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaaactctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477480_PreS2_P-A Feature FT:CDS GQ477480_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P41). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcagaatcccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggaatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477482_PreS2_P-A Feature FT:CDS GQ477482_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P46). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctacaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgg
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctcaaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477484_PreS2_P-A Feature FT:CDS GQ477484_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P54). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaccagtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477486_PreS2_P-A Feature FT:CDS GQ477486_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P57). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
taaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477487_PreS2_P-A Feature FT:CDS GQ477487_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P60). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaaactctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaagccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477488_PreS2_P-A Feature FT:CDS GQ477488_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P64). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaag
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcatgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477490_PreS2_P-A Feature FT:CDS GQ477490_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P74). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatccggagtcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaaatctgtacagcaccgtgagtccctt
tttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477491_PreS2_P-A Feature FT:CDS GQ477491_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P75). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaaatctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477493_PreS2_P-A Feature FT:CDS GQ477493_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P79). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggagttccactgctttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggaaaacatcacatcaggattcctagaacccccgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaatcccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacacgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtctctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477494_PreS2_P-A Feature FT:CDS GQ477494_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P80). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacggggccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcctgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatattgtattgggggccaagtctgtacaacatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtattcatttaa
>gnl|hbvcds|GQ477495_PreS2_P-A Feature FT:CDS GQ477495_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P89). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaaactctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaaacagctc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477496_PreS2_P-A Feature FT:CDS GQ477496_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P94). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477497_PreS2_P-A Feature FT:CDS GQ477497_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P98). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctcaaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggcttttagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttatgtctctgggtatacatttaa
>gnl|hbvcds|GQ477498_PreS2_P-A Feature FT:CDS GQ477498_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P100). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggaccccagctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcctgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477499_PreS2_P-A Feature FT:CDS GQ477499_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P105). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccattgcttggctttcagctatatggatgatgtggtattgggggccaagtctgtagagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477500_PreS2_P-A Feature FT:CDS GQ477500_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P107). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggttttccttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
attttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatattgcgc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatctaa
>gnl|hbvcds|GQ477501_PreS2_P-A Feature FT:CDS GQ477501_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P116). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagaatctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccattgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477502_PreS2_P-A Feature FT:CDS GQ477502_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P123). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagaatctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcgtcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggcttttagctatatggatgatgtggtattgggggccacatctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477503_PreS2_P-A Feature FT:CDS GQ477503_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P130). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477504_PreS2_P-A Feature FT:CDS GQ477504_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P131). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtccactaattccaggatcaacaacaaccagtacaggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggcttttagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggcactt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GU563545_PreS2_P-A Feature FT:CDS GU563545_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgctt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU563546_PreS2_P-A Feature FT:CDS GU563546_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-66). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GU563547_PreS2_P-A Feature FT:CDS GU563547_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-23). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaaactctgcaagattccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgctt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU563548_PreS2_P-A Feature FT:CDS GU563548_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-108). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgctt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU563550_PreS2_P-A Feature FT:CDS GU563550_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-204). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GU563551_PreS2_P-A Feature FT:CDS GU563551_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-124). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaattccactgccttccaccaagctctacaggatcccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccattgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GU563553_PreS2_P-A Feature FT:CDS GU563553_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-10). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GU563554_PreS2_P-A Feature FT:CDS GU563554_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-25). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GU563555_PreS2_P-A Feature FT:CDS GU563555_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-35). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GU563557_PreS2_P-A Feature FT:CDS GU563557_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-78). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GU563558_PreS2_P-A Feature FT:CDS GU563558_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-90). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GU563562_PreS2_P-A Feature FT:CDS GU563562_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-189). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HE576988_PreS2_P-A Feature FT:CDS HE576988_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P5.9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttcaagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggaaggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HE576989_PreS2_P-A Feature FT:CDS HE576989_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P2.2.11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaatcccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggaaggaaattgcacctgtattcccatcccattgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HM011485_PreS2_P-A Feature FT:CDS HM011485_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcgttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttcccaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccatgcaaaacctgcacgacttctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgcttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgaatccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM363612_PreS2_P-A Feature FT:CDS HM363612_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C3). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctatattttcctgctggtggctc
cagttcaggaacagtaaaccctgctcagaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HM363613_PreS2_P-A Feature FT:CDS HM363613_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate V103). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaactttccaccaagctctgcaagatcccagagtaaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaacccctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtctgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|HM535200_PreS2_P-A Feature FT:CDS HM535200_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 947 Harare). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgt
tgaacatggagaacatcacatcgagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM535205_PreS2_P-A Feature FT:CDS HM535205_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 72 Mutare). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagccaggggcctgtattttccggctggtggctc
cagttcaggaacactcaaccctgttccaaatactgcctctcacatctcggcaatctcctcgaggactggggaccctgcgt
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcctgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|JF439720_PreS2_P-A Feature FT:CDS JF439720_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL437). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggttttccttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacctctctcaattttctagggggaccacccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgccctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgtcgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439721_PreS2_P-A Feature FT:CDS JF439721_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL444). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaagatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctt
tataccgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|JF439722_PreS2_P-A Feature FT:CDS JF439722_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL445). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggttttccttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439723_PreS2_P-A Feature FT:CDS JF439723_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL448). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacggctcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctt
tataccgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|JF439724_PreS2_P-A Feature FT:CDS JF439724_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL450). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgccctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctt
tataccgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|JF439725_PreS2_P-A Feature FT:CDS JF439725_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL451). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggttttccttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtgcaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctagctcagtctactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439726_PreS2_P-A Feature FT:CDS JF439726_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL452). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs). [Hepadnaviridae] (length=846 residues).
atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtagctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggccttagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439727_PreS2_P-A Feature FT:CDS JF439727_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL453). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtagacttccacagcttttcaccaaactctgcaagatcccagagtcgggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatc
ctcacaataccgcagaaactagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctagctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439728_PreS2_P-A Feature FT:CDS JF439728_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL454). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggttttccttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtgcaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctagctcagtctactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439729_PreS2_P-A Feature FT:CDS JF439729_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL455). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439730_PreS2_P-A Feature FT:CDS JF439730_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL456). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctt
tataccgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|JF439731_PreS2_P-A Feature FT:CDS JF439731_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL458). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggttttccttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggccttagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439732_PreS2_P-A Feature FT:CDS JF439732_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL459). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccacggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgccgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccaccatcctgggctttcg
caaaatacctatgggagtgggccccagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctt
tataccgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|JF439733_PreS2_P-A Feature FT:CDS JF439733_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL460). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccacggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgccgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccaccatcctgggctttcg
caaaatacctatgggagtgggccccagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctt
tataccgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|JF439734_PreS2_P-A Feature FT:CDS JF439734_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL461). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggttttccttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgccgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggccttagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439735_PreS2_P-A Feature FT:CDS JF439735_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL462). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctt
tataccgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|JF439736_PreS2_P-A Feature FT:CDS JF439736_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL463). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctt
tataccgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|JF439737_PreS2_P-A Feature FT:CDS JF439737_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL465). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctt
tataccgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|JF439738_PreS2_P-A Feature FT:CDS JF439738_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL466). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctt
tataccgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|JF439739_PreS2_P-A Feature FT:CDS JF439739_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL467). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggttttccttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcgaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439740_PreS2_P-A Feature FT:CDS JF439740_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL468). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctagctcagtctactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439741_PreS2_P-A Feature FT:CDS JF439741_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL469). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgccccatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctagctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439742_PreS2_P-A Feature FT:CDS JF439742_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL471). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggttttccttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgccctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439743_PreS2_P-A Feature FT:CDS JF439743_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL472). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcaccctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttctcttgtctttgggtatacatctaa
>gnl|hbvcds|JF439744_PreS2_P-A Feature FT:CDS JF439744_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL473). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggttttccttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcgtggccaaaa
ttcgcagttcccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggccttagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439745_PreS2_P-A Feature FT:CDS JF439745_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL474). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgccctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439746_PreS2_P-A Feature FT:CDS JF439746_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL485). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggacttccacagcttttcaccgaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439747_PreS2_P-A Feature FT:CDS JF439747_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL489). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cggttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctt
tataccgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|JF439748_PreS2_P-A Feature FT:CDS JF439748_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL490). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggacttccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgccctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcggaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439750_PreS2_P-A Feature FT:CDS JF439750_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL498). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctagctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcatttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439751_PreS2_P-A Feature FT:CDS JF439751_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL499). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaaggcccctgctcgtgttacaggcggggttttccttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439752_PreS2_P-A Feature FT:CDS JF439752_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A1). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439753_PreS2_P-A Feature FT:CDS JF439753_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A2). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatttttttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439754_PreS2_P-A Feature FT:CDS JF439754_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A3). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439755_PreS2_P-A Feature FT:CDS JF439755_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A4). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439756_PreS2_P-A Feature FT:CDS JF439756_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A5). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439757_PreS2_P-A Feature FT:CDS JF439757_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A7). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439758_PreS2_P-A Feature FT:CDS JF439758_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A9). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439759_PreS2_P-A Feature FT:CDS JF439759_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A10). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439760_PreS2_P-A Feature FT:CDS JF439760_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A11). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439761_PreS2_P-A Feature FT:CDS JF439761_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A12). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439762_PreS2_P-A Feature FT:CDS JF439762_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95B1). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcattttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439763_PreS2_P-A Feature FT:CDS JF439763_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95B3). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439764_PreS2_P-A Feature FT:CDS JF439764_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95B5). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439765_PreS2_P-A Feature FT:CDS JF439765_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95B6). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439766_PreS2_P-A Feature FT:CDS JF439766_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95B7). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439767_PreS2_P-A Feature FT:CDS JF439767_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05B8). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaagaccccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggactgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439768_PreS2_P-A Feature FT:CDS JF439768_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05B9). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttcccccaagctctgcaagaccccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggactgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439769_PreS2_P-A Feature FT:CDS JF439769_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05B10). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttcccccaagctctgcaagaccccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggactgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439774_PreS2_P-A Feature FT:CDS JF439774_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05C8). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttacaccaagctctgcaagaccccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggactgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439777_PreS2_P-A Feature FT:CDS JF439777_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05D2). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaagaccccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggactgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439819_PreS2_P-A Feature FT:CDS JF439819_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97A1). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagaacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatagatgatgtggtattgggggccaagtctgtacagcaccgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439820_PreS2_P-A Feature FT:CDS JF439820_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97B1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggatttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacggggacatgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439821_PreS2_P-A Feature FT:CDS JF439821_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97B2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atacagtggaattacactaccttccgccaagctatgcaggatcccagagtcaggggaatgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggacccagtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgcggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaacatgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccaccgtccggggctttcg
caaaatacctatgggagtgggcctcagtccgtttctattggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439822_PreS2_P-A Feature FT:CDS JF439822_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97C1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccctccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaacatgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439823_PreS2_P-A Feature FT:CDS JF439823_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97C2). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagaacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaagttgcacctgtatccccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatagatgatgtggtattgggggccaagtctgtacagcaccgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439824_PreS2_P-A Feature FT:CDS JF439824_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97D1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgtcgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaacatgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439825_PreS2_P-A Feature FT:CDS JF439825_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97D2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaacatgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439826_PreS2_P-A Feature FT:CDS JF439826_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97E1). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatactcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaacatgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatagatgatgtggtattgggggccaagtctgtacagcaccgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439827_PreS2_P-A Feature FT:CDS JF439827_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97E2). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagaacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatagatgatgtggtattgggggccaagtctgtacagcaccgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439828_PreS2_P-A Feature FT:CDS JF439828_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97F1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgccgtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaacatgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439829_PreS2_P-A Feature FT:CDS JF439829_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97F2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaacatgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439830_PreS2_P-A Feature FT:CDS JF439830_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97G2). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaacatgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatagatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439831_PreS2_P-A Feature FT:CDS JF439831_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97H1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaacatgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439832_PreS2_P-A Feature FT:CDS JF439832_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97H2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgcggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcggcaacaaccagtacgggaacatgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439833_PreS2_P-A Feature FT:CDS JF439833_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99H4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagtccctt
cataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439834_PreS2_P-A Feature FT:CDS JF439834_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99A4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcgtcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439835_PreS2_P-A Feature FT:CDS JF439835_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99B3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagcctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439836_PreS2_P-A Feature FT:CDS JF439836_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99B4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggacaatgcaaaacctgcacgactactgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439837_PreS2_P-A Feature FT:CDS JF439837_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99C3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagcctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439838_PreS2_P-A Feature FT:CDS JF439838_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99C4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgcattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439839_PreS2_P-A Feature FT:CDS JF439839_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99D3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaagaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggactctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439840_PreS2_P-A Feature FT:CDS JF439840_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99D4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggacaatgcaaaacctgcacgactactgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439841_PreS2_P-A Feature FT:CDS JF439841_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99E4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatattgcctcccacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttca
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439842_PreS2_P-A Feature FT:CDS JF439842_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99F3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctctgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctagggcccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctcgatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaacatgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccatttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439843_PreS2_P-A Feature FT:CDS JF439843_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99F4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcttcccacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtgctggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgccctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcccgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439844_PreS2_P-A Feature FT:CDS JF439844_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99H3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439845_PreS2_P-A Feature FT:CDS JF439845_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00H6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439846_PreS2_P-A Feature FT:CDS JF439846_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00A5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatatttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctctcg
caaagtacctatgggagtgggcctcagtccgcttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439847_PreS2_P-A Feature FT:CDS JF439847_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00A6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcgggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagtcccct
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439848_PreS2_P-A Feature FT:CDS JF439848_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00B5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439849_PreS2_P-A Feature FT:CDS JF439849_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00B6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctctgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctcgatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcgaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggggtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattggggaccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439850_PreS2_P-A Feature FT:CDS JF439850_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00C5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctctgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtatcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggacaatgcaaaacctgcacgactactgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439851_PreS2_P-A Feature FT:CDS JF439851_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00C6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcgggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439852_PreS2_P-A Feature FT:CDS JF439852_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00D5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgtctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagacccgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttaccatattcctcttcatcctgctgctatgcctcatcttcttattggttcttttggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactactgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439853_PreS2_P-A Feature FT:CDS JF439853_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00D6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtctcggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439854_PreS2_P-A Feature FT:CDS JF439854_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00E5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcagggttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccgtcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439855_PreS2_P-A Feature FT:CDS JF439855_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00E6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcgggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggacaatgcaaaacctgcacgactactgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagcccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439856_PreS2_P-A Feature FT:CDS JF439856_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00F5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcagggttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccgtcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439857_PreS2_P-A Feature FT:CDS JF439857_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00F6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcgggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgccctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439858_PreS2_P-A Feature FT:CDS JF439858_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00G5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcgggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgcattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439859_PreS2_P-A Feature FT:CDS JF439859_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00G6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcgggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggaccggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439860_PreS2_P-A Feature FT:CDS JF439860_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00H5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcgggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgcattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439861_PreS2_P-A Feature FT:CDS JF439861_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05H8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctctgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctcgatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcgaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggggtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439862_PreS2_P-A Feature FT:CDS JF439862_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05B7). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctctgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaattcgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaatcccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggggtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439864_PreS2_P-A Feature FT:CDS JF439864_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05D7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattctactgccttccatcaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctctgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagggtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctcgatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcgaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggggtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439865_PreS2_P-A Feature FT:CDS JF439865_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05D8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatattgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439866_PreS2_P-A Feature FT:CDS JF439866_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05F7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcagggtcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctctgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctcgatgtgtctgcggc
gttttatcatattcctctccatcctgctgctatgcctcatcttcttattggttcttctggattatcgaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggggtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439867_PreS2_P-A Feature FT:CDS JF439867_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05G8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccgtccaccaagctctacaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggcgaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439868_PreS2_P-A Feature FT:CDS JF439868_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05H7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctctgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctcgatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcgaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcaatttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatattgtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgtcaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439869_PreS2_P-A Feature FT:CDS JF439869_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgctagacccccgagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggaggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctc
tatgattccctcatgttgctgtacaaaacctacggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttatgtctctgggtatacatttaa
>gnl|hbvcds|JF439870_PreS2_P-A Feature FT:CDS JF439870_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgctagacccccgagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatattgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctc
tatgattccctcatgttgctgtacaaaaactacggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttatgtctctgggtatacatttaa
>gnl|hbvcds|JF439871_PreS2_P-A Feature FT:CDS JF439871_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgctagacccccgagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctc
tatgattccctcatgttgctgtacaaaacctacggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttatgtctctgggtatacatttaa
>gnl|hbvcds|JF439872_PreS2_P-A Feature FT:CDS JF439872_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgctaaacccccgagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctc
tatgattccctcatgttgctgtacaaaaactacggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagcccgtttctattggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttatgtctctgggtatacatttaa
>gnl|hbvcds|JF439873_PreS2_P-A Feature FT:CDS JF439873_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgctagacccccgagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctc
tatgattccctcatgttgctgtacaaaacctacggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttatgtctctgggtatacatttaa
>gnl|hbvcds|JF439874_PreS2_P-A Feature FT:CDS JF439874_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgctagacccccgagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctc
tatgattccctcatgttgctgtacaaaacctacggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttatgtctctgggtatacatttaa
>gnl|hbvcds|JF439875_PreS2_P-A Feature FT:CDS JF439875_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgctagacccccgagtcacgggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctc
tatgattccctcatgttgctgtacaaaacctacggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttatgtctctgggtatacatttaa
>gnl|hbvcds|JF439876_PreS2_P-A Feature FT:CDS JF439876_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C10). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgctagacccccgagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggaggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctc
tatgattccctcatgttgctgtacaaaacctacggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttatgtctctgggtatacatttaa
>gnl|hbvcds|JF439877_PreS2_P-A Feature FT:CDS JF439877_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C11). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgctagacccccgagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctc
tatgatgccctcatgttgctgtacaaaaactacggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttatgtctctgggtatacatttaa
>gnl|hbvcds|JF439878_PreS2_P-A Feature FT:CDS JF439878_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C12). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgctagacccccgagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctc
tatgatgccctcatgttgctgtacaaaaactacggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttatgtctctgggtatacatttaa
>gnl|hbvcds|JF439879_PreS2_P-A Feature FT:CDS JF439879_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01E8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgctagacccccgagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctc
tatgattccctcatgttgctgtacaaaacctacggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttatgtctctgggtatacatttaa
>gnl|hbvcds|JF439880_PreS2_P-A Feature FT:CDS JF439880_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01E3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgctagacccccgagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaagacctgcacgacgcctgctcaaggcacctc
tatgattccctcatgttgctgtacaaaacctacggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttatgtctctgggtatacatttaa
>gnl|hbvcds|JF439881_PreS2_P-A Feature FT:CDS JF439881_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01E4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaggctctgctagacccccgagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctc
tatgattccctcatgttgctgtacaaaacctacggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttatgtctctgggtatacatttaa
>gnl|hbvcds|JF439882_PreS2_P-A Feature FT:CDS JF439882_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01E5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgctagacccccgagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctc
tatgattccctcatgttgctgtacaaaacctacggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttatgtctctgggtatacatttaa
>gnl|hbvcds|JF439883_PreS2_P-A Feature FT:CDS JF439883_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01E7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgctagacccccgagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaagacctgcacgactcctgctcaaggcacctc
tatgattccctcatgttgctgtacaaaacctacggctgcaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttatgtctctgggtatacatttaa
>gnl|hbvcds|JF439896_PreS2_P-A Feature FT:CDS JF439896_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01A2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctt
tataccgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|JF439897_PreS2_P-A Feature FT:CDS JF439897_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01A5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
gtgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctt
tataccgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|JF439898_PreS2_P-A Feature FT:CDS JF439898_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01A10). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439899_PreS2_P-A Feature FT:CDS JF439899_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01G6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439900_PreS2_P-A Feature FT:CDS JF439900_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01G7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttaccatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|JF439901_PreS2_P-A Feature FT:CDS JF439901_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01G9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|JF439902_PreS2_P-A Feature FT:CDS JF439902_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01G10). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctt
tataccgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|JF439903_PreS2_P-A Feature FT:CDS JF439903_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01G11). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctt
tataccgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|JF439904_PreS2_P-A Feature FT:CDS JF439904_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01G12). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctt
tataccgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|JF439905_PreS2_P-A Feature FT:CDS JF439905_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01H1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctt
tataccgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|JF439906_PreS2_P-A Feature FT:CDS JF439906_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01H2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
acgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttca
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|JF439907_PreS2_P-A Feature FT:CDS JF439907_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01H3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
gtgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JF439908_PreS2_P-A Feature FT:CDS JF439908_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01H4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcgtggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|JF439909_PreS2_P-A Feature FT:CDS JF439909_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01H5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctt
tataccgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|JF439910_PreS2_P-A Feature FT:CDS JF439910_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01H6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
gtgcagtggaattccacagcttttcaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgacgactggggaccctgcac
caaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagttcccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagcgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttttctttgggtatacatctaa
>gnl|hbvcds|JF439911_PreS2_P-A Feature FT:CDS JF439911_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A1). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439912_PreS2_P-A Feature FT:CDS JF439912_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A2). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcaccttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgttcagcatcgtgaggccctt
tacaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439913_PreS2_P-A Feature FT:CDS JF439913_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A3). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439914_PreS2_P-A Feature FT:CDS JF439914_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A4). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcctatcgtcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgttcagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439915_PreS2_P-A Feature FT:CDS JF439915_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A5). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacctctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgttcagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439916_PreS2_P-A Feature FT:CDS JF439916_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagagtc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgttcagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439917_PreS2_P-A Feature FT:CDS JF439917_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A7). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgcccaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcgtgaggcccct
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439918_PreS2_P-A Feature FT:CDS JF439918_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A8). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgccaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439919_PreS2_P-A Feature FT:CDS JF439919_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A9). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
cttacaataccgcagagtctagactcgtggtgggcttctctcaattttctagggggagcacccgtgtgccttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacggggccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439920_PreS2_P-A Feature FT:CDS JF439920_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A10). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcctcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439921_PreS2_P-A Feature FT:CDS JF439921_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A11). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcgcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttactggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439922_PreS2_P-A Feature FT:CDS JF439922_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A12). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439923_PreS2_P-A Feature FT:CDS JF439923_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00B1). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgttcggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439924_PreS2_P-A Feature FT:CDS JF439924_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00B2). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatatcgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacagtaccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439925_PreS2_P-A Feature FT:CDS JF439925_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00B3). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtctctcttggctcagtttactagtgccattcgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439926_PreS2_P-A Feature FT:CDS JF439926_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00B4). Partial genome (Contains: HBc, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttgactcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439927_PreS2_P-A Feature FT:CDS JF439927_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00B6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgttcagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439928_PreS2_P-A Feature FT:CDS JF439928_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05B7). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaacattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgagtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439929_PreS2_P-A Feature FT:CDS JF439929_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05B8). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaacattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgagtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tatacccctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439930_PreS2_P-A Feature FT:CDS JF439930_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05B9). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgcga
cgaacatggagaacatcacatcgggattcctaggacccccgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgagtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439931_PreS2_P-A Feature FT:CDS JF439931_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05B10). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggggaccctgcga
cgaacatggagaacatcacatcaggagtcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattgattcttctggattatcaaggtatgtcgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439932_PreS2_P-A Feature FT:CDS JF439932_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05B11). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaacattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgagtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtatggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439933_PreS2_P-A Feature FT:CDS JF439933_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05B12). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcgggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttccagggggagcacccgaatgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439934_PreS2_P-A Feature FT:CDS JF439934_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C1). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaacattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgagtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439935_PreS2_P-A Feature FT:CDS JF439935_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C2). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggggaccctgcga
cgaacatggagaacatcacatcaggagtcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcgcaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgccatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439936_PreS2_P-A Feature FT:CDS JF439936_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C3). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaacattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacctctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggggcacccgagtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgccctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439937_PreS2_P-A Feature FT:CDS JF439937_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C4). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcccctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcgggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgagtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccgtcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439938_PreS2_P-A Feature FT:CDS JF439938_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C5). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcgggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgagtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctatattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439939_PreS2_P-A Feature FT:CDS JF439939_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcgggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgagtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gttcgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439940_PreS2_P-A Feature FT:CDS JF439940_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C7). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaacattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgagtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439941_PreS2_P-A Feature FT:CDS JF439941_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C8). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcccctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcgggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgagtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439942_PreS2_P-A Feature FT:CDS JF439942_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C10). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcgggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgagtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatatccctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaagtacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439943_PreS2_P-A Feature FT:CDS JF439943_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tttaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439944_PreS2_P-A Feature FT:CDS JF439944_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcgggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaatcttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439945_PreS2_P-A Feature FT:CDS JF439945_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaatcttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439946_PreS2_P-A Feature FT:CDS JF439946_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439947_PreS2_P-A Feature FT:CDS JF439947_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatggtgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439948_PreS2_P-A Feature FT:CDS JF439948_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439949_PreS2_P-A Feature FT:CDS JF439949_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactgggggccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggacgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tatatcgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439950_PreS2_P-A Feature FT:CDS JF439950_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a10). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctcccacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439951_PreS2_P-A Feature FT:CDS JF439951_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a11). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtgcgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgcacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439952_PreS2_P-A Feature FT:CDS JF439952_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a12). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatgttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctgcggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgcggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439953_PreS2_P-A Feature FT:CDS JF439953_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcgcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttctcccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439954_PreS2_P-A Feature FT:CDS JF439954_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcgacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439955_PreS2_P-A Feature FT:CDS JF439955_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439956_PreS2_P-A Feature FT:CDS JF439956_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcgtcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439957_PreS2_P-A Feature FT:CDS JF439957_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgtctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439958_PreS2_P-A Feature FT:CDS JF439958_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtgggcttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgtcgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439959_PreS2_P-A Feature FT:CDS JF439959_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctatattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggctcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439960_PreS2_P-A Feature FT:CDS JF439960_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b10). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcagggtcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cggacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaatcttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439961_PreS2_P-A Feature FT:CDS JF439961_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcccgggctttca
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatttggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439962_PreS2_P-A Feature FT:CDS JF439962_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439963_PreS2_P-A Feature FT:CDS JF439963_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcaggggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439964_PreS2_P-A Feature FT:CDS JF439964_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaatcttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439965_PreS2_P-A Feature FT:CDS JF439965_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgtaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtacacatttaa
>gnl|hbvcds|JF439966_PreS2_P-A Feature FT:CDS JF439966_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c8). Partial genome (Contains: HBe, HBc, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccgacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgctaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439967_PreS2_P-A Feature FT:CDS JF439967_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c10). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439968_PreS2_P-A Feature FT:CDS JF439968_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c12). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctc
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439969_PreS2_P-A Feature FT:CDS JF439969_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439970_PreS2_P-A Feature FT:CDS JF439970_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccgggctctgcaggatcccagagtctggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgaaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439971_PreS2_P-A Feature FT:CDS JF439971_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctggactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgttgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439972_PreS2_P-A Feature FT:CDS JF439972_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctagttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaaatttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439973_PreS2_P-A Feature FT:CDS JF439973_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggagcagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtgggcttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439974_PreS2_P-A Feature FT:CDS JF439974_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439975_PreS2_P-A Feature FT:CDS JF439975_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacagtaccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcctctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatttggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439976_PreS2_P-A Feature FT:CDS JF439976_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgagcatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaaggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttaccatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439977_PreS2_P-A Feature FT:CDS JF439977_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtccgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439978_PreS2_P-A Feature FT:CDS JF439978_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d10). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagcctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgtccagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439979_PreS2_P-A Feature FT:CDS JF439979_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccgacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctccaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacgggtggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439980_PreS2_P-A Feature FT:CDS JF439980_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439981_PreS2_P-A Feature FT:CDS JF439981_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagagggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaagcctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439982_PreS2_P-A Feature FT:CDS JF439982_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagtccaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439983_PreS2_P-A Feature FT:CDS JF439983_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtagaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439984_PreS2_P-A Feature FT:CDS JF439984_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtgggggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439985_PreS2_P-A Feature FT:CDS JF439985_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e10). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgg
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439986_PreS2_P-A Feature FT:CDS JF439986_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e12). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaatatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439987_PreS2_P-A Feature FT:CDS JF439987_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaagacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439988_PreS2_P-A Feature FT:CDS JF439988_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439989_PreS2_P-A Feature FT:CDS JF439989_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
cttccccccaccgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439990_PreS2_P-A Feature FT:CDS JF439990_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggactcccaggacccctgctcgtgttacaggcggggtttctcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctcgaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatttggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439991_PreS2_P-A Feature FT:CDS JF439991_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggcggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatctgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtctgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439992_PreS2_P-A Feature FT:CDS JF439992_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggcggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggctcttctggattatcaaggtatgttgccc
gtttgtcccctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF439993_PreS2_P-A Feature FT:CDS JF439993_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgg
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagggtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatttggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF440020_PreS2_P-A Feature FT:CDS JF440020_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05C4). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaaaaccccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgtctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggactgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN182318_PreS2_P-A Feature FT:CDS JN182318_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacattcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctcctatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JN182319_PreS2_P-A Feature FT:CDS JN182319_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacattcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatctcgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JN182320_PreS2_P-A Feature FT:CDS JN182320_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacattcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcaagacctgcacgactcctgctcaaggcaaccc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JN182321_PreS2_P-A Feature FT:CDS JN182321_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacattcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacttccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JN182322_PreS2_P-A Feature FT:CDS JN182322_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacattcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JN182323_PreS2_P-A Feature FT:CDS JN182323_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacattcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccactgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JN182324_PreS2_P-A Feature FT:CDS JN182324_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacattcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcaagacctgcacgactcctgctcaaggcaacgc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttgccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JN182325_PreS2_P-A Feature FT:CDS JN182325_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacattcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JN182326_PreS2_P-A Feature FT:CDS JN182326_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacattcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JN182327_PreS2_P-A Feature FT:CDS JN182327_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacattcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JN182328_PreS2_P-A Feature FT:CDS JN182328_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtactttcctgctggtggctc
cagttcaggaacattcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtaagttgccc
gtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JN182329_PreS2_P-A Feature FT:CDS JN182329_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacattcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JN182330_PreS2_P-A Feature FT:CDS JN182330_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacattcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcaagacctgcacggctcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JN182331_PreS2_P-A Feature FT:CDS JN182331_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacattcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcccccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtataaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JN182332_PreS2_P-A Feature FT:CDS JN182332_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacattcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctgggttaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtatcgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JN182333_PreS2_P-A Feature FT:CDS JN182333_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacattcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttccctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtatcgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JN182334_PreS2_P-A Feature FT:CDS JN182334_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaggctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacattcaaccctgttccaaacattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgt
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcctctggattaccaaggtaagttgccc
gtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JN604128_PreS2_P-A Feature FT:CDS JN604128_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-4481-9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
gtacagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtatctccctgctggtggctc
cagttcaggaacactcaaccctgttcccaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaacatggagaacatmacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcatggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgyaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagactgtgcaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604136_PreS2_P-A Feature FT:CDS JN604136_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-5824-8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagcacgggaacctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccattgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604145_PreS2_P-A Feature FT:CDS JN604145_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-2097-2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604150_PreS2_P-A Feature FT:CDS JN604150_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-5814-7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgmaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaacatggagaacatcacatcaggattcctaggacccctgctcgkgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttccaggggtarcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaycarggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgttwccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatwcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtattcatttaa
>gnl|hbvcds|JN604155_PreS2_P-A Feature FT:CDS JN604155_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 480-0815-7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcaatggaattccacaactttccaccaagctctrcaagatcccagggtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcarttttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggrccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtmttgggggccaagactgctcaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604156_PreS2_P-A Feature FT:CDS JN604156_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 476-5439-9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacaycttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604157_PreS2_P-A Feature FT:CDS JN604157_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 476-8460-1). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaagggcctgtatttccctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgt
tgaacacggagaacatcacatcaggattcctaaaacccctgctcgtgttacaggrggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaagtatgttgccc
gtttgtcctctacttccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcggaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604158_PreS2_P-A Feature FT:CDS JN604158_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 476-9282-8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604159_PreS2_P-A Feature FT:CDS JN604159_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-0176-0). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtta
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatctgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccaytgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604160_PreS2_P-A Feature FT:CDS JN604160_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-1175-1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604162_PreS2_P-A Feature FT:CDS JN604162_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-3509-0). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcgggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604163_PreS2_P-A Feature FT:CDS JN604163_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-4838-2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
gtgcagtggaattccacagcttttcaccaaactctgcaagatcccagagccaggggcctgtgtcctcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtctcccgtgtgttttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604164_PreS2_P-A Feature FT:CDS JN604164_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-7898-3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604165_PreS2_P-A Feature FT:CDS JN604165_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-8501-1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttmttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggsccamccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaayttgtcctggttatcgctkgatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttrttggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcagcaacaaccagyacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggayggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttyagttatatggatgatgtggtattgggggccaartctgtgcarcatcgtgagtccstt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604167_PreS2_P-A Feature FT:CDS JN604167_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-9638-1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaaattgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604169_PreS2_P-A Feature FT:CDS JN604169_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-9866-8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcagggacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgg
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604171_PreS2_P-A Feature FT:CDS JN604171_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-0079-4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaactattgcctctcacatatcgtcaatctcctcgaggattggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604172_PreS2_P-A Feature FT:CDS JN604172_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-0232-8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggratcacccgtgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttyagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604173_PreS2_P-A Feature FT:CDS JN604173_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-0370-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604176_PreS2_P-A Feature FT:CDS JN604176_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-2959-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccccgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaatacygaagagtctagactcgtggtggacttctctcaattttctaggggggwcacccgagtgtcrtggcctaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggktatcgctkgatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagytatatggatgatgtggtwttgggggccaartctgtrcarcayctysagtccctt
wmyacmgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604178_PreS2_P-A Feature FT:CDS JN604178_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-5662-2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604179_PreS2_P-A Feature FT:CDS JN604179_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-6727-3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaagacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604180_PreS2_P-A Feature FT:CDS JN604180_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-6919-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctatattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604181_PreS2_P-A Feature FT:CDS JN604181_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-7570-5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaatgccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tacgttaccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604183_PreS2_P-A Feature FT:CDS JN604183_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-7954-1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
acgcagtggamytycaatgcctttcwccaagatctgcaagatcccagagtcaggggtytgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604184_PreS2_P-A Feature FT:CDS JN604184_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-8107-5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604185_PreS2_P-A Feature FT:CDS JN604185_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-9112-3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctgattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604186_PreS2_P-A Feature FT:CDS JN604186_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-0588-3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgctgtggaattccacagctttccaccaagctctgcaagatcccaragtcaggggcctgtactttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcga
agaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcarttttctagggggatcacacgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccaaaacaamcagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
gaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604188_PreS2_P-A Feature FT:CDS JN604188_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-2496-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgcctttcaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctargacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggakcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgrttcgcaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagkccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604190_PreS2_P-A Feature FT:CDS JN604190_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-3516-1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggagtcactcgtgtgtcttggccaaaa
ttcgcagttcccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgcttgatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaggtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604191_PreS2_P-A Feature FT:CDS JN604191_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-4278-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604193_PreS2_P-A Feature FT:CDS JN604193_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-8520-7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcaatggaattccacagctttccaccaagctctgcaagatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaactattgcctctcacatatcgtcaatctcctcgaggattggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaatgccacagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattgggtcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatttggtactgggggccaggtctgcaccacatcttgagtccctg
tacaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604194_PreS2_P-A Feature FT:CDS JN604194_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-9228-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604197_PreS2_P-A Feature FT:CDS JN604197_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 476-9048-4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctacttccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtatcgcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604200_PreS2_P-A Feature FT:CDS JN604200_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-8111-8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604204_PreS2_P-A Feature FT:CDS JN604204_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-9847-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604209_PreS2_P-A Feature FT:CDS JN604209_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 476-6354-8). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgartgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaargcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagttyactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagkccctt
tataccgctgtaaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604214_PreS2_P-A Feature FT:CDS JN604214_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-0581-1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgcctttcaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtcyagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604216_PreS2_P-A Feature FT:CDS JN604216_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-1244-4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgtctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604217_PreS2_P-A Feature FT:CDS JN604217_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-2075-2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctcgcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaccatggagaacatcacatcrggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagacttgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaayttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcrtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604218_PreS2_P-A Feature FT:CDS JN604218_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-2654-4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atrcagtggaattccactgccttccaccaagctctgcargaycccaragtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgargactggggaccctgtga
cgaacatggagaacatcacatcaggattccyaggacccctgckcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcarttttctagggggatcacccgtgtgtcktggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcytgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcaycttctyattggttcttctggattatcaaggtatgttgccc
gtttgtcctctrattccaggatcaacaacaamcagtacgggaccatgcaaaacctgcacgactcctgytcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatwcctatgggagtgggcctcagtccgtttctcytggctcarttyactagtgcmatttgttcagtggttcgtaggg
cyttcccccactgtttggctttyagctatatggatgatgtggtaytgggggcsaagtcygtacagcatcgtgagkcmctw
tataccgctgtwaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604220_PreS2_P-A Feature FT:CDS JN604220_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-3827-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtccggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactgggaaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaacacccgagtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaaattgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattgggtcttctggattatcaaggtatggtgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaagggaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatctggtattgggggccaagactgtgcagcatcgtgagtccctt
tataccgctgttactaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604227_PreS2_P-A Feature FT:CDS JN604227_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-8192-8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggrtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaawttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
taygtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccaytgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgtkaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604228_PreS2_P-A Feature FT:CDS JN604228_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-9065-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604229_PreS2_P-A Feature FT:CDS JN604229_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-9110-9). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccactgcctttcaccaarctctgaaggatcccagagtcargggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
agaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctygttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaargcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagygccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccacgtctgtacaacatcgtgargccctt
tatacygctgtaaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604230_PreS2_P-A Feature FT:CDS JN604230_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-9296-7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcarttttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggktcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604236_PreS2_P-A Feature FT:CDS JN604236_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-2347-3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatttccctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcrggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggrtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccacgtctgtacagcaycgtgagtccctt
tatacmgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604237_PreS2_P-A Feature FT:CDS JN604237_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-4279-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaarctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcarggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604240_PreS2_P-A Feature FT:CDS JN604240_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-8326-1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctatattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatccggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604241_PreS2_P-A Feature FT:CDS JN604241_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-8404-5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=852 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaagaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
tgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctcaaattccaggatccacaacaacaacaaccagtgcgggaccctgcaaaacctgcacgactcctgctcaagg
caactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcatcttggg
ctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttc
gtagggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgag
tccctttacaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604242_PreS2_P-A Feature FT:CDS JN604242_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-9283-2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604247_PreS2_P-A Feature FT:CDS JN604247_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-1752-3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaacctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604249_PreS2_P-A Feature FT:CDS JN604249_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-2196-2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagggtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtra
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtyacccgagtgtcwtggccaaaa
ttcgcagtgcccaacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcrctggatgtgtctgcggc
rttttatcatattcctcttcatcctgctgcyatgcctcatcttctyattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacgaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcrtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtkgttttgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttwccaattttctkttgtctctgggtatacatttaa
>gnl|hbvcds|JN604251_PreS2_P-A Feature FT:CDS JN604251_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-2814-0). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagaatcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcac
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggcctttagctatatggatgatgtggttctgggggccaagtctgcgcaacaccttgagtccctt
tatacagctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604252_PreS2_P-A Feature FT:CDS JN604252_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-5037-5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcgttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaactattgcatctcacatctcgtcaatctcatcgaggattggggaccctgcga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604257_PreS2_P-A Feature FT:CDS JN604257_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-7365-8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtta
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604260_PreS2_P-A Feature FT:CDS JN604260_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-2324-3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgyac
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtatctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604261_PreS2_P-A Feature FT:CDS JN604261_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-2798-0). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604262_PreS2_P-A Feature FT:CDS JN604262_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-5384-4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604266_PreS2_P-A Feature FT:CDS JN604266_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 476-6438-0). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgcctttcaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaa
ttcgcggtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctacttccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604268_PreS2_P-A Feature FT:CDS JN604268_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 476-6705-3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccatt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604269_PreS2_P-A Feature FT:CDS JN604269_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 476-6804-3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctatatcttcctgctggtggctc
cagttcagggacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtgtgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgyttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaartctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604270_PreS2_P-A Feature FT:CDS JN604270_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 476-6948-9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcacyaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604273_PreS2_P-A Feature FT:CDS JN604273_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-0248-7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604274_PreS2_P-A Feature FT:CDS JN604274_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-0692-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccagggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatatggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604276_PreS2_P-A Feature FT:CDS JN604276_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-2270-8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604277_PreS2_P-A Feature FT:CDS JN604277_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-2543-9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaaytccactgccttccaccaagctctgcaggatcccagagtgaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaatatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggmaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604279_PreS2_P-A Feature FT:CDS JN604279_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-3206-2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604282_PreS2_P-A Feature FT:CDS JN604282_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-7112-7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaagatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604283_PreS2_P-A Feature FT:CDS JN604283_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-7136-7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604285_PreS2_P-A Feature FT:CDS JN604285_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-9002-8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccmaagtcmagggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgggtcactggcggggttttycttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggrtcacccgtgtgtcktggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcktctggattatcaaggtatgttgccc
gtttgtcctctaatcccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggcttttagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggcccty
tacaccgctgtkaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604288_PreS2_P-A Feature FT:CDS JN604288_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-0727-9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgtcttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatmtcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604290_PreS2_P-A Feature FT:CDS JN604290_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-2581-7). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggagtcacccgtgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattccacttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ccttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttatcaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604291_PreS2_P-A Feature FT:CDS JN604291_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-2956-2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604292_PreS2_P-A Feature FT:CDS JN604292_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-3070-9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604293_PreS2_P-A Feature FT:CDS JN604293_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-3721-8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604294_PreS2_P-A Feature FT:CDS JN604294_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-4030-2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604297_PreS2_P-A Feature FT:CDS JN604297_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-5893-3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604298_PreS2_P-A Feature FT:CDS JN604298_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-7366-8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggccacacgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcgaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggcttttagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604299_PreS2_P-A Feature FT:CDS JN604299_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-7384-0). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604300_PreS2_P-A Feature FT:CDS JN604300_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-7825-4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgactattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604302_PreS2_P-A Feature FT:CDS JN604302_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-8782-5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgcttgatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattgggtcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacgtgcaaaacttgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccgtcgtcctgggctttcg
taaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggttttcagctatatggatgatgtggtattgggggccaagtctgcgcaccatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604303_PreS2_P-A Feature FT:CDS JN604303_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-9523-2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604304_PreS2_P-A Feature FT:CDS JN604304_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-9526-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604305_PreS2_P-A Feature FT:CDS JN604305_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-0870-4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtcaaccctgctccgaatattgcctctcacatctcgttaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaa
ttcgcggtccccaacctccaatcactcaccaacctcctgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgccc
gtttgtcctctaattccaggatcaacaacaacaagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcaccktgaagccmtt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604306_PreS2_P-A Feature FT:CDS JN604306_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-3894-1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggttcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604307_PreS2_P-A Feature FT:CDS JN604307_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-4233-0). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcaaccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604308_PreS2_P-A Feature FT:CDS JN604308_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-4794-2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgaaaaatcccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacaggaaaccctgctccgaatattgcatctcacatctcgtcaatctccgggaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaattccgcagagtctagactcgtggtggacttctctcagttttctaggggggtcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgcttgatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatctgcttattggctcttctggattatcgaggtatgttgccc
gtttgtcctctaattccagcatcaacaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttcmctcatgttgctgtacaaaacctacggatggaaattgcacttgtactcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatatggtattgggggccaaractgtrcagcatcgtgagtccctt
tataccgctgttacyaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604309_PreS2_P-A Feature FT:CDS JN604309_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-5013-5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtctttcttgttgacaagaatc
ctcacaataccacagagtctagacttgtggtggacttctctcaattttccagggggagtacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatccctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgctgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604314_PreS2_P-A Feature FT:CDS JN604314_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-8511-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatc
ctcacaataccgcagagtctagactcgtggtggacttctctcarttttctagggggrtcacmcgtgtgtcttggccaaaa
ttcgcagtscccaacctccaatcactcaccaacctcctgtcctccaayttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggaygatgtggtwttgggggccaartctgtwsarcatcgkgarkccctt
twtaccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604315_PreS2_P-A Feature FT:CDS JN604315_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-9174-1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604317_PreS2_P-A Feature FT:CDS JN604317_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 480-0314-9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcarttttctagggggtccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctkgatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtktgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JN604319_PreS2_P-A Feature FT:CDS JN604319_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 480-1418-8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatctggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ023660_PreS2_P-A Feature FT:CDS JQ023660_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1160). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccgaatattgcctctcacatatcatcaatctcctcgaggactgggggccctgcca
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtgtttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgggtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JQ023661_PreS2_P-A Feature FT:CDS JQ023661_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1158). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgtctctcacatctcgtcaatctcctcgaggactggggaccctgccc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtgtttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgggtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctaacccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JQ023662_PreS2_P-A Feature FT:CDS JQ023662_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1164). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactgaaccctgttccgaatattgcctctctcatatcatcaatctcctcgaggactgggggccctgcca
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtgtttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgggtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggntcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggacccctgcaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JQ023663_PreS2_P-A Feature FT:CDS JQ023663_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1159). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctc
cagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JQ687529_PreS2_P-A Feature FT:CDS JQ687529_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Srb 176). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ687533_PreS2_P-A Feature FT:CDS JQ687533_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Srb 210). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcctgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcg
taaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707299_PreS2_P-A Feature FT:CDS JQ707299_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C1). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaatttttttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707300_PreS2_P-A Feature FT:CDS JQ707300_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgttaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707301_PreS2_P-A Feature FT:CDS JQ707301_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C12). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707302_PreS2_P-A Feature FT:CDS JQ707302_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C13). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707303_PreS2_P-A Feature FT:CDS JQ707303_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C14). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707304_PreS2_P-A Feature FT:CDS JQ707304_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C15). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707305_PreS2_P-A Feature FT:CDS JQ707305_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C16). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgaagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccctttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707306_PreS2_P-A Feature FT:CDS JQ707306_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C17). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaaactctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactagtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707307_PreS2_P-A Feature FT:CDS JQ707307_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C18). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707308_PreS2_P-A Feature FT:CDS JQ707308_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C19). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707309_PreS2_P-A Feature FT:CDS JQ707309_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctttgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707310_PreS2_P-A Feature FT:CDS JQ707310_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C20). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707311_PreS2_P-A Feature FT:CDS JQ707311_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C21). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707312_PreS2_P-A Feature FT:CDS JQ707312_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C22). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707313_PreS2_P-A Feature FT:CDS JQ707313_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C23). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707314_PreS2_P-A Feature FT:CDS JQ707314_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C24). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgttaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707315_PreS2_P-A Feature FT:CDS JQ707315_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C25). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtatctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707316_PreS2_P-A Feature FT:CDS JQ707316_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C26). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707317_PreS2_P-A Feature FT:CDS JQ707317_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C27). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaaactctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707318_PreS2_P-A Feature FT:CDS JQ707318_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C28). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaattccgctgtcttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctggtggtggctc
cagttcaggaacagtaaaccgtgctccgaatattgcctctcacatctcgtcaatctccccgaggactggggaccctgtga
ggaacgtggacaatgtcacatcagtgttcaaaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707319_PreS2_P-A Feature FT:CDS JQ707319_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatctcagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctacgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctcattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707320_PreS2_P-A Feature FT:CDS JQ707320_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C30). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707321_PreS2_P-A Feature FT:CDS JQ707321_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C31). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707322_PreS2_P-A Feature FT:CDS JQ707322_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C32). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707323_PreS2_P-A Feature FT:CDS JQ707323_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C33). Complete genome. [Hepadnaviridae] (length=846 residues).
attcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707324_PreS2_P-A Feature FT:CDS JQ707324_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C34). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccattgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707325_PreS2_P-A Feature FT:CDS JQ707325_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C35). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcatgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatatcgtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707326_PreS2_P-A Feature FT:CDS JQ707326_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C36). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccattgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707327_PreS2_P-A Feature FT:CDS JQ707327_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C37). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgattcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707328_PreS2_P-A Feature FT:CDS JQ707328_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C38). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707329_PreS2_P-A Feature FT:CDS JQ707329_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C39). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcatctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgattcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707330_PreS2_P-A Feature FT:CDS JQ707330_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707331_PreS2_P-A Feature FT:CDS JQ707331_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C40). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707332_PreS2_P-A Feature FT:CDS JQ707332_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C41). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707333_PreS2_P-A Feature FT:CDS JQ707333_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C42). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttaccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707334_PreS2_P-A Feature FT:CDS JQ707334_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C43). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgattcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707335_PreS2_P-A Feature FT:CDS JQ707335_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C44). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atacagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaataaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgattcgtaggg
ctttcccccactgtttggctttcagctatatggatgatatagtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707336_PreS2_P-A Feature FT:CDS JQ707336_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C45). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707337_PreS2_P-A Feature FT:CDS JQ707337_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C46). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcactaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707338_PreS2_P-A Feature FT:CDS JQ707338_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C47). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707339_PreS2_P-A Feature FT:CDS JQ707339_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C48). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgagtcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggc
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707340_PreS2_P-A Feature FT:CDS JQ707340_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C5). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcataataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcatctaattccaggattaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatatagtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707341_PreS2_P-A Feature FT:CDS JQ707341_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C6). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707342_PreS2_P-A Feature FT:CDS JQ707342_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C7). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707343_PreS2_P-A Feature FT:CDS JQ707343_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatatggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707344_PreS2_P-A Feature FT:CDS JQ707344_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccattgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707345_PreS2_P-A Feature FT:CDS JQ707345_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C1). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggattggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagaatctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatttggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707346_PreS2_P-A Feature FT:CDS JQ707346_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C12). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatttggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707347_PreS2_P-A Feature FT:CDS JQ707347_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C13). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707348_PreS2_P-A Feature FT:CDS JQ707348_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C14). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatatcgtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707349_PreS2_P-A Feature FT:CDS JQ707349_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C15). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatttggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707350_PreS2_P-A Feature FT:CDS JQ707350_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C16). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggcttttagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707351_PreS2_P-A Feature FT:CDS JQ707351_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C2). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgaaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatatcgtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707352_PreS2_P-A Feature FT:CDS JQ707352_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C20). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707353_PreS2_P-A Feature FT:CDS JQ707353_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C21). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaatatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707354_PreS2_P-A Feature FT:CDS JQ707354_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C22-2). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707355_PreS2_P-A Feature FT:CDS JQ707355_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C25). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatttggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707356_PreS2_P-A Feature FT:CDS JQ707356_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C28). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatttggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707357_PreS2_P-A Feature FT:CDS JQ707357_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C29-2). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatatcgtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707358_PreS2_P-A Feature FT:CDS JQ707358_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C33). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatttggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttgtgtctctgggtatacatttaa
>gnl|hbvcds|JQ707359_PreS2_P-A Feature FT:CDS JQ707359_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C35). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707360_PreS2_P-A Feature FT:CDS JQ707360_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C36). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707361_PreS2_P-A Feature FT:CDS JQ707361_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C37). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707362_PreS2_P-A Feature FT:CDS JQ707362_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C39). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707363_PreS2_P-A Feature FT:CDS JQ707363_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C4). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatttggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707364_PreS2_P-A Feature FT:CDS JQ707364_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C41). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggcggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707365_PreS2_P-A Feature FT:CDS JQ707365_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C43). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatttggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707366_PreS2_P-A Feature FT:CDS JQ707366_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C44). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707367_PreS2_P-A Feature FT:CDS JQ707367_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C46). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707368_PreS2_P-A Feature FT:CDS JQ707368_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C47). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgccggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707369_PreS2_P-A Feature FT:CDS JQ707369_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C48). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707370_PreS2_P-A Feature FT:CDS JQ707370_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C5). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccatcaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707371_PreS2_P-A Feature FT:CDS JQ707371_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707372_PreS2_P-A Feature FT:CDS JQ707372_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacagcaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtgttcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707373_PreS2_P-A Feature FT:CDS JQ707373_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C14). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707374_PreS2_P-A Feature FT:CDS JQ707374_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C15). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacgtggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707375_PreS2_P-A Feature FT:CDS JQ707375_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C17-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707376_PreS2_P-A Feature FT:CDS JQ707376_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707377_PreS2_P-A Feature FT:CDS JQ707377_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C21). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707378_PreS2_P-A Feature FT:CDS JQ707378_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C22). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattctctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707379_PreS2_P-A Feature FT:CDS JQ707379_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C24-9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707380_PreS2_P-A Feature FT:CDS JQ707380_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C27). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707381_PreS2_P-A Feature FT:CDS JQ707381_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C28). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707382_PreS2_P-A Feature FT:CDS JQ707382_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707383_PreS2_P-A Feature FT:CDS JQ707383_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C31). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707384_PreS2_P-A Feature FT:CDS JQ707384_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C32). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatagatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707385_PreS2_P-A Feature FT:CDS JQ707385_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C33). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707386_PreS2_P-A Feature FT:CDS JQ707386_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C34). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707387_PreS2_P-A Feature FT:CDS JQ707387_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C36). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
cttacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707388_PreS2_P-A Feature FT:CDS JQ707388_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C37). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaacgccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707389_PreS2_P-A Feature FT:CDS JQ707389_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C38). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707390_PreS2_P-A Feature FT:CDS JQ707390_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C39). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707391_PreS2_P-A Feature FT:CDS JQ707391_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaagtccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707392_PreS2_P-A Feature FT:CDS JQ707392_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C40). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707393_PreS2_P-A Feature FT:CDS JQ707393_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C42). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctt
tataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JQ707394_PreS2_P-A Feature FT:CDS JQ707394_PreS2_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C44). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtga
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcag