HBVdb

Dataset for nucleotide sequence PreC of genotype A

[Download (right click)] [Alignment] [Repertoires]

1228 sequence(s)

>gnl|hbvcds|AB014370_PreC_P-A Feature FT:CDS AB014370_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 11D11HCC). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB064314_PreC_P-A Feature FT:CDS AB064314_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catacggcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggttccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB076678_PreC_P-A Feature FT:CDS AB076678_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala14). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggcaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB076679_PreC_P-A Feature FT:CDS AB076679_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala35). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactattcaagcctccaagctgtgccttggctggct
ttggggcatggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaggccttagagtctccggagcattgctcacctcac
catacagcactcaggcaagccattctctgctgggtggaattaacgactctagctacctgggtgggtaataatttggaaga
tcatgcatccagggacctagtagtcaattatgtaaatgataatatgggactaaagctcagacaactattgtggtttcata
tttcttgccttacttttggaaaacaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcc
tatcgaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagagaccgaggcgggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB116076_PreC_P-A Feature FT:CDS AB116076_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-USA1911). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtgcagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcaagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagacactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgccgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaat
gttag
>gnl|hbvcds|AB116077_PreC_P-A Feature FT:CDS AB116077_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-USA2126). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB116078_PreC_P-A Feature FT:CDS AB116078_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-USA712). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcaagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataacttggacga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB116079_PreC_P-A Feature FT:CDS AB116079_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TR1). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB116080_PreC_P-A Feature FT:CDS AB116080_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TR2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB116081_PreC_P-A Feature FT:CDS AB116081_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TR3). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcaaacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB116082_PreC_P-A Feature FT:CDS AB116082_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN1). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacatcgacccttataaagaatttggagctactgtagagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagacacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcaccgcac
cacacagcactcaggcaagctgttctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtacttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaaaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB116083_PreC_P-A Feature FT:CDS AB116083_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN36). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagctactgttgagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagacacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcat
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|AB116084_PreC_P-A Feature FT:CDS AB116084_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN81). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggctggct
ttggggcatggacattgacccgtataaagaatttggagctactgtggagttactctcatttttgccgtctgacttctttc
cttccgtccgggatctactagatactgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatcaagtagtcaattatgtcaatactaacatgggcttaaagatcaggcaactattgtggtttcata
cttcttgccttacttttggaagagacactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgcgaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|AB116085_PreC_P-A Feature FT:CDS AB116085_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN83). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctttgctgggtggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB116086_PreC_P-A Feature FT:CDS AB116086_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-IND18). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgcggacttactctcgtttttgccttctgacttctttc
cttccgtccaggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgtgcattgctcacctcac
catacagcactaaggcaagccattctctgctggggggaattaaggactctaggtacctgggtgggtaataatttggacga
tcaagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagatactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagacctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaat
gttag
>gnl|hbvcds|AB116087_PreC_P-A Feature FT:CDS AB116087_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-IND8). Complete genome. [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacgtcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagacaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccacct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgacgagtccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|AB116088_PreC_P-A Feature FT:CDS AB116088_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-NEP30). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacctttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatttcgggaagccttagagtctcctgagcattgctcatctcac
catacagcactcaggcaagccattgtatgctggggggaattaatgactctaggtacctgggtgggtaataatttggaaga
tccagaatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgcctcacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB116089_PreC_P-A Feature FT:CDS AB116089_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-NEP39). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtgcagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcat
catacagcactcaggcaagccagtctctgctgggtggaattaatgactctagctacctgggtggggaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaagttgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB116090_PreC_P-A Feature FT:CDS AB116090_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-NEP40). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcttcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacatttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB116091_PreC_P-A Feature FT:CDS AB116091_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH1). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggttggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagccaccgctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgtcaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagacactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|AB116092_PreC_P-A Feature FT:CDS AB116092_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH20). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactttcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagtcgcagctctatttcgggatgccttagagtctcctgagcattgctcagctcac
cacacagcactaaggcaagtcattctctgctggggggaattaatgactctagctacctgggtgggtactaatttgcaaga
tccagcatccagggatctagtagtcagttatgttaatgataacatgggcctaaagatcaggcaattattatggtttcata
cttcttgcattacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|AB116093_PreC_P-A Feature FT:CDS AB116093_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH25). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatttactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcat
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagagactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB116094_PreC_P-A Feature FT:CDS AB116094_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH4). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB126580_PreC_P-A Feature FT:CDS AB126580_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-RU204). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctctcgtacatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccctcataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cctccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctggtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB194950_PreC_P-A Feature FT:CDS AB194950_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMR983). Complete genome. [Hepadnaviridae] (length=645 residues).
ttgcaactttttcacctctgcctaatcatctcttgtacatgtcccactattcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcatcagcgctatatcgggaagcactagagtctcctgagcattgctcgcctcac
catacagcactcaggcaagccattctctgctggggggatgtaacgaatctagctacctgggtgggtactaatttggacga
tcccgcatccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtacttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB194951_PreC_P-A Feature FT:CDS AB194951_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMR82). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtagagttactctcgtttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctatatcgggaagcccttgagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggatgtaacgaatctagccacctgggtgggtactaatttggaaga
tccggcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaacagtacttgaatatttggtttctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB194952_PreC_P-A Feature FT:CDS AB194952_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMR711). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgagatctcctagatacctccgcagctctatatcgggaagcccttgagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggagttaatgactctagccacctgggtgggtaataatttgcaaga
tccggcatccagggatcaagtagtaaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagacagactgtacttgaatatttggtttctttcggagtgtggattcgcactcctccaccc
tatagacctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB205118_PreC_P-A Feature FT:CDS AB205118_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TJ1-1-2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaacaactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB222707_PreC_P-A Feature FT:CDS AB222707_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate UZTBV102). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatcaagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|AB241114_PreC_P-A Feature FT:CDS AB241114_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PhHCC01). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB241115_PreC_P-A Feature FT:CDS AB241115_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PhCH09). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggtgaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB246317_PreC_P-A Feature FT:CDS AB246317_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate TA112). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctacttgataccgcctcagctttgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccgtactatgctggggggaattaatgactctagctacctgggtgggtaataatttggacga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaggtcagacaactattgtggtttcata
tttcttgcattacttttggaagacaaactgtcggtgagtttttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB246335_PreC_P-A Feature FT:CDS AB246335_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB246336_PreC_P-A Feature FT:CDS AB246336_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactggcgagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcttcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctatgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagagatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactgttgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtacttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB246337_PreC_P-A Feature FT:CDS AB246337_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB246338_PreC_P-A Feature FT:CDS AB246338_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB300366_PreC_P-A Feature FT:CDS AB300366_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient8). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB300367_PreC_P-A Feature FT:CDS AB300367_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient9). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB362931_PreC_P-A Feature FT:CDS AB362931_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgcacacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggatga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|AB453979_PreC_P-A Feature FT:CDS AB453979_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH1). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB453980_PreC_P-A Feature FT:CDS AB453980_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB453981_PreC_P-A Feature FT:CDS AB453981_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH3). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB453982_PreC_P-A Feature FT:CDS AB453982_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH4). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcatctcac
catactgcactcaggcaagccattctctgctggggggaattgacgactctaggtacctgggtgggtaataatttgcaaga
tccagcatccagggatcaagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaat
gttag
>gnl|hbvcds|AB453983_PreC_P-A Feature FT:CDS AB453983_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH5). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctatgctgggtggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggacctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB453984_PreC_P-A Feature FT:CDS AB453984_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH6). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB453986_PreC_P-A Feature FT:CDS AB453986_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH8). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgttcgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaacgactctaggtacctgggtgggtaataatttgcaaga
tcaaacatccagggatcaagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB453987_PreC_P-A Feature FT:CDS AB453987_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH9). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB453988_PreC_P-A Feature FT:CDS AB453988_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH10). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccgttctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactccaccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB453989_PreC_P-A Feature FT:CDS AB453989_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH11). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggttggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgagatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcagctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactttagctacctgggtgggaaataatttggaaga
tccagcatccagggacctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
cttcttgcattacttttggaagagaaattgtccttgagtatttggtctctttcggagtgtggattcgcactccaccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaacgataccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|AB480036_PreC_P-A Feature FT:CDS AB480036_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB480038_PreC_P-A Feature FT:CDS AB480038_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB480039_PreC_P-A Feature FT:CDS AB480039_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB480040_PreC_P-A Feature FT:CDS AB480040_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB480041_PreC_P-A Feature FT:CDS AB480041_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB549213_PreC_P-A Feature FT:CDS AB549213_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB697487_PreC_P-A Feature FT:CDS AB697487_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No1). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcwtgtwcatgtccyactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccktataaagaatttggagctwctgtggagttactctcktttttgccttctgacttctttc
cttccrtymgagatctyctmgacaccgcctcwgctctgtatcgrgargccttagagtctcckgarcattgytcacctcac
catacwgcactcaggcaagcyattctstgytggggkgarttgatgamtctrgcyacctgggtgggwartaatttggaaga
yccagcatccagggawytagtagtcarytatgtyaatrytaayatgggyytaaaratcagrcaactattgtggtttcaya
twtcytgycttacttttggaagagaractgtwcttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB697488_PreC_P-A Feature FT:CDS AB697488_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgartatttggtstctttyggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB697489_PreC_P-A Feature FT:CDS AB697489_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No3). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB697491_PreC_P-A Feature FT:CDS AB697491_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No6). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagargaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB697492_PreC_P-A Feature FT:CDS AB697492_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No7). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB697493_PreC_P-A Feature FT:CDS AB697493_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No8). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB697495_PreC_P-A Feature FT:CDS AB697495_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No10). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagcyattctctgctggggggaattgatgactctagcyacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagaractgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB697496_PreC_P-A Feature FT:CDS AB697496_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No11). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB697497_PreC_P-A Feature FT:CDS AB697497_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No14). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB697498_PreC_P-A Feature FT:CDS AB697498_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No15). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcktgtwcatgtccyactgttcaagcctccaagctgtgccttgggtggct
ttgggrcatggacattgacccktataaagaatttggagctwctgtggagttactctcktttttgccttctgacttctttc
cktcygtymgagatctyctmgacaccgcctcwgctctgtatcgrgargccttagagtctcckgarcattgytcacctcac
catacwgcactcaggcaagcyattctstgytggggkgarttgatgamtctrgcyacctgggtgggwartaatttggaaga
ycmagcatccagggayytagtagtcarytatgtyaatrytaayatgggywtaaaratcagrcaactattgtggtttcaya
twtcttgycttacttttggaagagaractgtwcttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB697499_PreC_P-A Feature FT:CDS AB697499_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No16). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB697501_PreC_P-A Feature FT:CDS AB697501_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No19). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB697503_PreC_P-A Feature FT:CDS AB697503_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No22). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB697504_PreC_P-A Feature FT:CDS AB697504_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No23). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB697505_PreC_P-A Feature FT:CDS AB697505_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No25). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB697506_PreC_P-A Feature FT:CDS AB697506_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No28). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB697507_PreC_P-A Feature FT:CDS AB697507_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No29). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB697508_PreC_P-A Feature FT:CDS AB697508_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No31). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB697509_PreC_P-A Feature FT:CDS AB697509_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No32). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB697511_PreC_P-A Feature FT:CDS AB697511_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No36). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB697512_PreC_P-A Feature FT:CDS AB697512_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No37). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB775198_PreC_P-A Feature FT:CDS AB775198_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB10-0707). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagataccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB775199_PreC_P-A Feature FT:CDS AB775199_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB10-0708). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB775200_PreC_P-A Feature FT:CDS AB775200_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB12-0925). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB775201_PreC_P-A Feature FT:CDS AB775201_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB12-0929). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB937791_PreC_P-A Feature FT:CDS AB937791_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB05-0890). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB937792_PreC_P-A Feature FT:CDS AB937792_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1205). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB937793_PreC_P-A Feature FT:CDS AB937793_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-0302). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB937794_PreC_P-A Feature FT:CDS AB937794_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-0666). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB937795_PreC_P-A Feature FT:CDS AB937795_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1191). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaat
gttag
>gnl|hbvcds|AB937796_PreC_P-A Feature FT:CDS AB937796_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1196). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AB937797_PreC_P-A Feature FT:CDS AB937797_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1204). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctactgacttctttc
cttccgtcaaagatcttctagacaccgcctcagctctgtatcgagatgccttagagtctcctgagcattgctcagctcac
catactgcactcaggcaagtcagcctctgctgggtggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatcaagtagtcaattatgttaataataacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttrttagacgamgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaayctcaat
gttag
>gnl|hbvcds|AB937798_PreC_P-A Feature FT:CDS AB937798_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB14-0383). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF043560_PreC_P-A Feature FT:CDS AF043560_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagacacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF043580_PreC_P-A Feature FT:CDS AF043580_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA3). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF090838_PreC_P-A Feature FT:CDS AF090838_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
ctaacgtcagagatctcctagacaccgcctcagctctgtttcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagctattctctgctggggggatgtgatgaatctagctacctgggtgggtgctaatttggaaga
tcaagcatccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcata
tctcttgccttacttttggaagagacactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaat
gttag
>gnl|hbvcds|AF090839_PreC_P-A Feature FT:CDS AF090839_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF090840_PreC_P-A Feature FT:CDS AF090840_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF090841_PreC_P-A Feature FT:CDS AF090841_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcata
tctcttgccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF090842_PreC_P-A Feature FT:CDS AF090842_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactccaccagct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF297621_PreC_P-A Feature FT:CDS AF297621_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 78). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggatctactgtggagttactctcatttttgccttctgacttctttc
cttcagtacgggatctacttgatacagcttcagctctgtatcgggaagccttagaatctccggagcattgctcccctcac
catacagcactcaggcaagccattttatgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgtcaatactaacatgggcctaaagattagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttagtctctttcggagtgtggatacgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF297622_PreC_P-A Feature FT:CDS AF297622_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 79). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtacgggatctactagacacagcatcagctctgtatcgggaagccttagagtctccggagcattgctcccctcac
catacagcactcaggcaagccattctatgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagagatctagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttagtctctttcggagtgtggatacgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF297623_PreC_P-A Feature FT:CDS AF297623_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 83). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtgcgggatctacttgacacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttagacga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaattagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgccgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF297624_PreC_P-A Feature FT:CDS AF297624_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 80). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF297625_PreC_P-A Feature FT:CDS AF297625_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 84). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcagggaaactattctttgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tcctgcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtctggattcgcactcctccagca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF350080_PreC_P-A Feature FT:CDS AF350080_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1196). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctttatcgggaagcattagaatctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagagatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcctgccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF350081_PreC_P-A Feature FT:CDS AF350081_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1199). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagttccagatctcctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagctattctctgctggggggaactaatgactctagctacctgggtgggtaataatttagaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtacttgagtatttggtatctttcggagtgtggattcgcactcttccagct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF350082_PreC_P-A Feature FT:CDS AF350082_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1213). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctttatcgggaagcattagaatctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagagatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcctgccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacggagggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF350083_PreC_P-A Feature FT:CDS AF350083_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1314F79). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcac
catacagcactcaggcaagccattatttgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcttccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcctgccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggacagaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF350084_PreC_P-A Feature FT:CDS AF350084_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1315F80). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcttccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcctgccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF350085_PreC_P-A Feature FT:CDS AF350085_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1316F79). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcagctttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcttccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcctgccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF350086_PreC_P-A Feature FT:CDS AF350086_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1330F80). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcttccagggatctagtagtcagttatgttaatactaacatgggcctaaagttcaggcaactattgtggtttcata
tttcctgccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF350087_PreC_P-A Feature FT:CDS AF350087_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1486F125). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttcagtccgagatctccttgataccgcctcagctctgaatcgtgaagccttagagtctcctgagcattgttcacctcac
catacagcactcaggcaagctattctttgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagttaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcctgccttacttttggaagagaaactgtacttgagtatttggtctcctttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF350088_PreC_P-A Feature FT:CDS AF350088_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1487F125). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgagatctccttgataccgcctcagctctgtatcgggaagcattagagtctcctgagcactgttcacctcac
catacagcactcaggcaagctattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagttaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcctgccttacttttggaagagaaactgtacttgagtatttggtctcctttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF350089_PreC_P-A Feature FT:CDS AF350089_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1606). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcat
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcctgccttacttttggaagagaaaccgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF350090_PreC_P-A Feature FT:CDS AF350090_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1687). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatcccgggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcctgccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF350091_PreC_P-A Feature FT:CDS AF350091_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1730F202). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagagatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcctgccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF350092_PreC_P-A Feature FT:CDS AF350092_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1746). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttttttc
cttccgtccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagagatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcctgccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgccgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF350093_PreC_P-A Feature FT:CDS AF350093_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1747). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttttttc
cttccgtccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgttcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagagatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcctgccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF350094_PreC_P-A Feature FT:CDS AF350094_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1800). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgagatcttctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcctgccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF350095_PreC_P-A Feature FT:CDS AF350095_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1815F214). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctttatcgggaagcattagaatctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagagatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcctgccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF350096_PreC_P-A Feature FT:CDS AF350096_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1817F214). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctttatcgggaagcattagaatctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagcgacctgggtgggtaataatttggaaga
tccagcatccagagatttagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcctgccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF350097_PreC_P-A Feature FT:CDS AF350097_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1835F222). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagagatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcctgccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF350098_PreC_P-A Feature FT:CDS AF350098_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1841F222). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctttatcgggaagcattagaatctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagagatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcctgccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF419534_PreC_P-A Feature FT:CDS AF419534_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate I5-Fam B). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgtctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatt
cttcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF419535_PreC_P-A Feature FT:CDS AF419535_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate I6-Fam B). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgtctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
ctncttgcattacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF419536_PreC_P-A Feature FT:CDS AF419536_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate I7-Fam B). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgcctcatgacttctttc
cttccgtcagagatctcctagacaccgtctcagctctgtatcgagaagccttagagtctcctgagcattgctctcctcac
catactgcaatcaggcaagccattctctgctgggggcaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatgataacatgggtttaatgatcaggcaactattgtggtttcatt
cttcttgcattacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaacggcaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF536524_PreC_P-A Feature FT:CDS AF536524_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcaactctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AF537371_PreC_P-A Feature FT:CDS AF537371_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgat
gttag
>gnl|hbvcds|AF537372_PreC_P-A Feature FT:CDS AF537372_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagagtttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccgttctctgctggggggaattgatgactctagctacttgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactgctgttgttagatgtcggggccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaat
gttag
>gnl|hbvcds|AJ012207_PreC_P-A Feature FT:CDS AJ012207_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcata
tctcttgccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AJ309369_PreC_P-A Feature FT:CDS AJ309369_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient X104). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgccaaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgttgagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcactgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggatga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AJ309370_PreC_P-A Feature FT:CDS AJ309370_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient X104). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgttgagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccc
tagaagaagaaccccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AJ309371_PreC_P-A Feature FT:CDS AJ309371_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient X104). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgttgagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcactgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcattcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AJ344115_PreC_P-A Feature FT:CDS AJ344115_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBsAg negative patient X27). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctttgctggggggaattgatgactctagcttcctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgtcaatactaacatgggtttgaagatcaggcaactattgtggtttcata
tatcttgcctcacttttggaaaagatactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcatcacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|AJ627226_PreC_P-A Feature FT:CDS AJ627226_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 20952). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctagtcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcctcctgacttctttc
cttccgccagagatctcctagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcagctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaaatattgtggtttcatc
tatcttgtattatgtttggaagagacattgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AJ627227_PreC_P-A Feature FT:CDS AJ627227_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 21077). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctartcatctcttgtacatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacctttataaagaatttggagctagtgtggagttactctcgtttttgcctkctgacttctatc
cttccgtcagagatctcctagacaccgccwcagctctrtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcaatcaggcaagccattgtctgctggggwgaattgacgaatctaggtacttgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaatcatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagaaacactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttrttagacgamgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AJ627228_PreC_P-A Feature FT:CDS AJ627228_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 34408). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctagtcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctcatgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttggagtctcctgagcattgctcacctcat
catactgcaatcaggcaatgcgttctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgattatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaattcttccggaaactactgttgttagacgacgagaccgaggtaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|AM180624_PreC_P-A Feature FT:CDS AM180624_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CAE168). Complete genome. [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgttcgagatctcctagataccgcctcagctctatttcgggaagcactagagtctcctgagcatggttctsctcac
catacagcamtcaggcaagccattctttgctggggggakgtaatgactctagccacctgggtgggtrmtaatttggaaga
tccagcatcccgggatctagtagtcaattatgtcaatactaatatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgttcttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggamtctcaat
gttag
>gnl|hbvcds|AM184125_PreC_P-A Feature FT:CDS AM184125_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate O64). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactattcaagcctccaaactgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctcctagataccgcctcagctctatatcgggaagcactagagtctcctgaacattgctctcctcac
catacagcactcaggcaagccattctctgctggggggagttaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcagacaactgttgtggtttcata
tttcttgccttacttttggaagagaaactgtacttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AM184126_PreC_P-A Feature FT:CDS AM184126_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N35). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctatatcgggaagcactagagtctcctgagcattgctctcctcac
catacagcactcaggcaagccattctctgctggggggagttaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactgttgtggtttcata
tttcttgccttacttttggaagagaaacggtacttgagtatttggtctcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AM282986_PreC_P-A Feature FT:CDS AM282986_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagcaattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AM295795_PreC_P-A Feature FT:CDS AM295795_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AM295796_PreC_P-A Feature FT:CDS AM295796_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcaaacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AM295797_PreC_P-A Feature FT:CDS AM295797_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AM410963_PreC_P-A Feature FT:CDS AM410963_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AM494718_PreC_P-A Feature FT:CDS AM494718_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CAR204). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactattcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttcttcc
cttctgtccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtttccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY034878_PreC_P-A Feature FT:CDS AY034878_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBVKL). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgagaagccttagaatctcctgagcattgcacacctcac
catactgcactcaggcaagccattctatgctggggggaattgatgactctagctacctgggtgggtaataatttggacga
tccagcatccaaggatctagtagtcaattatgttaatactaaacatgggttaaagatcaggcaactattgtgggttcata
catcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaacaacaaatgcccctatcttatcaacacttccggaagctactgttgttagacaacgggaccgacgcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY128092_PreC_P-A Feature FT:CDS AY128092_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY152726_PreC_P-A Feature FT:CDS AY152726_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 8.22). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgggaagccctagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaaatattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY161138_PreC_P-A Feature FT:CDS AY161138_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY161139_PreC_P-A Feature FT:CDS AY161139_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY161142_PreC_P-A Feature FT:CDS AY161142_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgttccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatatggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctgcggggaattaatgaccttagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtgcttgagtatgtggtctctttcggagtgtggattcgcactcctccagca
tatagaccaccaaatgcccctatcttatcagcacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagactcccttcgccttgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY161143_PreC_P-A Feature FT:CDS AY161143_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgttccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatatggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctgcggggaattaatgaccttagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtgcttgagtatgtggtctctttcggagtgtggattcgcactcctccagca
tatagaccaccaaatgcccctatcttatcagcacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY161144_PreC_P-A Feature FT:CDS AY161144_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgttccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatatggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctgcggggaattaatgaccttagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtgcttgagtatgtggtctctttcggagtgtggattcgcactcctccagca
tatagaccaccaaatgcccctatcttatcagcacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY230111_PreC_P-A Feature FT:CDS AY230111_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=638 residues).
tttttcacctctgcctaatcacctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggac
atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcctggtgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattgtctgctggggagaattgatgaatctagctacctgggtgggcaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtataaagatcaggcaactattgtggtttcatatatcttg
cattacttttggaagagaggttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|AY230113_PreC_P-A Feature FT:CDS AY230113_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=638 residues).
tttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggac
atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcctcctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctctcctcaccatactg
cactcaggcttgccattgtatgctggtgagaattgatgaatctagctacctgggtgggtaataattggcaagatccagca
tccagggatgtagtagtcaattatgttaatactaacatgggtataaagatcaggcaactattgtggtttcatatatcttg
cattacttttggaagagagattgtacttgaatatttggtctctttcggagtgtggattcgctctcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatttcaatcgccgcgtcacagaagatctcgatctcggggatcccaatgttag
>gnl|hbvcds|AY233274_PreC_P-A Feature FT:CDS AY233274_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 0962). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tcctgcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcata
tttcctgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcaggagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY233275_PreC_P-A Feature FT:CDS AY233275_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 163). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggctggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcctttttgccttctgacttctttc
cttccgtccgggatctacttgatacagcctcagcactgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaatatgggcctaaaaatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggggtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY233276_PreC_P-A Feature FT:CDS AY233276_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1839). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcttcagctctgtatcgggaagccttagagtctccggagcattgttcccctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagccacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgagatcgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY233278_PreC_P-A Feature FT:CDS AY233278_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY233279_PreC_P-A Feature FT:CDS AY233279_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 28). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcttcagctttgtatcgggaagccttagagtctccggagcattgctcccctcac
catacagcacacaggcaagccattctctgctggggggaattaatgactctagccacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcata
tttcttgtcttacttttggaagagaaacggtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgagatcgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY233280_PreC_P-A Feature FT:CDS AY233280_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY233281_PreC_P-A Feature FT:CDS AY233281_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 303). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctacttgatacagcctcagcactgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaatatgggcctaaaaatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggggtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|AY233282_PreC_P-A Feature FT:CDS AY233282_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 306). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcac
catactgcactcaggcaagcaattctctgctggggggaattaatgactctagctacctgggtggggaataatttggaaga
tcctgcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY233283_PreC_P-A Feature FT:CDS AY233283_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4038). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tcctgcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggccccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY233284_PreC_P-A Feature FT:CDS AY233284_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 5283). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctacttgatacagcctcagcactgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tcctgcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggggtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY233285_PreC_P-A Feature FT:CDS AY233285_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 795). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctcagtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtggggaataatttggaaga
tcctgcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggacccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY233286_PreC_P-A Feature FT:CDS AY233286_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 818). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgcctcacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY233287_PreC_P-A Feature FT:CDS AY233287_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 8225). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatcacttgtacatgtcccactcttcaagcctccaagctgtgccttggatggct
ttgggacatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcttcagctctgtatcgggaagccttagagtctccggagcattgctcccctcac
catacagcactcaggcaagccattctctgctggggggaattaatggctctagccacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgagatcgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY233288_PreC_P-A Feature FT:CDS AY233288_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 823). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgataccgcctcagctctgtaccgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tcctgcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattatggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY233289_PreC_P-A Feature FT:CDS AY233289_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 833). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtggggaataatttggaaga
tcctgcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY233290_PreC_P-A Feature FT:CDS AY233290_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 85). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagagtttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttcagtacgggatctacttgatacagcctcagctctgtatcgggaagccttagaatctccggagcattgctcccctcac
catacagcactcaggcaagccattctatgctggggggatgttatgaatctagcttcctgggtgggtaataatttggacga
tccagcatccagggatcaagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcata
tttcttgccttacttttggaagacaaactgttcttgagtatttagtctctttcggagtgtggatacgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY236165_PreC_P-A Feature FT:CDS AY236165_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=638 residues).
tttttcacctctacctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggac
atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcctcctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattgtctgctggggagaattgatgaatctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtataaagatcaggcaactattgtggtttcatatatcttg
cattacttttggaagagagattgtacttgaatatttggtctctttcggagtgtggattcgcactcctccggcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|AY236166_PreC_P-A Feature FT:CDS AY236166_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=638 residues).
tttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggac
atggacgttgacacttataaagaatttggcgctactgtggagttgctctcttttttgcctggtgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattgtctgctggggagaattgatgaatctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctcgtagtcaattatgttaatactaacatgggtataaagatcaggcaactattgtggtttcatatatcttg
cattacttttggaagagaggttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaangcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|AY236167_PreC_P-A Feature FT:CDS AY236167_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=638 residues).
tttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggac
atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcctggtgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattgtctgctggggagaattgatgaatctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctcgtagtcaattatgttaatactaacatgggtataaagatcaggcaactattgaggtttcatatatcttg
cattacttttggaagagaggttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaangcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggctggtcccatagaaga
agaactccctcgcctcgcagacgcagatcccaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|AY236168_PreC_P-A Feature FT:CDS AY236168_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=638 residues).
tttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggac
atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcctcctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattgtctgctggggagaattgatgaatctagccacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtataaagatcaggcaactattgtggtttcatatatcttg
cattacttttggaagagagattgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|AY236169_PreC_P-A Feature FT:CDS AY236169_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=638 residues).
tttttcacctcggcctaatcatctcttgttcatgttctactgttcaagcctccaagctgtgccttgggtggctttaggac
atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcctggtgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattgcctgctggggagaattgatgaatttagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtataaagatcaggcaactattgtggtttcatatatcttg
cattacttttggaagagaggttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttgtcaacacttccggagactactgttattagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|AY373428_PreC_P-A Feature FT:CDS AY373428_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatttactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY373429_PreC_P-A Feature FT:CDS AY373429_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtctcata
tttcttgccttacttttggaagagaaactgcccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagtagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY373432_PreC_P-A Feature FT:CDS AY373432_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY603429_PreC_P-A Feature FT:CDS AY603429_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 15T). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcgattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY603430_PreC_P-A Feature FT:CDS AY603430_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 19T). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY603431_PreC_P-A Feature FT:CDS AY603431_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 23T). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgaatcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY603432_PreC_P-A Feature FT:CDS AY603432_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 24T). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcgtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggcgctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtactagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagttaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY603435_PreC_P-A Feature FT:CDS AY603435_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 31T). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY603436_PreC_P-A Feature FT:CDS AY603436_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 32T). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY603438_PreC_P-A Feature FT:CDS AY603438_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 36T). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgaatcgcagacgcagagctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY603441_PreC_P-A Feature FT:CDS AY603441_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 59T). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY603446_PreC_P-A Feature FT:CDS AY603446_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 11T). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttccggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY707087_PreC_P-A Feature FT:CDS AY707087_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-N10). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagcaattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY738139_PreC_P-A Feature FT:CDS AY738139_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=645 residues).
aygcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaaaatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY738140_PreC_P-A Feature FT:CDS AY738140_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=645 residues).
aygcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaaatattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY738141_PreC_P-A Feature FT:CDS AY738141_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=645 residues).
aygcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaaatattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY738142_PreC_P-A Feature FT:CDS AY738142_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=645 residues).
aygcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY738143_PreC_P-A Feature FT:CDS AY738143_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=645 residues).
aygcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaaaatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY862867_PreC_P-A Feature FT:CDS AY862867_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H4-zhus). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccctgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY862868_PreC_P-A Feature FT:CDS AY862868_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H4-zhus). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggcttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY902775_PreC_P-A Feature FT:CDS AY902775_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MTB162). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY903452_PreC_P-A Feature FT:CDS AY903452_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagacacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagagatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcgttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY934763_PreC_P-A Feature FT:CDS AY934763_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ik3346). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgagatctcctggacaccgcctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtacttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY934764_PreC_P-A Feature FT:CDS AY934764_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9210699). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctgtaccgggaagcattagagtctcctgagcattgctcacctcac
cacacagcactaaggcaagccattctttgttggggggaattaatgactctagctacctgggtgggcaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcctgccttacttttggaagagaaactgtacttgagtatttggtctctttcggagtgtggattcgcactcctccagct
tatcgaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY934765_PreC_P-A Feature FT:CDS AY934765_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 24306). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgatttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgttggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatctagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagacctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY934766_PreC_P-A Feature FT:CDS AY934766_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 24233). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtgcgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggcaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaatatgggcctaaagattagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtttccttcggagtgtggattcgcactcctccagcc
tataggccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY934767_PreC_P-A Feature FT:CDS AY934767_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 27178). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgatttctttc
cttccgtccgggatctactagatacagcttcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccggcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY934768_PreC_P-A Feature FT:CDS AY934768_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 25830). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgatttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggcaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagattaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY934769_PreC_P-A Feature FT:CDS AY934769_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 23719). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgatttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY934770_PreC_P-A Feature FT:CDS AY934770_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 953642). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgatttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatctggaaga
tccagcatctagggatttagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY934771_PreC_P-A Feature FT:CDS AY934771_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 27439). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgttcgggatctactagatactgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtttctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY934772_PreC_P-A Feature FT:CDS AY934772_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1908). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctgggtggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY934773_PreC_P-A Feature FT:CDS AY934773_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9414346). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttttttc
cttctgtccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagcaattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|AY934774_PreC_P-A Feature FT:CDS AY934774_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9615549). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctacagtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|DQ020002_PreC_P-A Feature FT:CDS DQ020002_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 380). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctgcttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagccacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|DQ020003_PreC_P-A Feature FT:CDS DQ020003_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 5780). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcaccgcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgtgaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|DQ298161_PreC_P-A Feature FT:CDS DQ298161_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcacctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcctggtgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattgtctgctggggagaattgatgaatctagctacctgggtgggcaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtataaagatcaggcaactattgtggtttcata
tatcttgcattacttttggaagagaggttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaat
gttag
>gnl|hbvcds|DQ298162_PreC_P-A Feature FT:CDS DQ298162_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcctcctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctctcctcac
catactgcactcaggcttgccattgtatgctggggagaattgatgaatctagctacctgggtgggtaataattggcaaga
tccagcatccagggatgtagtagtcaattatgttaatactaacatgggtataaagatcaggcaactattgtggtttcata
tatcttgcattacttttggaagagagattgtacttgaatatttggtctctttcggagtgtggattcgctctcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatttcaatcgccgcgtcacagaagatctcgatctcggggatcccaat
gttag
>gnl|hbvcds|DQ298163_PreC_P-A Feature FT:CDS DQ298163_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcctcctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattgtctgctggggagaattgatgaatctagccacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtataaagatcaggcaactattgtggtttcata
tatcttgcattacttttggaagagagattgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaat
gttag
>gnl|hbvcds|DQ298164_PreC_P-A Feature FT:CDS DQ298164_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacgttgacacttataaagaatttggcgctactgtggagttgctctcttttttgcctggtgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattgtctgctggggagaattgatgaatctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctcgtagtcaattatgttaatactaacatgggtataaagatcaggcaactattgtggtttcata
tatcttgcattacttttggaagagaggttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaat
gttag
>gnl|hbvcds|DQ298165_PreC_P-A Feature FT:CDS DQ298165_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcctggtgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattgtctgctggggagaattgatgaatctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctcgtagtcaattatgttaatactaacatgggtataaagatcaggcaactattgaggtttcata
tatcttgcattacttttggaagagaggttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggctggtccca
tagaagaagaactccctcgcctcgcagacgcagatcccaatcgccgcgtcgcagaagatctcaatctcggggatcccaat
gttag
>gnl|hbvcds|DQ315784_PreC_P-A Feature FT:CDS DQ315784_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EI03101). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccgttctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|DQ315785_PreC_P-A Feature FT:CDS DQ315785_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EI0386). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttgggacatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttttttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctttgctggggggaattaatgactctaggtacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaat
gttag
>gnl|hbvcds|DQ315786_PreC_P-A Feature FT:CDS DQ315786_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EI057). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggttggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagacacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttaa
>gnl|hbvcds|DQ788725_PreC_P-A Feature FT:CDS DQ788725_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate serum 07/92). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtaagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtcgcccgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttgggagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EF103278_PreC_P-A Feature FT:CDS EF103278_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ran60). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttttttc
cttccgtccgagatctactagatacagcctcagctctgtatcgggaagccttagaatctcctgagcattgctcacatcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaatatgggtctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaaaacaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagatgtcgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EF208113_PreC_P-A Feature FT:CDS EF208113_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient B, serum 05/93). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU054331_PreC_C-A Feature FT:CDS EU054331_PreC_C-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatttcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgagatctcctcgataccgcctcagctctatatcgggaagcactagagtctcctgagcattgctctcctcac
catacagcactcaggcaagccattctctgctggggggagttaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactgttgtggtttcata
tttcttgccttacttttggaagagaaactgtacttgagtatttggtctcttttggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU086721_PreC_P-A Feature FT:CDS EU086721_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HRO/w4601-2002). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU185746_PreC_P-A Feature FT:CDS EU185746_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MSM9). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tataraccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU185750_PreC_P-A Feature FT:CDS EU185750_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MSM13). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=641 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
g
>gnl|hbvcds|EU185765_PreC_P-A Feature FT:CDS EU185765_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU6). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=638 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaatgcttccggaaactgctgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctca
>gnl|hbvcds|EU185774_PreC_P-A Feature FT:CDS EU185774_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H-IDU1). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=642 residues).
atgcaactttttcacctctgcctaatcatctctcgtgcgtgtcccactgttsaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttc
cttccgtcagagatctcctaracaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactatkgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gt
>gnl|hbvcds|EU185775_PreC_P-A Feature FT:CDS EU185775_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H-IDU2). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=638 residues).
ctgcaactttttcacctctscctaatcatctcttgtacgtgtcccactgttggagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaattattgtggtttcata
tatcttgccttacttttggaagagatactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccggcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctca
>gnl|hbvcds|EU185776_PreC_P-A Feature FT:CDS EU185776_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H-IDU3). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=642 residues).
atgcaactttttcacctctgcctaatcatctcttgtacgtgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctasacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactcttgctacctgggtgggtaataatttggaaga
tccaccatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactatkgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tataaaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gt
>gnl|hbvcds|EU185777_PreC_P-A Feature FT:CDS EU185777_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H-IDU4). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=643 residues).
atgcaactttttcacctctgcctaatcatctyttgtacgtgtcccactgttcaagcctccaagctgtgccktgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccktcagagatctcctasacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctytgctggggggaattgatgactcttgctacctgggtgggtaataatttggaaga
tccaccatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactatkgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tataaaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcattcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gtt
>gnl|hbvcds|EU185786_PreC_P-A Feature FT:CDS EU185786_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU11). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcwtgtacatgtccyactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctaatgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgacgactctaggtacctgggtgggtaataatttgcaaga
tccagcatccagggatcaagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU185787_PreC_P-A Feature FT:CDS EU185787_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU4). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttstrcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagatactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU185789_PreC_P-A Feature FT:CDS EU185789_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU8). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagatactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU304331_PreC_P-A Feature FT:CDS EU304331_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA84). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
attcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcktttttgcctymtgacttctttc
cttccgtccgggatctactagacacagcctcagctttgtatcgggaagccttagagtctcctgagcattgctcatctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatcaagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tytcttgccttacttttggaagagacaytgtccttgagtatttggtctckttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacaacgacaccgaggcaggtcccc
tagaggaagaactccctcgcctcgcagacsaagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU366129_PreC_P-A Feature FT:CDS EU366129_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA92). Complete genome. [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttttttc
cttccgtccgggatctactagatacagccgcagctctgtttcgggaggccttagagtctcctgagcattgctcacctcac
catacagcaatcaggcaagccattctatgctggggagaattaatgactctagctacctgggtgggtaataatttggamga
tccagcatccagggatctagtagtcaattatgttaatactcacatgggcctraagatcaggcaactattgtggtttcatm
tttcttgcatttgttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgagtccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU410082_PreC_P-A Feature FT:CDS EU410082_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ph81). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU414048_PreC_P-A Feature FT:CDS EU414048_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcacctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctatgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatcaagtagtcaattatgttaatactaacatgggtttaaagatcagacaactattgtggtttcata
tctcttgccttacttttggaagagagactgtacttgaatatttggtttctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU414049_PreC_P-A Feature FT:CDS EU414049_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgyaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccwagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcktttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggkggawktgaygactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaaaagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccasyaaatgcccctatcttatcaacacttccggaaactactgttrttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagawctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU414050_PreC_P-A Feature FT:CDS EU414050_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
acgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagctactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtttcgggaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggatgtgacgaatctagctacctgggtgggtactaatttgaatga
tcctgcatccagggatcaagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU414052_PreC_P-A Feature FT:CDS EU414052_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttc
cttccgccagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggcggatgtgacgaatctagctacctgggtgggtaataatttggaaga
tcaagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
catcttgccttacttttggaagagagactgtacttgaatatttrgtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacggaaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU414132_PreC_P-A Feature FT:CDS EU414132_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
nnnnnnnnnnnnnnnnnnnnnnnnntcatctyttgtacatgtcccmctgttcaagcctycaarctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagstactgkggagktactctcgtttttkccttytgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaarccttagagtctcytgagcattgctcacctcmc
catactgcactcaggcaagccattctytgctggggggaakkgakgactctagctacctgggtgggtaataatttggaaga
tccagcatccmmggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttkccttacttttggaagagagactgtacttgaatatttggtctctttyggagtgtggattcgcactcctccascc
yatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagaygwcgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatytyaat
gttag
>gnl|hbvcds|EU414133_PreC_P-A Feature FT:CDS EU414133_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttc
cttccgccagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggcggatgtgacgaatctagctacctgggtgggtaataatttggaaga
tcaagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
catcttgccttacttttggaagagagactgtacttgaatatttrgtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacggaaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU594383_PreC_P-A Feature FT:CDS EU594383_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU594384_PreC_P-A Feature FT:CDS EU594384_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU594385_PreC_P-A Feature FT:CDS EU594385_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU594386_PreC_P-A Feature FT:CDS EU594386_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU594387_PreC_P-A Feature FT:CDS EU594387_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU594388_PreC_P-A Feature FT:CDS EU594388_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU594389_PreC_P-A Feature FT:CDS EU594389_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU594390_PreC_P-A Feature FT:CDS EU594390_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU594391_PreC_P-A Feature FT:CDS EU594391_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU594392_PreC_P-A Feature FT:CDS EU594392_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU594393_PreC_P-A Feature FT:CDS EU594393_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU594394_PreC_P-A Feature FT:CDS EU594394_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagagatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU594395_PreC_P-A Feature FT:CDS EU594395_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagagatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU747320_PreC_P-A Feature FT:CDS EU747320_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate V51). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagaaatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaat
gttag
>gnl|hbvcds|EU859898_PreC_P-A Feature FT:CDS EU859898_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P45). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcaaacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859899_PreC_P-A Feature FT:CDS EU859899_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P44). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859900_PreC_P-A Feature FT:CDS EU859900_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P42). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859901_PreC_P-A Feature FT:CDS EU859901_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P37). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859902_PreC_P-A Feature FT:CDS EU859902_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P32). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859903_PreC_P-A Feature FT:CDS EU859903_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P40). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859904_PreC_P-A Feature FT:CDS EU859904_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P39). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859905_PreC_P-A Feature FT:CDS EU859905_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P38). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859906_PreC_P-A Feature FT:CDS EU859906_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P30). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859907_PreC_P-A Feature FT:CDS EU859907_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P29). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859908_PreC_P-A Feature FT:CDS EU859908_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P28). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859909_PreC_P-A Feature FT:CDS EU859909_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P31). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859910_PreC_P-A Feature FT:CDS EU859910_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P27). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859911_PreC_P-A Feature FT:CDS EU859911_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P26). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859912_PreC_P-A Feature FT:CDS EU859912_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P23). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttggtagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859913_PreC_P-A Feature FT:CDS EU859913_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P24). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859914_PreC_P-A Feature FT:CDS EU859914_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P20). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859915_PreC_P-A Feature FT:CDS EU859915_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P07). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859916_PreC_P-A Feature FT:CDS EU859916_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P03). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859917_PreC_P-A Feature FT:CDS EU859917_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P13). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859918_PreC_P-A Feature FT:CDS EU859918_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P17). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859919_PreC_P-A Feature FT:CDS EU859919_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P19). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttcctctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859920_PreC_P-A Feature FT:CDS EU859920_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P21). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859921_PreC_P-A Feature FT:CDS EU859921_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P08). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859922_PreC_P-A Feature FT:CDS EU859922_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P09). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859923_PreC_P-A Feature FT:CDS EU859923_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P15). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859924_PreC_P-A Feature FT:CDS EU859924_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P16). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859925_PreC_P-A Feature FT:CDS EU859925_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P22). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859926_PreC_P-A Feature FT:CDS EU859926_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P06). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859927_PreC_P-A Feature FT:CDS EU859927_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P25). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859928_PreC_P-A Feature FT:CDS EU859928_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P01). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859929_PreC_P-A Feature FT:CDS EU859929_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P43). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859930_PreC_P-A Feature FT:CDS EU859930_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C126). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859931_PreC_P-A Feature FT:CDS EU859931_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C96). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859932_PreC_P-A Feature FT:CDS EU859932_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C69). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859933_PreC_P-A Feature FT:CDS EU859933_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C67). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859934_PreC_P-A Feature FT:CDS EU859934_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C60). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859935_PreC_P-A Feature FT:CDS EU859935_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C14). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859936_PreC_P-A Feature FT:CDS EU859936_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C10). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859937_PreC_P-A Feature FT:CDS EU859937_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C40). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859938_PreC_P-A Feature FT:CDS EU859938_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C133). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcgtgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaat
gttag
>gnl|hbvcds|EU859939_PreC_P-A Feature FT:CDS EU859939_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C130). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859940_PreC_P-A Feature FT:CDS EU859940_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C122). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859941_PreC_P-A Feature FT:CDS EU859941_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C153). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859942_PreC_P-A Feature FT:CDS EU859942_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C110). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatctagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859943_PreC_P-A Feature FT:CDS EU859943_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C109). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859944_PreC_P-A Feature FT:CDS EU859944_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C105). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggacga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctcaagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859945_PreC_P-A Feature FT:CDS EU859945_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C102). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859946_PreC_P-A Feature FT:CDS EU859946_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C155). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859947_PreC_P-A Feature FT:CDS EU859947_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C85). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859948_PreC_P-A Feature FT:CDS EU859948_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C151). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859949_PreC_P-A Feature FT:CDS EU859949_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C152). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859950_PreC_P-A Feature FT:CDS EU859950_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C64). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859951_PreC_P-A Feature FT:CDS EU859951_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C62). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859952_PreC_P-A Feature FT:CDS EU859952_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C56). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccctataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctccttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgtcttacttttggaagagaaactgtgcttgagtatttggtttctttcggagtgtggattcgcactcctcctgcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggtaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859953_PreC_P-A Feature FT:CDS EU859953_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C55). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859954_PreC_P-A Feature FT:CDS EU859954_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C42). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859955_PreC_P-A Feature FT:CDS EU859955_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C39). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|EU859956_PreC_P-A Feature FT:CDS EU859956_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C35). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ349222_PreC_P-A Feature FT:CDS FJ349222_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H20). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagtc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ349224_PreC_P-A Feature FT:CDS FJ349224_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H71). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ349296_PreC_P-A Feature FT:CDS FJ349296_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactggggagttactctcttttttgccttctgacttctttc
cttccgttcgagatcttctaaacaccgcctcagctctctatcgggaagccctaaagtctcctgggcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggcaataatttggaaaa
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactatgggggtttcata
tttcttgtcttacttttggaagagaaacagtacttgagtatttggtctctttcggagtgtggattcgcactcctccagca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtagggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692554_PreC_P-A Feature FT:CDS FJ692554_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_24063). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttccgttcgagatctcctagataccgcctcagctctatatcgggaagcactagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtacttgagtatttggtctcttttggagtgtggattcgcactcctccagtc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692555_PreC_P-A Feature FT:CDS FJ692555_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_24074). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgcctcatgacttctttc
cttccgtccgagatctcctagataccgcctcasctctgtatcgggaagcactagagtctcctgagcattgctcacctcmc
catacagcaatcaggcaagccattctytgctggggggaattaatgactctagctacctgggtgggcaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactmacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacctttggaagagaaactgtacttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccacmaaatgcccctatcttatcaacacttccggaaactrctgttgttagatgtcgggaccgaggcaggtcctc
tagaagaagaactccctcacctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692557_PreC_P-A Feature FT:CDS FJ692557_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48004). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692558_PreC_P-A Feature FT:CDS FJ692558_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48008). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgccttatgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tgcagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcaca
tttcttgcattacttttggaagagaagttgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgtggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|FJ692559_PreC_P-A Feature FT:CDS FJ692559_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48032). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcaatcaggcaagccgtdctatgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagacaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacrcttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggamtctcaat
gttag
>gnl|hbvcds|FJ692561_PreC_P-A Feature FT:CDS FJ692561_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48040). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccttataaagaatttggagctactgtggagttactctcttttttgcctymtgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaayatgggcctaaaaatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttyggagtgtggattcgcactcctccaccy
tatagaccaccaaatgcccctatcttatcaacacttccggaractgctgttgttagatgtcgagcccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692562_PreC_P-A Feature FT:CDS FJ692562_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48044). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactattcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctatgctggggggaattaatgaccctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtyaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagaccaactgtccttgagtatttggtctctttcggggtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692563_PreC_P-A Feature FT:CDS FJ692563_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48049). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagacacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggactaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692564_PreC_P-A Feature FT:CDS FJ692564_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48074). Complete genome. [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgcccgggatctactagatacagcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggatgtaacgactctagctacctgggtgggtactaatttggaaga
cccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgcmttacttttggaagagaagttgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggccgaggcaggtcccc
tcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692565_PreC_P-A Feature FT:CDS FJ692565_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48077). Complete genome. [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgcccgggatctactagatacagcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggatgtaacgactctagctacctgggtgggtactaatttggaaga
cccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaagttgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccamcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagrccgaggcaggtcccc
tmgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggsaatctcaat
gttag
>gnl|hbvcds|FJ692566_PreC_P-A Feature FT:CDS FJ692566_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48090). Complete genome. [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttccgtccgggatctactagatacagccgcagctctgtatcgggaatccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|FJ692567_PreC_P-A Feature FT:CDS FJ692567_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48113). Complete genome. [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggrtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggatggcttggagtctcctgagcattgcwcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
cccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccacaaaatgcccctatcttatcaacacttccggagactactgttgttagatgtcgaaaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacmtcaat
gttag
>gnl|hbvcds|FJ692570_PreC_P-A Feature FT:CDS FJ692570_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50010). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggatgtaacgaatctagctacctgggtgggtactaatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctgaaaatcaggcaactattgtggtttcata
tttcttgccttacttttggaagacaaactgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692571_PreC_P-A Feature FT:CDS FJ692571_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50011). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccacgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692572_PreC_P-A Feature FT:CDS FJ692572_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50013). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggttggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgttcgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccgttctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccaccc
tatagacctccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaaaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaat
gttag
>gnl|hbvcds|FJ692573_PreC_P-A Feature FT:CDS FJ692573_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50014). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttc
cttcagtccgggatctacttgataccgcctcagctttgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttggaaga
tcctgcatccagggatctagttgtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaagttgtccttgagtatttggtttccttcggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcatcacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgcctcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|FJ692574_PreC_P-A Feature FT:CDS FJ692574_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50015). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692575_PreC_P-A Feature FT:CDS FJ692575_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50020). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagacacagcctcagctttgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
cttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggyaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|FJ692576_PreC_P-A Feature FT:CDS FJ692576_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50022). Complete genome. [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctttc
cttccgtccgagatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcat
catacagcactcaggcaagccattctctgctgggtggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaattgtccttgagtttttggtctctttcggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagaggacgaccccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692577_PreC_P-A Feature FT:CDS FJ692577_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50024). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccatwctatgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcaggcaactattgtggtttcata
tttcttgccttacttttggaamamaaactgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgacgcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692578_PreC_P-A Feature FT:CDS FJ692578_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50083). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692579_PreC_P-A Feature FT:CDS FJ692579_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50084). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692580_PreC_P-A Feature FT:CDS FJ692580_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50085). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692581_PreC_P-A Feature FT:CDS FJ692581_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50086). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692582_PreC_P-A Feature FT:CDS FJ692582_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50088). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692583_PreC_P-A Feature FT:CDS FJ692583_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50089). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692584_PreC_P-A Feature FT:CDS FJ692584_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50090). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692585_PreC_P-A Feature FT:CDS FJ692585_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50091). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692586_PreC_P-A Feature FT:CDS FJ692586_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50099). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttc
cttccgcccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggacttaacgactctaggttcctgggtgggtaataatttggaaga
ccaagcatccagggctctagtagtcaattatgttgatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttcagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaaaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagrtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692587_PreC_P-A Feature FT:CDS FJ692587_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50115). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcctaatgacttctttc
cttcagtccgggatctacttgataccgccgcagctttgtatcgggaggccttrgagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggatgtaatgactctaggcacctgggtgggtaataatttggaaga
tcctgcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtttttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgcaaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692588_PreC_P-A Feature FT:CDS FJ692588_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50119). Complete genome. [Hepadnaviridae] (length=648 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttc
cttccgtccgggatctattagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
cccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccggcaaggcaggtc
ccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
aatgttag
>gnl|hbvcds|FJ692590_PreC_P-A Feature FT:CDS FJ692590_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50152). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
cccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692591_PreC_P-A Feature FT:CDS FJ692591_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50167). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
cccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692592_PreC_P-A Feature FT:CDS FJ692592_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50175). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctatc
cttcagtccgggatctacttgataccgcctcagctttgtatcgggaaggcttagaatctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgstggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tcctgcatccagggatctagtggtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtttccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaat
gttag
>gnl|hbvcds|FJ692593_PreC_P-A Feature FT:CDS FJ692593_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48054). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacctktataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctgtttcgggaagcattagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctatgctggggggaattaatgactctagctacctgggtgggtaataatttggacga
tccagtatccagggatctagtagtcaattatgttaatactaacatgggcctaaggatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tataraccacaaaatgcccctatcttatcaacacttccggaaactrctgttgttagacgacgaggcaggtcccctagaag
acgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ692595_PreC_P-A Feature FT:CDS FJ692595_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48093). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagctactgtggagttactctcttttttgcctaatgacttctttc
cttccgtccgagatctcctagataccgccacagctctgtatcgggaagcattagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatgataacatgggcataaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaattgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccc
tatagaccactaaatgcccctatcttatcaacacttccggaaactactgttgttagacaacgataccgaggcaggtcccc
tagaagacgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|FJ692596_PreC_P-A Feature FT:CDS FJ692596_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48103). Complete genome. [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgttgagttactctcttttttgcctkctgacttctttc
cttccgtccgagatctactagataccgcctcagctctgtatcgggaagcattagagtctcctgagcattgctctcctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
cttcttccattacttttggaagagaamttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagacgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|FJ692597_PreC_P-A Feature FT:CDS FJ692597_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48125). Complete genome. [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctytgcctaatcatctyttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatygacccttataaagaatttggagcttctgtggagttactctcttttttgcctactgacttcttcc
cttccgtccgagatcttytagataccgcctcagctctgtttygggaagcattagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctytgytggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatcaagtagtcaattatgttaataytaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagacattgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacwacgamtccgaggcaggtcccc
tagaagacgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|FJ692598_PreC_P-A Feature FT:CDS FJ692598_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50018). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtrgagttactctcttttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaagtaatgratctaggtaactgggtgggtaataatttggaaga
tcmagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagamactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccc
tatagaccayyaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagacgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692599_PreC_P-A Feature FT:CDS FJ692599_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50033). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctaccgtggagttactctcttttttgccttctgatttctttc
cttccgtccgagatctcctagataccgcctcagctctgtatcgggaagcattagagtctcctgagcattgcacacctcac
catacagcaatcaggcaagccattctytgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagatactgtacttgaatatttggtgtctttcggagtgtggattcgcactcctccagcc
tatagaccagtaaatgcccctatcctatcgacacttcctgaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagacgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|FJ692600_PreC_P-A Feature FT:CDS FJ692600_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50034). Complete genome. [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggayattgacccttataaagaatttggagctactgtggagttactctcttttttgcctactgattactatc
cwtccgtccgagatctcctagataccgcctcagctctstatcgggawgcattagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccatwctmtgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatcwagtagtcaattatgttaatmataacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagatactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgasaccgaggcaggtcccc
tagaagacgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692601_PreC_P-A Feature FT:CDS FJ692601_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50035). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagacgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692602_PreC_P-A Feature FT:CDS FJ692602_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50041). Complete genome. [Hepadnaviridae] (length=645 residues).
acgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtagagttactctcttttttgcctgctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctgcatcgggaagcattagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggacttatcgactctagctacctgggtgggtaataatttggcaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagacaaattgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagacgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692603_PreC_P-A Feature FT:CDS FJ692603_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50050). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccattataaagaatttggagctwctgtggagttactctcttttttgccttctgacttctatc
cttccgtccgagatctcctagataccgccacagctctgtatcgggamkcattagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagacgaactccctcgcctcgcagacgaagaactcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692604_PreC_P-A Feature FT:CDS FJ692604_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50052). Complete genome. [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcctgctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggacttaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaccacgggcctaaggatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagatactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagacgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692605_PreC_P-A Feature FT:CDS FJ692605_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50059). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccmttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcrgctctgtatcgggaagcattagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggawga
tccagcrtccagggatctagtagtcaattatgttaatactmacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaaytgtacttgaatatttggtctctttcggagtgtggatacgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagacgtactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaayctcaat
gttag
>gnl|hbvcds|FJ692606_PreC_P-A Feature FT:CDS FJ692606_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50061). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctgtatcgggaagcattagagtctcctgagcattgcacacctcac
catacagcactcaggcaagccattctctgctggggggagttaatgactctagctacctgggtgggtaataatttggacga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagacaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagacgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692607_PreC_P-A Feature FT:CDS FJ692607_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50068). Complete genome. [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagctactgtggagttactctcttttttgcctgctgacttctttc
cttccgtacgagatctcctagataccgcctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccatactatgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tcccgcatccagggatctagtagtcaattatgtcaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacctttggaagagaaattgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccc
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaggagaccgaggcaggtccct
tagaagacgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|FJ692608_PreC_P-A Feature FT:CDS FJ692608_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50075). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctgtatcgggaagcattagagtctcctgagcattgcacacctcac
catacagcactcaggcaagccattctctgctggggggagttaatgactctagctacctgggtgggtaataatttggacga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagacaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagacgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692609_PreC_P-A Feature FT:CDS FJ692609_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50098). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcctacttttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagctagtgtggagttactctcttttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaacgactctaggtacctgggtgggtaataatttgcaaga
tccagcatccagggatcaagtagtcarttatgttaatactcacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccascc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagacgtactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|FJ692610_PreC_P-A Feature FT:CDS FJ692610_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50104). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcctacttttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacmcgtataaagaatttggagctagtgtggagttactctcttttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctgtatcgggaagcattagagtctcckgagcatwkctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaacgactctagstacctgggtgggtaataatttgcaaga
tccagcatccagggatcaagtagtcrattatgttaatactcacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagacyaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagrccgaggcaggtcccc
tagaagacgtactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|FJ692611_PreC_P-A Feature FT:CDS FJ692611_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50127). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacttataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagcttcctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagaccaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagacgaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ692612_PreC_P-A Feature FT:CDS FJ692612_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50132). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccmttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactmacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccascc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagacgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaayctcaat
gttag
>gnl|hbvcds|FJ692613_PreC_P-A Feature FT:CDS FJ692613_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50156). Complete genome. [Hepadnaviridae] (length=645 residues).
ttgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttccatccgagatctcctagataccgcctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcac
catacagcaatcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataacttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgagatcgaggcaggtcccc
tagaagacgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcact
gttag
>gnl|hbvcds|FJ867946_PreC_P-A Feature FT:CDS FJ867946_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HCCMPC5). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=637 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgaccgttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
>gnl|hbvcds|FJ867947_PreC_P-A Feature FT:CDS FJ867947_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HCCMPC9). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=637 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
>gnl|hbvcds|FJ867948_PreC_P-A Feature FT:CDS FJ867948_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HCCMPC17). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=637 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgaccgttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
>gnl|hbvcds|FJ867949_PreC_P-A Feature FT:CDS FJ867949_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HCCMPC4). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=637 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgaccgttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
>gnl|hbvcds|FJ867958_PreC_P-A Feature FT:CDS FJ867958_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HCCNPC2). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=637 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgaccgttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctacttgatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
>gnl|hbvcds|FJ867959_PreC_P-A Feature FT:CDS FJ867959_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HCCNPC13). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=637 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
>gnl|hbvcds|FJ867960_PreC_P-A Feature FT:CDS FJ867960_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HCCNPC21). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=637 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttgggacatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
>gnl|hbvcds|FJ867961_PreC_P-A Feature FT:CDS FJ867961_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HCCNPC36). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=637 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctacttgatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
>gnl|hbvcds|FJ867962_PreC_P-A Feature FT:CDS FJ867962_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HCCNPC79). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=637 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctacttgatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
>gnl|hbvcds|FJ867985_PreC_P-A Feature FT:CDS FJ867985_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LCMPC19). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=637 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccatcctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaacttctgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
>gnl|hbvcds|FJ867986_PreC_P-A Feature FT:CDS FJ867986_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LCMPC26). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=637 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttgggacatggacattgaccgttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccatcctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaacttctgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
>gnl|hbvcds|FJ867994_PreC_P-A Feature FT:CDS FJ867994_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LCNPC13). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=637 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctaccgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccatcctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
>gnl|hbvcds|FJ867995_PreC_P-A Feature FT:CDS FJ867995_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LCNPC29). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=637 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctacttgatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggagctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
>gnl|hbvcds|FJ868002_PreC_P-A Feature FT:CDS FJ868002_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CHMPC58). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=637 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgaccgttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcatggctcacctcac
catacagcactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtattaatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaagctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccacccaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
>gnl|hbvcds|FJ868007_PreC_P-A Feature FT:CDS FJ868007_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CHNPC59). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=637 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctacttgatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctttgctggggggaattaatgaatctagctacctgggtgggtaataatttggaaga
tccagcatctagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
>gnl|hbvcds|FJ868008_PreC_P-A Feature FT:CDS FJ868008_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CHNPC87). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=637 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcctgctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcat
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctc
>gnl|hbvcds|FJ904411_PreC_P-A Feature FT:CDS FJ904411_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A55). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctatc
cttcagtccgggatctcctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattaacggatctaggttcctgggtgggtaataatttgcaaga
tccagcatccagggatcaagtagtcaattatgttaatactaatatgggcctaaagatcaggcaaatattgtggtttcata
tctcttgtcttacttttgggagggaaactgtacttgagtatttggtctctttcggggtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FJ904434_PreC_P-A Feature FT:CDS FJ904434_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate B21). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctcgtgacttctttc
cttcagtccgggatctcctagataccgcctcagctctgtatcgggaagccttagagtcacctgagcattgctcacctcac
cataccgcaattcggcaaatcattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttgsaaga
tccagcatccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcata
tctcttgccttacttttggaagagaaactgtaattgagtatttggtctctttcggggtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FM199974_PreC_P-A Feature FT:CDS FM199974_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttc
cttcggtccgggatctacttgatacagcctcagctctgtatcgggatgccttggagtctcctgagcattgctcccctcac
catacagcactcaggcaagccattctctgctggggggaattaatggctctagcctcctgggtgggtaataatttggacga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcata
cttcttgcattacttttggaagggaaactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|FM199975_PreC_P-A Feature FT:CDS FM199975_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctatatcgggaagccttagagtctyctgagcattgcwcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tcctgcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttrtcaacacttccggaaactactgttgttagatgtcgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaat
gttag
>gnl|hbvcds|FM199976_PreC_P-A Feature FT:CDS FM199976_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcycactgttcaagcctccaagctgtgccttggatggct
ttgrggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagttcgggatctacttgacacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccrttctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagattagacaamtattgtggtttcata
tttcttgccttacttttggaagagagactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggyaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FM199977_PreC_P-A Feature FT:CDS FM199977_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
ttgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggttggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgcagcgggaagccttagagtctcatgagcattgctcacctcat
catacagcactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcata
tttcttgccttactttcggaagagatactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccwccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagacgaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FM199978_PreC_P-A Feature FT:CDS FM199978_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtcacctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttagaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcata
tttcttgccttacttttgggagagaaactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FM199979_PreC_P-A Feature FT:CDS FM199979_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcata
tttcttgccttactttcggaagagaaactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FM199980_PreC_P-A Feature FT:CDS FM199980_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctttgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagcaattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcata
tttcttgccttactttcggaagagaaactgtccttgagtatttggtctcctttggagtgtggattcgcacacctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FM199981_PreC_P-A Feature FT:CDS FM199981_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctscctaatcatctcttgtacatgtcccactgttcaagcctcctagctgtgccttggrtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctrtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgwctctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcata
tttcttgccttacttttggaagagacactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccrcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FN545825_PreC_P-A Feature FT:CDS FN545825_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctatatcgggaagcccttgagtctcctgagcattgttcaccgcac
catacagcactaaggcaagccgttctctgctggggggagttaatgactctagccacctgggtgggtaataatttgcaaga
tccagcatccagggacctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgtcttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagawctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FN545826_PreC_P-A Feature FT:CDS FN545826_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactyttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccttataaagaatttggagctactgtggagttaatctcgtttttgccttctgacttctttc
cttccgttcgagatcttctagataccgcctcagctctctatcgggaagcactagagtctcctgagcattgttcacctcac
catacmgcactcaggcaagccattctctgctggggggacttaatgactttagctacctgggtgggcaataatttggaaga
tccggcatccagggatctagtagtcaattatgttaataataccacgggcttaaagatcaggcaactattgtggtttcaya
tttcttgtcttacttttggaagagacaccgtacttgagtatttggtctctttcggagtgtggattcgcactcctccagca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|FN545828_PreC_P-A Feature FT:CDS FN545828_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactcttcaagcctccaagctgtgccttgggkggct
ttggggcatggacattgacccttataaagaatttggcgctactgtagagttactctcttttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctgtttcgggaagcattggaatcacctgagcattgtacacctcac
catacagcactcaggcaagccattctttgctggggggaattaatgactctagcttcctgggtgggtaataatttgcaaga
tccagcatccagggatcaagtagtcgattatgttaacactaacatgggcctaaaaatcaggcaactattgtggtttcata
tttcttgtctcacttttggaagacaaactgtacttgagtatttggtatcttttggagtgtggattcgtactcctccaccc
tacagaccactaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggacccaggccggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FN545829_PreC_P-A Feature FT:CDS FN545829_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcatctcttgtacatgtcccactyttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttccgcccgagatctcctagataccgcctcagccctgtatcgggaaggattggaatcacctgagcattgtacacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctcgtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcata
tttcttgtctcacttttggaagagaggttgtacttgagtatttggtatcttttggagtgtggattcgcactcctccagcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgagctcggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FN545830_PreC_P-A Feature FT:CDS FN545830_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttccgtccgagatctcctagatacagcctcagccctgtttcgggaagcattggaatcacctgagcattgtacacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgtctcacttttggaagagatattgtactggagtatttggtatcttttggagtgtggattcgcactcctccagcc
tacagaccactaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagggaccgaggtcggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|FN545831_PreC_P-A Feature FT:CDS FN545831_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactattcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctatatcgggaagcactagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcata
tttcttgtcttacttttggaagagaaacggtacttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FN545832_PreC_P-A Feature FT:CDS FN545832_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggvtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcctgctgacttctttc
cttccgtycgagatctcctagataccgcctcagctctgtttcgggamgctttggaatcaccagagcattgtacacctcac
catacagcactcaggcaagccattctctgctggggggaaktaatgactctagctacctgggtgggtaataatttggacga
tccagcatccagggatctagtagtcaattatgtyaatactmacatgggcctaaagatcagrcaactattgtggtttcata
tttcttgtctcacttttggaagagaaaytgtgcttsagtatttggtatcttttggagtgtggattcgcactcctccagcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagaygmagggaccgaggtcggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctmaat
gttag
>gnl|hbvcds|FN545833_PreC_P-A Feature FT:CDS FN545833_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctgtttcgggaagcattagagtcacctgagcattgttcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaactatgttaatactaacatgggcctaaagatcaggcaaatattgtggtttcata
tttcttgtctcacttttggaagagaagttgtgcttgagtatttggtatcttttggagtgtggattcgcactcctccagcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FN545834_PreC_P-A Feature FT:CDS FN545834_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttccgcccgagatctcctagagaccgcctcagctctgtatcgggaagcattagagtcacctgagcattgttcacctcac
catacagcactcaggcaagccattctctgctgggtggaattaatgactctagctacctgggtgggtaataatttggatga
tccagcatccagggatctagtagtcaactatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgtatcacttttggaagagaagttgtgcttgagtatttggtatcttttggagtgtggattcgcactcctccagcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FN545835_PreC_P-A Feature FT:CDS FN545835_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctgtatcgggaagcattggaatcacctgagcattgtacacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaacactaacatgggcctaaaaatcaggcaactattgtggtttcata
tttcttgtctcacttttggaagagaaactgtacttgagtatttggtatcttttggagtgtggattcgtactcctccagcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggccggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FN545836_PreC_P-A Feature FT:CDS FN545836_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaarctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttccgtccgagacctcctagataccgcctcagctctatatcgggaagcactagagtctcctgagcattgctcacctcat
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtacttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FN545837_PreC_P-A Feature FT:CDS FN545837_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcgactgtggagttactctcttttttgccttctgacttctttc
cttccgtccgagatctgcttgacactgcctcagcgctgtatcgggaagccttagagtctcctgagcattgttcacctcat
catacggccctcaggcaagccattctytgctggggggaattaatgamtctagctacctgggtgggcaataatttgcaaga
cccagcttccagggatttagtggtcaattatgtcaacactaacatgggcttaaagattagacaamtattgtggtttcata
tctcttgccttacttttggaagagaaaccgtgcttgagtatttggtatcttttggagtgtggattcgcactcctccagca
tacagaccacttaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggtcggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FN545838_PreC_P-A Feature FT:CDS FN545838_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
ttgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctatttcgggaagcattagagtctcctgagcattgctctcctcac
catacggcactcaggcaagccattctctgctggggggatgtaatgtctctagctacctgggtgggtactaatttggaaga
tccagcatccagggaacaagtagtcagttatgttaatactaatatgggcctgaagatcaggcaactgttgtggtttcata
tttcttgccttacttttggaagagaagttgtacttgagtatttggtctcttttggggtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagactacggaaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|FN545839_PreC_P-A Feature FT:CDS FN545839_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcctkcggacttctttc
cttccgtccgagatctcctagataccgcctcagctctgtatcgggatgcattggaatcacctgagcattgtacacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagccacctgggtgggcaataatttggatga
tccagcatccagggatctagtagtcaattatgttaatactcacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgtctcacttttggaagagamactgtgcttcagtatttggtatcttttggagtgtggattcgcactcctccagcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagakgtagggaccgaggccggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaat
gttag
>gnl|hbvcds|FN545840_PreC_P-A Feature FT:CDS FN545840_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagagtttggagctactgtggagttactctcttttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagccctgtatcgggaagcattggaatcacctgagcattgtacacctcac
catacagcactcaggcaagccattctctgctgggtggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgtctcacttttggaagagaaactgtgcttgagtatttggtatcttttggagtgtggattcgcactcctccaccc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggtcggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|GQ161813_PreC_P-A Feature FT:CDS GQ161813_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GU1021). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtaagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcac
cacacwgcactmaggcaagccattctttgytggggggaattaatgactctagctacctgggtgggcaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcctgccttacttttggaagagaaactgtacttgagtatttggtctctttcggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ184323_PreC_P-A Feature FT:CDS GQ184323_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1121). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ184324_PreC_P-A Feature FT:CDS GQ184324_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1122). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactctggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ222208_PreC_P-A Feature FT:CDS GQ222208_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1123). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggcgggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaat
gttag
>gnl|hbvcds|GQ331046_PreC_P-A Feature FT:CDS GQ331046_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-188). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccctataaagaatttggagctactgtggagttactctcatttttgcctgctgacttctttc
cttccgtccgggatctactagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgtcaatactaacatgggcctaaagatcaggcaactattgtggtttcaca
tctcttgtcttacttttggaagagaagttgtacttgagtatttggtctctttcggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaat
gttag
>gnl|hbvcds|GQ331047_PreC_P-A Feature FT:CDS GQ331047_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-56). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccctataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctccttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgtcttacttttggaagagaaactgtgcttgagtatttggtttctttcggagtgtggattcgcactcctcctgcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggtaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcaaaagatctcaatctcgggaatcccaat
gttag
>gnl|hbvcds|GQ414522_PreC_P-A Feature FT:CDS GQ414522_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtaccgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477461_PreC_P-A Feature FT:CDS GQ477461_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P3). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477462_PreC_P-A Feature FT:CDS GQ477462_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P4). Complete genome. [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctcatgacttctatc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagaatctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgacgagtctaggcacctgggtgggtaataatttggacga
tcaagcatccagggatctagtagtcaattatgttaatactaacatgggcttaaagctcaggcaactattgtggtttcaca
tatcttgccttacttttggaagagagactgtaattgaatatttggtctctttcggagtgtggattcgcactcctcaagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctccatctcggggatctcaat
gttag
>gnl|hbvcds|GQ477463_PreC_P-A Feature FT:CDS GQ477463_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P5). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgatcattgcacacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagcttcctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaactcttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|GQ477464_PreC_P-A Feature FT:CDS GQ477464_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P8). Complete genome. [Hepadnaviridae] (length=645 residues).
ttgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctcttgacttctttc
cttcagtccgagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctgggtggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tctcttgcattacttttggaagagaaactgtacttgagtatttagtctctttcggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|GQ477465_PreC_P-A Feature FT:CDS GQ477465_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P10). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctttgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagcttcctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcgattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgtttgtagacgacgggtccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477466_PreC_P-A Feature FT:CDS GQ477466_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P12). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctrgacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacatcac
catactgcactcaggcaagccgttctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatc
tatcttgccttatgtttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477467_PreC_P-A Feature FT:CDS GQ477467_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P14). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477468_PreC_P-A Feature FT:CDS GQ477468_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P16). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctatgctggggggacgtgatgacyctagctacctgggtgggtaataatttggaaga
tcttgcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477469_PreC_P-A Feature FT:CDS GQ477469_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P19). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgctgagttactctcatttttgcctctggacttctttc
cttccgttagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcagctcac
catactgcactcaggcaagccgttctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tcaagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaatccttccggaaactactgttattagacgacgggaccgaggtaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477470_PreC_P-A Feature FT:CDS GQ477470_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P20). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctcctagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttttgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgacgaatctaggtacctgggtgggtaataatttggaaga
tcaagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactccttcagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477472_PreC_P-A Feature FT:CDS GQ477472_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P24). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctttc
ctggcgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattaacgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaataccaacatgggtttaaaaatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaatacttccggaaactactgttattagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477473_PreC_P-A Feature FT:CDS GQ477473_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P27). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctcttgacttctttc
cttccgccagagatctcctagacaccgcctcagctctgtatcgagaaggcttagagtcacctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattaacggctctagctacctgggtgggtggcaatttggacga
tccagcatccagggatcaagtagtcaattatgttaacactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgattatttggtctcttttggagtgtggattcgcactcctccggcc
tatagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgtcgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaat
gttag
>gnl|hbvcds|GQ477474_PreC_P-A Feature FT:CDS GQ477474_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P28). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttaatctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtcttctgagcattgctcacctcac
catactgcaatcaggcatgtccttctctgctgggtggaattgatgactctagctaactgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagacagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgagtcaggtcccc
tagaagaagaactccctcgcctcgcagacgcmgatctcaatcgccgcgtcgcagaagatctccatctcgggaacctcaat
gttag
>gnl|hbvcds|GQ477475_PreC_P-A Feature FT:CDS GQ477475_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P29). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttaggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcac
catactgcaatccggcaagtcgttctatgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tcaagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtaattgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccactaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477476_PreC_P-A Feature FT:CDS GQ477476_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P30). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggcgctactgctgagttactctcgtttttgcctactgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattaagtactctagctacctgggtgggtaataatttgcaaga
tccagcatccagagatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatg
tatcttgcattatttttggaagagagatagtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477477_PreC_P-A Feature FT:CDS GQ477477_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P31). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgcgagcttactctcgtttttgcctcatgacttctttc
cttccgtcagagatctcctagacaccgccacagctctgtttcaagaagccttagagtctcctgagcattgctcatctcac
catactgcaatcaggcaagccattctctgctggggggaattgatgtctctagcttcctgggtgggtaataatttggacga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagatactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477478_PreC_P-A Feature FT:CDS GQ477478_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P34). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttacctactgactactatc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaaatactgttgttagaccacggggccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttaa
>gnl|hbvcds|GQ477479_PreC_P-A Feature FT:CDS GQ477479_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P40). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctgctgactactatc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477480_PreC_P-A Feature FT:CDS GQ477480_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P41). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccttataaagaatttggagcttctacggagttactctcgtttttgccttctgacttctttc
ctaacgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgcacacctcac
catactgcactcaggcaagccgttctctgctggggggaattgatgaatctagctacctgggtgggtagtaatttgcaaga
tccagcatccagggatctagtagtcaattatgtcaatactaacatgggtttaaagttcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgacgcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477482_PreC_P-A Feature FT:CDS GQ477482_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P46). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccattataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattatctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagagatctagtagtcaattatgttaatactaacatgggtttaaagctcaggcaactattgtggtttcata
tttcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477484_PreC_P-A Feature FT:CDS GQ477484_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P54). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggatgtgatgtctctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacagcaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477486_PreC_P-A Feature FT:CDS GQ477486_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P57). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcctcatgacttctttc
cttccgtcagagatctcctagacaccgccgcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctatgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
catcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477487_PreC_P-A Feature FT:CDS GQ477487_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P60). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctcatgacttctatc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgtcgactctagctacctgggtgggtaataatttgcaaga
ttcagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
catcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tataggccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggccggtcccc
tagaggaagaactccctcgcctcgcagacgcagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477488_PreC_P-A Feature FT:CDS GQ477488_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P64). Complete genome. [Hepadnaviridae] (length=645 residues).
acgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcctgctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacatcac
catactgcaatcaggcaagccattctctgctggggggaattgatgactctagcttcctgggtgggtaataatttggatga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagattgtacttgaatttttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477490_PreC_P-A Feature FT:CDS GQ477490_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P74). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtcgagttactctcgtttttgccttctgacttctttc
cttccgccagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggatgtgatgactctagctacctgggtgggtagtaatttggaaga
tccagcatccagggatcaagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccatcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477491_PreC_P-A Feature FT:CDS GQ477491_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P75). Complete genome. [Hepadnaviridae] (length=645 residues).
acgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccttataaagaatttggagcttctgtggacttactctcttttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatt
catcttgcattacttttggaagagatactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccactaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctagggaacctcaat
gttag
>gnl|hbvcds|GQ477493_PreC_P-A Feature FT:CDS GQ477493_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P79). Complete genome. [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctactgacttctttc
cttccgccagggatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcaatcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaacaatttggacga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgcattacttttggaagagatactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccactaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgacgccggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477494_PreC_P-A Feature FT:CDS GQ477494_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P80). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctactgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccgtgctatgctggggggaattgatgactttagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477495_PreC_P-A Feature FT:CDS GQ477495_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P89). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgttccgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagttgtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaacaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477496_PreC_P-A Feature FT:CDS GQ477496_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P94). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
catcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgagtcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477497_PreC_P-A Feature FT:CDS GQ477497_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P98). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttaggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgacgactctaggtacctgggtgggtaataatttgcaaga
tccagcatccagggatcaagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaatgtactgttattagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcact
gttag
>gnl|hbvcds|GQ477498_PreC_P-A Feature FT:CDS GQ477498_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P100). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccgttctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtaattgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccatcaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477499_PreC_P-A Feature FT:CDS GQ477499_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P105). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctcctagctgtgccttrggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctcttgacttctatc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgcacacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatcaagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctcttttggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgacgcaggtcccc
tagaagaagaactccctcgcctcgcagacgcaaatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477500_PreC_P-A Feature FT:CDS GQ477500_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P107). Complete genome. [Hepadnaviridae] (length=645 residues).
atacaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctttc
cttccgtcaaagatcttctagacaccgcctcagctctgtatcgagaagccttagagtcttctgagcattgctcacctcac
catactgcaattaggcaagtcattctctgctggggggatgtgatgactctaggtacctgggtgggtaataatttggaaga
tccagcctccaaggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477501_PreC_P-A Feature FT:CDS GQ477501_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P116). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctacagtggagttactctcgtttttgcctcatgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgacaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctatgctggggggaattgacgactttaggtacctgggtgggtaataatttgaacga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagatactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaatgcttccggaaactgctgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477502_PreC_P-A Feature FT:CDS GQ477502_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P123). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttc
ctaacgttagagatctcctagacaccgcctcagccctatatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggacttgatgaatctagctacctgggtgggtggtaatttgcaaga
cccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcata
tatcttgccttacttttggaagagagactgtacttcaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagaccacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaat
gttag
>gnl|hbvcds|GQ477503_PreC_P-A Feature FT:CDS GQ477503_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P130). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GQ477504_PreC_P-A Feature FT:CDS GQ477504_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P131). Complete genome. [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagagtttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgtcgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatcaagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagaggttgtacatgaatatttggtctcttttggggtgtggattcgcactcctccagcc
tatagaccaataaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GU563545_PreC_P-A Feature FT:CDS GU563545_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-5). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttcagtccgggatctatgtgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgtcaatactaacatgggcctaaagattagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GU563546_PreC_P-A Feature FT:CDS GU563546_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-66). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GU563547_PreC_P-A Feature FT:CDS GU563547_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-23). Complete genome. [Hepadnaviridae] (length=645 residues).
ttgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggttggct
ttggggcatggacattgacccttataaagaatttggagctactacggacttactctcttttttgccttctgacttctttc
cttcagtccgggatctacgtgatacaacctcagctctgtatcgggaagccttagagtctcctgagcattgctcatctcac
catacagcaatcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatc
tttcttgcattacttttggaagagacactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|GU563548_PreC_P-A Feature FT:CDS GU563548_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-108). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggacctagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GU563550_PreC_P-A Feature FT:CDS GU563550_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-204). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtgggt
ttggggcatggacattgacccttataaagaatttggagctactggggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GU563551_PreC_P-A Feature FT:CDS GU563551_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-124). Complete genome. [Hepadnaviridae] (length=645 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttttttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgcacacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagtc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaat
gttag
>gnl|hbvcds|GU563553_PreC_P-A Feature FT:CDS GU563553_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-10). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GU563554_PreC_P-A Feature FT:CDS GU563554_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-25). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GU563555_PreC_P-A Feature FT:CDS GU563555_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-35). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GU563557_PreC_P-A Feature FT:CDS GU563557_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-78). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagaatctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
cccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GU563558_PreC_P-A Feature FT:CDS GU563558_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-90). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccggcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GU563562_PreC_P-A Feature FT:CDS GU563562_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-189). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|GU827640_PreC_P-A Feature FT:CDS GU827640_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMC25B). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttttttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgacgtctctaggtacctgggtgggtaataatttggaaga
tcaagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|HE576988_PreC_P-A Feature FT:CDS HE576988_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P5.9). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaataataacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|HE576989_PreC_P-A Feature FT:CDS HE576989_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P2.2.11). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|HM011485_PreC_P-A Feature FT:CDS HM011485_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgtaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggctggct
ttggggcatggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgcwcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggatga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcctgccttacttttggaagacaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccaaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|HM042263_PreC_P-A Feature FT:CDS HM042263_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 469). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=642 residues).
atgcaactttttcccctctgcctaatcatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtg
gctttagggcatggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttct
ttccttcagtacgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctgctgagcattgctcacct
caccatactgcactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtaataatttgga
agatccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttc
atatttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctcca
gcctatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctag
aagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgtt
ag
>gnl|hbvcds|HM535200_PreC_P-A Feature FT:CDS HM535200_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 947 Harare). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgcggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|HM535205_PreC_P-A Feature FT:CDS HM535205_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 72 Mutare). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaattagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcggacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JF440016_PreC_P-A Feature FT:CDS JF440016_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05B11). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
ctttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttgggg
catggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccg
tcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacc
gcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagc
atccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctctt
gccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctataga
ccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN182318_PreC_P-A Feature FT:CDS JN182318_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atnnnnctttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JN182319_PreC_P-A Feature FT:CDS JN182319_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttnnnnnnnnnnnnnnnnnnnnnnnnncatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctacttgacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JN182320_PreC_P-A Feature FT:CDS JN182320_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
nnnnnnnnnnnnnncctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JN182321_PreC_P-A Feature FT:CDS JN182321_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JN182322_PreC_P-A Feature FT:CDS JN182322_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
nnnnnnctttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JN182323_PreC_P-A Feature FT:CDS JN182323_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
nnnnnnctttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcctacggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JN182324_PreC_P-A Feature FT:CDS JN182324_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JN182325_PreC_P-A Feature FT:CDS JN182325_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgcacacctcac
catacagcactcaggcaagccattctccgctggggggaactaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JN182327_PreC_P-A Feature FT:CDS JN182327_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaacttttnnnnnnnnnnnnnnnnnnnnnnnnnnnatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaaga
tccagcgtccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JN182328_PreC_P-A Feature FT:CDS JN182328_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccctggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcac
catacagcactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JN182329_PreC_P-A Feature FT:CDS JN182329_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
nnnnnnctttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacgactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JN182330_PreC_P-A Feature FT:CDS JN182330_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JN182331_PreC_P-A Feature FT:CDS JN182331_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccctctgacttctttc
cttccgtccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JN182332_PreC_P-A Feature FT:CDS JN182332_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaacgattgtggtttcata
tttcttgccttacttttggaagagaaactgcccttgagtatttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JN182333_PreC_P-A Feature FT:CDS JN182333_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JN182334_PreC_P-A Feature FT:CDS JN182334_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaacttttnnnnnnnnnnnnnnnnnnnncttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaaccaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctggtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagtagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ023660_PreC_P-A Feature FT:CDS JQ023660_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1160). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagacttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaaggcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaagtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ023661_PreC_P-A Feature FT:CDS JQ023661_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1158). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagacttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaaggcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ023662_PreC_P-A Feature FT:CDS JQ023662_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1164). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagacttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaaggcccctatcttatcaacacttccggaaactactgttgtttgacgacgagaccgaggcaggtcccc
taaaagaagaactccctcgcctcgcagacgaaaatctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ023663_PreC_P-A Feature FT:CDS JQ023663_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1159). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagacttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaaggcccctatcttatcaacacttccggaaactactgttgtttgacgacgagaccgaggccggtcccc
taaaagaagaactccctcgcctcgcaaacgaaaatctcaatcgccgcgtcgcaaaaaatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ687529_PreC_P-A Feature FT:CDS JQ687529_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Srb 176). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ687533_PreC_P-A Feature FT:CDS JQ687533_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Srb 210). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggcaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcaaacgcagatctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707299_PreC_P-A Feature FT:CDS JQ707299_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C1). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggacga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707300_PreC_P-A Feature FT:CDS JQ707300_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C11). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcatcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707301_PreC_P-A Feature FT:CDS JQ707301_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C12). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707302_PreC_P-A Feature FT:CDS JQ707302_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C13). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707303_PreC_P-A Feature FT:CDS JQ707303_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C14). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
cccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707304_PreC_P-A Feature FT:CDS JQ707304_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C15). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707305_PreC_P-A Feature FT:CDS JQ707305_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C16). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707306_PreC_P-A Feature FT:CDS JQ707306_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C17). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707307_PreC_P-A Feature FT:CDS JQ707307_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C18). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707308_PreC_P-A Feature FT:CDS JQ707308_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C19). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707309_PreC_P-A Feature FT:CDS JQ707309_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707310_PreC_P-A Feature FT:CDS JQ707310_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C20). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707311_PreC_P-A Feature FT:CDS JQ707311_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C21). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707312_PreC_P-A Feature FT:CDS JQ707312_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C22). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttaata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707313_PreC_P-A Feature FT:CDS JQ707313_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C23). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707314_PreC_P-A Feature FT:CDS JQ707314_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C24). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707315_PreC_P-A Feature FT:CDS JQ707315_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C25). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctggcttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttggagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707316_PreC_P-A Feature FT:CDS JQ707316_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C26). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707317_PreC_P-A Feature FT:CDS JQ707317_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C27). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707318_PreC_P-A Feature FT:CDS JQ707318_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C28). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707319_PreC_P-A Feature FT:CDS JQ707319_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C3). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggacga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707320_PreC_P-A Feature FT:CDS JQ707320_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C30). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707321_PreC_P-A Feature FT:CDS JQ707321_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C31). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707322_PreC_P-A Feature FT:CDS JQ707322_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C32). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707323_PreC_P-A Feature FT:CDS JQ707323_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C33). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707324_PreC_P-A Feature FT:CDS JQ707324_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C34). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagagatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacctttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707325_PreC_P-A Feature FT:CDS JQ707325_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C35). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagaaacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707326_PreC_P-A Feature FT:CDS JQ707326_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C36). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707327_PreC_P-A Feature FT:CDS JQ707327_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C37). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707328_PreC_P-A Feature FT:CDS JQ707328_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C38). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttggagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctgtgctggggggaattgatgactctagctacctgggtgggtaataatttgtaaga
tccagcatcaagggatctagtattcaattatgttaattctaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgcattacttttggaagagagaaggtactagaatatttggtccctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707329_PreC_P-A Feature FT:CDS JQ707329_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C39). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaaaacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707330_PreC_P-A Feature FT:CDS JQ707330_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C4). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707331_PreC_P-A Feature FT:CDS JQ707331_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C40). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707332_PreC_P-A Feature FT:CDS JQ707332_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C41). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaattcggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagaaacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707333_PreC_P-A Feature FT:CDS JQ707333_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C42). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707334_PreC_P-A Feature FT:CDS JQ707334_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C43). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaac
gttag
>gnl|hbvcds|JQ707335_PreC_P-A Feature FT:CDS JQ707335_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C44). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgat
gttag
>gnl|hbvcds|JQ707336_PreC_P-A Feature FT:CDS JQ707336_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C45). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgcatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707337_PreC_P-A Feature FT:CDS JQ707337_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C46). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707338_PreC_P-A Feature FT:CDS JQ707338_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C47). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatttcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707339_PreC_P-A Feature FT:CDS JQ707339_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C48). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagggtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgtcaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707340_PreC_P-A Feature FT:CDS JQ707340_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C5). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707341_PreC_P-A Feature FT:CDS JQ707341_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C6). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagccttcaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707342_PreC_P-A Feature FT:CDS JQ707342_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C7). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707343_PreC_P-A Feature FT:CDS JQ707343_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C8). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707344_PreC_P-A Feature FT:CDS JQ707344_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C9). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707345_PreC_P-A Feature FT:CDS JQ707345_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C1). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttagtctcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707346_PreC_P-A Feature FT:CDS JQ707346_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C12). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagttgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
accagcatcaagggatctagtagtcaactatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagac
tatagatcaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707347_PreC_P-A Feature FT:CDS JQ707347_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C13). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707348_PreC_P-A Feature FT:CDS JQ707348_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C14). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707349_PreC_P-A Feature FT:CDS JQ707349_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C15). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707350_PreC_P-A Feature FT:CDS JQ707350_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C16). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707351_PreC_P-A Feature FT:CDS JQ707351_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtttctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707352_PreC_P-A Feature FT:CDS JQ707352_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C20). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagccactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707353_PreC_P-A Feature FT:CDS JQ707353_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C21). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707354_PreC_P-A Feature FT:CDS JQ707354_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C22-2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707355_PreC_P-A Feature FT:CDS JQ707355_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C25). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707356_PreC_P-A Feature FT:CDS JQ707356_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C28). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgagtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707357_PreC_P-A Feature FT:CDS JQ707357_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C29-2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707358_PreC_P-A Feature FT:CDS JQ707358_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C33). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707359_PreC_P-A Feature FT:CDS JQ707359_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C35). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagccttcaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707360_PreC_P-A Feature FT:CDS JQ707360_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C36). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccatcctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707361_PreC_P-A Feature FT:CDS JQ707361_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C37). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707362_PreC_P-A Feature FT:CDS JQ707362_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C39). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707363_PreC_P-A Feature FT:CDS JQ707363_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C4). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttccagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707364_PreC_P-A Feature FT:CDS JQ707364_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C41). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707365_PreC_P-A Feature FT:CDS JQ707365_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C43). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcaagtcccacggttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707366_PreC_P-A Feature FT:CDS JQ707366_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C44). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707367_PreC_P-A Feature FT:CDS JQ707367_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C46). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707368_PreC_P-A Feature FT:CDS JQ707368_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C47). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttctaaagaatttggagctactgtggagttactctcgtttctgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctttgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcgtatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggttccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707369_PreC_P-A Feature FT:CDS JQ707369_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C48). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcctttttgccctctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcacactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707370_PreC_P-A Feature FT:CDS JQ707370_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C5). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707371_PreC_P-A Feature FT:CDS JQ707371_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C1). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707372_PreC_P-A Feature FT:CDS JQ707372_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C11). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707373_PreC_P-A Feature FT:CDS JQ707373_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C14). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707374_PreC_P-A Feature FT:CDS JQ707374_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C15). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707375_PreC_P-A Feature FT:CDS JQ707375_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C17-2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707376_PreC_P-A Feature FT:CDS JQ707376_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707377_PreC_P-A Feature FT:CDS JQ707377_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C21). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707378_PreC_P-A Feature FT:CDS JQ707378_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C22). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707379_PreC_P-A Feature FT:CDS JQ707379_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C24-9). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707380_PreC_P-A Feature FT:CDS JQ707380_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C27). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707381_PreC_P-A Feature FT:CDS JQ707381_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C28). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707382_PreC_P-A Feature FT:CDS JQ707382_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C3). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtggataataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707383_PreC_P-A Feature FT:CDS JQ707383_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C31). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707384_PreC_P-A Feature FT:CDS JQ707384_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C32). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707385_PreC_P-A Feature FT:CDS JQ707385_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C33). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707386_PreC_P-A Feature FT:CDS JQ707386_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C34). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttaccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707387_PreC_P-A Feature FT:CDS JQ707387_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C36). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactcccgcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707388_PreC_P-A Feature FT:CDS JQ707388_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C37). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctactagtcaattatgttaatggtgacatgggtttaaaaattaggcaactagggaggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707389_PreC_P-A Feature FT:CDS JQ707389_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C38). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707390_PreC_P-A Feature FT:CDS JQ707390_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C39). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707391_PreC_P-A Feature FT:CDS JQ707391_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C4). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707392_PreC_P-A Feature FT:CDS JQ707392_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C40). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttccgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707393_PreC_P-A Feature FT:CDS JQ707393_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C42). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707394_PreC_P-A Feature FT:CDS JQ707394_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C44). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707395_PreC_P-A Feature FT:CDS JQ707395_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C46). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgcggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707396_PreC_P-A Feature FT:CDS JQ707396_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C47). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatattaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707397_PreC_P-A Feature FT:CDS JQ707397_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C48). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707398_PreC_P-A Feature FT:CDS JQ707398_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C5). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707399_PreC_P-A Feature FT:CDS JQ707399_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C6). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707400_PreC_P-A Feature FT:CDS JQ707400_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C1). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707401_PreC_P-A Feature FT:CDS JQ707401_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C10). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttagaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707402_PreC_P-A Feature FT:CDS JQ707402_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C11-3). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707403_PreC_P-A Feature FT:CDS JQ707403_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C16). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707404_PreC_P-A Feature FT:CDS JQ707404_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C17). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcgctcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707405_PreC_P-A Feature FT:CDS JQ707405_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C18). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707406_PreC_P-A Feature FT:CDS JQ707406_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C19). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707407_PreC_P-A Feature FT:CDS JQ707407_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C20-9). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707408_PreC_P-A Feature FT:CDS JQ707408_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C23). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707409_PreC_P-A Feature FT:CDS JQ707409_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C26-5). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707410_PreC_P-A Feature FT:CDS JQ707410_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C28). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707411_PreC_P-A Feature FT:CDS JQ707411_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C3). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707412_PreC_P-A Feature FT:CDS JQ707412_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C32). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707413_PreC_P-A Feature FT:CDS JQ707413_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C34). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707414_PreC_P-A Feature FT:CDS JQ707414_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C35). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcaactctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707415_PreC_P-A Feature FT:CDS JQ707415_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C40). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgtcaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707416_PreC_P-A Feature FT:CDS JQ707416_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C41). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707417_PreC_P-A Feature FT:CDS JQ707417_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C44). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707418_PreC_P-A Feature FT:CDS JQ707418_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C47). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707419_PreC_P-A Feature FT:CDS JQ707419_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C48). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctccttgacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccggggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707420_PreC_P-A Feature FT:CDS JQ707420_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C6). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707531_PreC_P-A Feature FT:CDS JQ707531_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C1). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707532_PreC_P-A Feature FT:CDS JQ707532_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C10). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707533_PreC_P-A Feature FT:CDS JQ707533_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C11). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707534_PreC_P-A Feature FT:CDS JQ707534_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C12). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagtc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707535_PreC_P-A Feature FT:CDS JQ707535_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C13). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707536_PreC_P-A Feature FT:CDS JQ707536_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C14). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707537_PreC_P-A Feature FT:CDS JQ707537_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C15). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707538_PreC_P-A Feature FT:CDS JQ707538_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C16). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707539_PreC_P-A Feature FT:CDS JQ707539_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C17). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaatatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707540_PreC_P-A Feature FT:CDS JQ707540_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C18). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707541_PreC_P-A Feature FT:CDS JQ707541_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C19). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707542_PreC_P-A Feature FT:CDS JQ707542_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C21). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707543_PreC_P-A Feature FT:CDS JQ707543_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C22). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707544_PreC_P-A Feature FT:CDS JQ707544_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C23). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707545_PreC_P-A Feature FT:CDS JQ707545_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C24). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707546_PreC_P-A Feature FT:CDS JQ707546_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C26). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707547_PreC_P-A Feature FT:CDS JQ707547_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C27). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707548_PreC_P-A Feature FT:CDS JQ707548_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C28). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707549_PreC_P-A Feature FT:CDS JQ707549_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C29). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707550_PreC_P-A Feature FT:CDS JQ707550_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C3). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggatcgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707551_PreC_P-A Feature FT:CDS JQ707551_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C30). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactttagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707552_PreC_P-A Feature FT:CDS JQ707552_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C31). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707553_PreC_P-A Feature FT:CDS JQ707553_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C32). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707554_PreC_P-A Feature FT:CDS JQ707554_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C33). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707555_PreC_P-A Feature FT:CDS JQ707555_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C34). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggggaaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707556_PreC_P-A Feature FT:CDS JQ707556_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C35). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707557_PreC_P-A Feature FT:CDS JQ707557_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C36). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707558_PreC_P-A Feature FT:CDS JQ707558_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C38). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707559_PreC_P-A Feature FT:CDS JQ707559_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C4). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707560_PreC_P-A Feature FT:CDS JQ707560_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C40). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707561_PreC_P-A Feature FT:CDS JQ707561_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C41). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707562_PreC_P-A Feature FT:CDS JQ707562_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C42). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707563_PreC_P-A Feature FT:CDS JQ707563_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C43). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctcgctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707564_PreC_P-A Feature FT:CDS JQ707564_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C44). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707565_PreC_P-A Feature FT:CDS JQ707565_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C45). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattcctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707566_PreC_P-A Feature FT:CDS JQ707566_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C46). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707567_PreC_P-A Feature FT:CDS JQ707567_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C47). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707568_PreC_P-A Feature FT:CDS JQ707568_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C48). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707569_PreC_P-A Feature FT:CDS JQ707569_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C5). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707570_PreC_P-A Feature FT:CDS JQ707570_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C6). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707571_PreC_P-A Feature FT:CDS JQ707571_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C7). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707572_PreC_P-A Feature FT:CDS JQ707572_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C8). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707573_PreC_P-A Feature FT:CDS JQ707573_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C9). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707574_PreC_P-A Feature FT:CDS JQ707574_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C10). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707575_PreC_P-A Feature FT:CDS JQ707575_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C13). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707576_PreC_P-A Feature FT:CDS JQ707576_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C14). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatgaacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactcacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707577_PreC_P-A Feature FT:CDS JQ707577_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C15). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagacattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaacgatcaggcgactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707578_PreC_P-A Feature FT:CDS JQ707578_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C16). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactcttgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccggcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707579_PreC_P-A Feature FT:CDS JQ707579_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C17). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707580_PreC_P-A Feature FT:CDS JQ707580_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C18). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggggctactgcggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707581_PreC_P-A Feature FT:CDS JQ707581_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C19). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtactcgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707582_PreC_P-A Feature FT:CDS JQ707582_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C2). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagccctgtatcgagaagccttagagtctcctgagcattgctcatctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707583_PreC_P-A Feature FT:CDS JQ707583_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C21). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707584_PreC_P-A Feature FT:CDS JQ707584_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C22). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707585_PreC_P-A Feature FT:CDS JQ707585_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C23). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707586_PreC_P-A Feature FT:CDS JQ707586_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C24). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707587_PreC_P-A Feature FT:CDS JQ707587_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C25). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707588_PreC_P-A Feature FT:CDS JQ707588_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C26). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707589_PreC_P-A Feature FT:CDS JQ707589_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C27). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707590_PreC_P-A Feature FT:CDS JQ707590_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C28). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggcgctactgcggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707591_PreC_P-A Feature FT:CDS JQ707591_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C29). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707592_PreC_P-A Feature FT:CDS JQ707592_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C3). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttaa
>gnl|hbvcds|JQ707593_PreC_P-A Feature FT:CDS JQ707593_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C33). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactcgcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707594_PreC_P-A Feature FT:CDS JQ707594_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C34). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707595_PreC_P-A Feature FT:CDS JQ707595_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C35). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagacattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaacgatcaggcgactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707596_PreC_P-A Feature FT:CDS JQ707596_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C36). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagacattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaacgatcaggcgactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707597_PreC_P-A Feature FT:CDS JQ707597_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C37). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707598_PreC_P-A Feature FT:CDS JQ707598_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C38). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707599_PreC_P-A Feature FT:CDS JQ707599_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C4). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707600_PreC_P-A Feature FT:CDS JQ707600_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C40). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagacattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaacgatcaggcgactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|JQ707601_PreC_P-A Feature FT:CDS JQ707601_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C41). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707602_PreC_P-A Feature FT:CDS JQ707602_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C42). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagacattctctgctgggggaaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707603_PreC_P-A Feature FT:CDS JQ707603_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C43). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtactcgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707604_PreC_P-A Feature FT:CDS JQ707604_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C44). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707605_PreC_P-A Feature FT:CDS JQ707605_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C45). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagacattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaacgatcaggcgactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707606_PreC_P-A Feature FT:CDS JQ707606_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C48). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707607_PreC_P-A Feature FT:CDS JQ707607_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C8). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707608_PreC_P-A Feature FT:CDS JQ707608_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C9). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707609_PreC_P-A Feature FT:CDS JQ707609_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C1). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707610_PreC_P-A Feature FT:CDS JQ707610_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C10). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707611_PreC_P-A Feature FT:CDS JQ707611_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C11). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707612_PreC_P-A Feature FT:CDS JQ707612_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C13). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcctgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707613_PreC_P-A Feature FT:CDS JQ707613_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C15). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707614_PreC_P-A Feature FT:CDS JQ707614_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C17). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707615_PreC_P-A Feature FT:CDS JQ707615_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C18). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgctctcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707616_PreC_P-A Feature FT:CDS JQ707616_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707617_PreC_P-A Feature FT:CDS JQ707617_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C21). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707618_PreC_P-A Feature FT:CDS JQ707618_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C22). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707619_PreC_P-A Feature FT:CDS JQ707619_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C23). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707620_PreC_P-A Feature FT:CDS JQ707620_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C24). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707621_PreC_P-A Feature FT:CDS JQ707621_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C26). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707622_PreC_P-A Feature FT:CDS JQ707622_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C27). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707623_PreC_P-A Feature FT:CDS JQ707623_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C28). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtttcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707624_PreC_P-A Feature FT:CDS JQ707624_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C3). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707625_PreC_P-A Feature FT:CDS JQ707625_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C30). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707626_PreC_P-A Feature FT:CDS JQ707626_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C31). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707627_PreC_P-A Feature FT:CDS JQ707627_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C32). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707628_PreC_P-A Feature FT:CDS JQ707628_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C33). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707629_PreC_P-A Feature FT:CDS JQ707629_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C34). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707630_PreC_P-A Feature FT:CDS JQ707630_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C35). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707631_PreC_P-A Feature FT:CDS JQ707631_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C36-6). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707632_PreC_P-A Feature FT:CDS JQ707632_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C4). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707633_PreC_P-A Feature FT:CDS JQ707633_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C41). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707634_PreC_P-A Feature FT:CDS JQ707634_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C42). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggaactagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707635_PreC_P-A Feature FT:CDS JQ707635_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C45). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgccacgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707636_PreC_P-A Feature FT:CDS JQ707636_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C46). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707637_PreC_P-A Feature FT:CDS JQ707637_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C5-5). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707638_PreC_P-A Feature FT:CDS JQ707638_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C12). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707639_PreC_P-A Feature FT:CDS JQ707639_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C13-9). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707640_PreC_P-A Feature FT:CDS JQ707640_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C14). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707641_PreC_P-A Feature FT:CDS JQ707641_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C17). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707642_PreC_P-A Feature FT:CDS JQ707642_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707643_PreC_P-A Feature FT:CDS JQ707643_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C20-7). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707644_PreC_P-A Feature FT:CDS JQ707644_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C22). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707645_PreC_P-A Feature FT:CDS JQ707645_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C24). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707646_PreC_P-A Feature FT:CDS JQ707646_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C26). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707647_PreC_P-A Feature FT:CDS JQ707647_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C27). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707648_PreC_P-A Feature FT:CDS JQ707648_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C28). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707649_PreC_P-A Feature FT:CDS JQ707649_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C3). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707650_PreC_P-A Feature FT:CDS JQ707650_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C30). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707651_PreC_P-A Feature FT:CDS JQ707651_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C33). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707652_PreC_P-A Feature FT:CDS JQ707652_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C34). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707653_PreC_P-A Feature FT:CDS JQ707653_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C38). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707654_PreC_P-A Feature FT:CDS JQ707654_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C40). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707655_PreC_P-A Feature FT:CDS JQ707655_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C41). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccgtctgatttctttc
cttccgtcagagagctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707656_PreC_P-A Feature FT:CDS JQ707656_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C43). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707658_PreC_P-A Feature FT:CDS JQ707658_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_13). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707659_PreC_P-A Feature FT:CDS JQ707659_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_14). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707661_PreC_P-A Feature FT:CDS JQ707661_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_18). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707662_PreC_P-A Feature FT:CDS JQ707662_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_19). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggacctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707663_PreC_P-A Feature FT:CDS JQ707663_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707664_PreC_P-A Feature FT:CDS JQ707664_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_20). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707665_PreC_P-A Feature FT:CDS JQ707665_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_21). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcaccccac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707667_PreC_P-A Feature FT:CDS JQ707667_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_25). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707669_PreC_P-A Feature FT:CDS JQ707669_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_28). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707670_PreC_P-A Feature FT:CDS JQ707670_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_29). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707672_PreC_P-A Feature FT:CDS JQ707672_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_32). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707674_PreC_P-A Feature FT:CDS JQ707674_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_38). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707675_PreC_P-A Feature FT:CDS JQ707675_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_41). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707676_PreC_P-A Feature FT:CDS JQ707676_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_42). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JQ707681_PreC_P-A Feature FT:CDS JQ707681_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_9-12). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JX096952_PreC_P-A Feature FT:CDS JX096952_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 11-10165). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JX096953_PreC_P-A Feature FT:CDS JX096953_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 12-8957). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttaccctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JX154579_PreC_P-A Feature FT:CDS JX154579_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBVFLS36). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacctttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagctattgtctgctggggggaattaatgactctaggtacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggaaatctcaat
gttag
>gnl|hbvcds|JX154580_PreC_P-A Feature FT:CDS JX154580_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBVFLS46). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacctttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagctattgtctgctggggggaattaatgactctaggtacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JX154581_PreC_P-A Feature FT:CDS JX154581_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBVFLS51). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacctttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagctattgtctgctggggggaattaatgactctaggtacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|JX154582_PreC_P-A Feature FT:CDS JX154582_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBVFLS64). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacctttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagctattgtctgctggggggaattaatgactctaggtacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KC836831_PreC_P-A Feature FT:CDS KC836831_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate AH2). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttcttgacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KC836832_PreC_P-A Feature FT:CDS KC836832_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate AH3). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KC836834_PreC_P-A Feature FT:CDS KC836834_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate AH5). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttctattcgagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KC836846_PreC_P-A Feature FT:CDS KC836846_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate AH22). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgatttctttc
cttccgtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcaccgcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatttagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KC836849_PreC_P-A Feature FT:CDS KC836849_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate AH25). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KC836854_PreC_P-A Feature FT:CDS KC836854_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate AH32). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KC836858_PreC_P-A Feature FT:CDS KC836858_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate AH38). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KC875251_PreC_P-A Feature FT:CDS KC875251_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV1). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagggtctcctgagcattgctcacctcac
catccagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KC875252_PreC_P-A Feature FT:CDS KC875252_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV3). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattcactgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KC875253_PreC_P-A Feature FT:CDS KC875253_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV23). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcctactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacgttgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactaaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KC875254_PreC_P-A Feature FT:CDS KC875254_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV12). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcctactttttaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KC875255_PreC_P-A Feature FT:CDS KC875255_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV24). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagacaaactgtccttgagtatttggtccctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KC875256_PreC_P-A Feature FT:CDS KC875256_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV27). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
acgcaactttttcacctctgcctaatcatctcttgtacatgtcctactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgcgcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KC875257_PreC_P-A Feature FT:CDS KC875257_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV14). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgaatctagctacctgggcgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccgccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KC875258_PreC_P-A Feature FT:CDS KC875258_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV66). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccaggc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KC875259_PreC_P-A Feature FT:CDS KC875259_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV73). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttatcaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcatgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaacttgtgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KC875260_PreC_P-A Feature FT:CDS KC875260_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV5). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctctcctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagccacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgtcttacttttggaagacagactgtgctagaatatttggtctctttcggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF214657_PreC_P-A Feature FT:CDS KF214657_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2008-1). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagatactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF214658_PreC_P-A Feature FT:CDS KF214658_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2009-6). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctcccagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctgggggaaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttactttcggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF214659_PreC_P-A Feature FT:CDS KF214659_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2009-2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagacacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggtgaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF214660_PreC_P-A Feature FT:CDS KF214660_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2008-9). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcagctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacatcgacccttataaagaatttggcgctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctacaagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacatcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggacttagtagtcaattatgttaatactaatatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF214661_PreC_P-A Feature FT:CDS KF214661_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2008-8). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtacgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggagagctgttctgtgttggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatctagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgttcttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF214662_PreC_P-A Feature FT:CDS KF214662_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2008-14). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcctccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgttcttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF214663_PreC_P-A Feature FT:CDS KF214663_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2007-11). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF214665_PreC_P-A Feature FT:CDS KF214665_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2008-3). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF214666_PreC_P-A Feature FT:CDS KF214666_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2010-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccgttctctgctggggggaattaacgactttagctggctgggtgggtcataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccacct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggtaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KF798265_PreC_P-A Feature FT:CDS KF798265_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICIB-07). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagacacagcctcagctctatttcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattactgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaattgctgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF798266_PreC_P-A Feature FT:CDS KF798266_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICIB-08). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcttcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgcattacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|KF798267_PreC_P-A Feature FT:CDS KF798267_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICIB-09). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcat
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatcaagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgttcttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF798271_PreC_P-A Feature FT:CDS KF798271_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICIB-13). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgcacaccgcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF798278_PreC_P-A Feature FT:CDS KF798278_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICIB-20). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggagttaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF798279_PreC_P-A Feature FT:CDS KF798279_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICIB-21). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF798285_PreC_P-A Feature FT:CDS KF798285_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICIB-27). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF798286_PreC_P-A Feature FT:CDS KF798286_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICIB-28). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagacacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtatctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF798289_PreC_P-A Feature FT:CDS KF798289_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICIB-31). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF798290_PreC_P-A Feature FT:CDS KF798290_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICIB-32). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcaccgcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF798291_PreC_P-A Feature FT:CDS KF798291_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICIB-33). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaacaatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF798292_PreC_P-A Feature FT:CDS KF798292_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICIB-34). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcat
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatttagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgaagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF798302_PreC_P-A Feature FT:CDS KF798302_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICIB-44). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggagga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF798308_PreC_P-A Feature FT:CDS KF798308_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICIB-50). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF798309_PreC_P-A Feature FT:CDS KF798309_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICIB-51). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF798310_PreC_P-A Feature FT:CDS KF798310_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICIB-52). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgttcttgagtatttggtctcttttggagtgtggattcgcacccctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF798311_PreC_P-A Feature FT:CDS KF798311_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICIB-53). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF798314_PreC_P-A Feature FT:CDS KF798314_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICIB-56). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcttcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF922406_PreC_P-A Feature FT:CDS KF922406_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3791v1). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tcctgcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF922407_PreC_P-A Feature FT:CDS KF922407_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3791v2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tcctgcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcata
tttcttgccttacttttggaagggaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF922408_PreC_P-A Feature FT:CDS KF922408_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3791v3). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tcctgcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcata
tttcttgccctacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF922409_PreC_P-A Feature FT:CDS KF922409_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3791v4). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tcctgcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcggaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF922414_PreC_P-A Feature FT:CDS KF922414_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v1). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttcagtacgggatttacttgatacagcatcagctctgtatcgggaagccttagaatctccggagcattgctcccctcac
catacagcactcaggcaagccattctatgctggggggatgtaatgaatctagctacttgggtgggtactaatttggaaga
cccagcatccagggatcaagtagttaattatgttaatattaacatgggcataaagattagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttagtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcatcacttccggaaactactgttgttagacgacgaggccgagacaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF922415_PreC_P-A Feature FT:CDS KF922415_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttcagtacgggatttacttgatacagcatcagctctgtatcgggaagccttagaatctccggagcattgctcccctcac
catacagcactcaggcaagccattctatgctggggggatgtaatgaatctagctacttgggtgggtactaatttggaaga
cccagcatccagggatcaagtagttaattatgttaatattaacatgggcataaagattagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttagtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcatcacttccggaaactactgttgttagacgacgaggccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF922416_PreC_P-A Feature FT:CDS KF922416_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v3). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttcagtacgggatctacttgatacagcatcagctctgtatcgggaagccttagaatctccggagcattgctcccctcac
catacagcactcaggcaagccattctatgctggggggatgtaatgaatctagctacttgggtgggtactaatttggaaga
cccagcatccagggatcaagtagttaattatgttaatattaacatgggcataaagattagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttagtttctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcatcacttccggaaactactgttgttagacgacgaggccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF922417_PreC_P-A Feature FT:CDS KF922417_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v4). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttcagtacgggatttacttgatacagcatcagctctgtatcgggaagccttagaatctccggagcattgctcccctcac
catacagcactcaggcaagccattctatgctggggggatgtaatgaatctagctacttgggtgggtactaatttggaaga
cccagcatccagggatcaagtagttaattatgttaatattaacatgggcataaagattagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttagtttctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcatcacttccggaaactactgttgttagacgatgaggccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF922418_PreC_P-A Feature FT:CDS KF922418_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v5). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttcagtacgggatttacttgatacagcatcagctctgtatcgggaagccttagaatctccggagcattgctcccctcac
catacagcactcaggcaagccattctatgctggggggatgtaatgaatctagctacttgggtgggtactaatttggaaga
cccagcatccagggatcaagtagttaattatgttaatattaacatgggcataaagattagacaactattgtggtttcata
tttcttgcattacttttggaagagaaactgtccttgagtatttagtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcatcacttccggaaactactgttgttagacgacgaggccgaggcaggtcccc
tggaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF922419_PreC_P-A Feature FT:CDS KF922419_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v6). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttcagtacgggatttacttgatacagcatcagctctgtatcgggaagccttagaatctccggagcattgctcccctcac
catacagcactcaggcaagccattctatgctggggggatgtaatgaatctagctacttgggtgggtactaatttggaaga
cccagcatccagggatcaagtagttaattatgttaatattaacatgggcataaagattagacaactattgtggtttcata
tttcttgcattacttttggaagagaaactgtccttgagtatttagtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcatcacttccggaaactactgttgttagacgacgaggccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF922420_PreC_P-A Feature FT:CDS KF922420_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v7). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttcagtacgggatctacttgatacagcatcagctctgtatcgggaagccttagaatctccggagcattgctcccctcac
catacagcactcaggcaagccattctatgctggggggatgtaatgaatctagctacttgggtgggtactaatttggaaga
cccagcatccagggatcaagtagttaattatgttaatattaacatgggcataaagattagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttagtttctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcatcacttccggaaactactgttgttagacgacgaggccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF922421_PreC_P-A Feature FT:CDS KF922421_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v8). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttcagtacgggatctacttgatacagcatcagctctgtatcgggaagccttagaatctccggagcattgctcccctcac
catacagcactcaggcaagccattctatgctggggggatgtaatgaatctagctacttgggtgggtactaatttggaaga
cccagcatccagggatcaagtagttaattatgttaatattaacatgggcataaagattagacaactattgtggtttcata
tttcttgcattacttttggaagagaaactgtccttgagtatttagtctctttcggagtgtggattcgcactcctccagcc
tatggaccaccaaatgcccctatcttatcatcacttccggaaactactgttgttagacgacgaggccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF922424_PreC_P-A Feature FT:CDS KF922424_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4070v1). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggacctagttgtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF922425_PreC_P-A Feature FT:CDS KF922425_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4070v2). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggacctagttgtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF922426_PreC_P-A Feature FT:CDS KF922426_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4312v1). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggcaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactgttgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF922427_PreC_P-A Feature FT:CDS KF922427_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4312v2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggcaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactgttgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF922428_PreC_P-A Feature FT:CDS KF922428_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4312v3). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggcaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactgttgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF922429_PreC_P-A Feature FT:CDS KF922429_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3274v1). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagccttagctctgtatcgggaagccttagagtctccggagcattgctcccctcac
catacagcaatcaggcaagccattctatgctggggggaattaatgactctagctacctgggtgggtaataatttggagga
tccagcatccagggatctagtagtcaattatgtcaatactaacatgggcctaaaaataagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagct
tatagaccgcaaaatgcccctatcttatcaactcttccggagactactgttgttagacgacgaggccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF922430_PreC_P-A Feature FT:CDS KF922430_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3274v2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagccttagctctgtatcgggaagccttagagtctccagagcattgctcccctcac
catacagcaatcaggcaagccattctatgctggggggaattaatgatttttgctacctgggtgggtaataatttggagga
tccagcatccagggatctagtagtcaattatgtcaatactaacatgggcctaaaaataagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagct
tatagaccgcaaaatgcccctatcttatcaactcttccggagactactgttgttagacgacgaggccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF922431_PreC_P-A Feature FT:CDS KF922431_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3274v3). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttcagtccgggatctacttgatacagccttagctctgtatcgggaagccttagagtctccagagcattgctcccctcac
catacagcaatcaggcaagccattctatgctggggggaattaatgactctagctacctgggtgggtaataatttggagga
tccagcatccagggatctagtagtcaattatgtcaatactaacatgggcctaaaaataagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagct
tatagaccgcaaaatgcccctatcttatcaactcttccggagactactgttgttagacgacgaggccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF922433_PreC_P-A Feature FT:CDS KF922433_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3658v1). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggatctactgtggagttactctcatttttgccttctgacttctttc
cttcagtacgggatctacttgatacagcttcagctctgtatcgggaagccttagaatctccggagcattgctcccctcac
catacagcactcaggcaagccattttatgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgtcaatactaacatgggcctaaagattagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttagtctctttcggagtgtggatacgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF922434_PreC_P-A Feature FT:CDS KF922434_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3658v2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggatctactgtggagttactctcatttttgccttctgacttctttc
cttcagtacgggatctacttgatacagcttcagctctgtatcgggaagccttagaatctccggagcattgctcccctcac
catacagcactcaggcaagccattttatgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgtcaatactaacatgggcctaaagattagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttagtctctttcggagtgtggatacgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KF922435_PreC_P-A Feature FT:CDS KF922435_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N060v1). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggatctactgtggagttactctcatttttgccttctgacttctttc
cttcagtacgggatctactggatacagcctcagctctgtatcgggaagccttagaatctcaggagcattgctcccctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgttcttgagtatttagtctctttcggagtgtggatacgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaatccttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|KF922436_PreC_P-A Feature FT:CDS KF922436_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N060v2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggatctactgtggagttactctcatttttgccttctgacttctttc
cttcagtacgggatctacttgatacagcctcagctctgtatcgggaagccttagaatctctggagcattgctcccctcac
catacggcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgttcttgagtatttagtctctttcggagtgtggatacgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaatccttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|KF922437_PreC_P-A Feature FT:CDS KF922437_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N060v3). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggatctactgtggagttactctcatttttgccttctgacttctttc
cttcagtacgggatctacttgatacagcctcagcactatatcgagaaggcttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccgttctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tcctgcatccagggatctagtagtcaattatgttaatactaatatgggcctaaaaatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggggtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaatccttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|KJ010776_PreC_P-A Feature FT:CDS KJ010776_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3358v1). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tcctgcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ010777_PreC_P-A Feature FT:CDS KJ010777_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3358v2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tcctgcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ010778_PreC_P-A Feature FT:CDS KJ010778_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3358v3). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tcctgcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ194506_PreC_P-A Feature FT:CDS KJ194506_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV_Amsterdam_1_1994). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgcatcgggaagccttagagtctcctgagcattgctcacctcac
cacacagcactcaggcaagcctttgtctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagttgtcaattatgttaatactaacatgggcctaaagatcaggcgattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaat
gttag
>gnl|hbvcds|KJ586809_PreC_P-A Feature FT:CDS KJ586809_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcaaagatctcctaaacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggagaattgatgactctatctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcagttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ843166_PreC_P-A Feature FT:CDS KJ843166_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag04). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcata
tatcttgccttacttttggaagagagactgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ843172_PreC_P-A Feature FT:CDS KJ843172_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag10). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagaatctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagcttcctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaattattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaattactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ843173_PreC_P-A Feature FT:CDS KJ843173_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag11). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcata
tatcttgccttacttttggaagagagactgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ843182_PreC_P-A Feature FT:CDS KJ843182_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag21). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ843183_PreC_P-A Feature FT:CDS KJ843183_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag22). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagacacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtggtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ843184_PreC_P-A Feature FT:CDS KJ843184_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag23). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcncactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ843186_PreC_P-A Feature FT:CDS KJ843186_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag25). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ843188_PreC_P-A Feature FT:CDS KJ843188_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag27). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcata
tttcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ843192_PreC_P-A Feature FT:CDS KJ843192_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag31). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ843214_PreC_P-A Feature FT:CDS KJ843214_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag55). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ843215_PreC_P-A Feature FT:CDS KJ843215_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag56). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcata
tatcttgccttacttttggaagagagactgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ843216_PreC_P-A Feature FT:CDS KJ843216_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag57). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ843217_PreC_P-A Feature FT:CDS KJ843217_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag62). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacggagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ843218_PreC_P-A Feature FT:CDS KJ843218_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag63). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ854685_PreC_P-A Feature FT:CDS KJ854685_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 116-SE-BRA). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggctggct
ttggggcatggccattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactggacacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattatcgactctaggtacctgggtgggtaataatttgcaaga
tcaagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactcttgtggtttcata
cttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgtcgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ854686_PreC_P-A Feature FT:CDS KJ854686_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1356-SE-BRA). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagccacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaayctcaat
gttag
>gnl|hbvcds|KJ854687_PreC_P-A Feature FT:CDS KJ854687_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1377-SE-BRA). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcatgagcattgctcaccgcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ854688_PreC_P-A Feature FT:CDS KJ854688_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1379-SE-BRA). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgaacattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ854689_PreC_P-A Feature FT:CDS KJ854689_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 16202-NE-BRA). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttc
cttccgtccgggatctactagacacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatttagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ854690_PreC_P-A Feature FT:CDS KJ854690_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 16338-NE-BRA). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgatttctttc
cctccgtccgggatctacttgatacatcctcagctctgtatcgggaagccttagaatctcctgagcattgctcaccgcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ854691_PreC_P-A Feature FT:CDS KJ854691_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 16650-NE-BRA). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcnnctcttgtacatgtcccacttttcaagcctccaagctgtgccttggttggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttc
cttccgtccgggatctactagacacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ854692_PreC_P-A Feature FT:CDS KJ854692_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 17372-NE-BRA). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagacacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatttagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ854693_PreC_P-A Feature FT:CDS KJ854693_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 17545-NE-BRA). Complete genome. [Hepadnaviridae] (length=645 residues).
nnnnnnctttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgatttctttc
cttccgtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcaccgcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ854694_PreC_P-A Feature FT:CDS KJ854694_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 17822-NE-BRA). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgatttctttc
cttccgtccgggatctacttgatacagcctcagctctgtatcgggaagccttagaatctcctgagcattgctcaccgcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ854696_PreC_P-A Feature FT:CDS KJ854696_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 18158-SE-BRA). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagacacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatttagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ854697_PreC_P-A Feature FT:CDS KJ854697_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1969-SE-BRA). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagacacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtggtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ854698_PreC_P-A Feature FT:CDS KJ854698_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1993-N-BRA). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
nnnnnnctttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgatttctttc
cttccgtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcaccgcac
catacagcactcaggcaagccattctytgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ854699_PreC_P-A Feature FT:CDS KJ854699_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 2340-N-BRA). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgatttctttc
cttccgtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcaccgcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ854700_PreC_P-A Feature FT:CDS KJ854700_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 313-N-BRA). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgatttctttc
cttccgtccgggatctacttgatacagcatcagctctgtatcgggaagccttagagtctcctgagcattgctcaccgcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagnagttgtcctggagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ854701_PreC_P-A Feature FT:CDS KJ854701_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 349-SE-BRA). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgatttctttc
ctaccgcccgggatctacttgatacagcctcagctctgtatcgggaagcattagagtctcctgagcattgctcaccgcac
catacagcactcaggcaagccatactatgctggggggatatactgactctaggtacctgggtgggtaataatttggaaga
tcaaacatccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaarctgtccttgagtatttggtctctttcggagtgtggattcgcactcctcaagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcact
gttag
>gnl|hbvcds|KJ854702_PreC_P-A Feature FT:CDS KJ854702_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 41-CW-BRA). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagacacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcgctcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttagaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ854703_PreC_P-A Feature FT:CDS KJ854703_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 65-SE-BRA). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggactttgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagacacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatttaktartcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ854704_PreC_P-A Feature FT:CDS KJ854704_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 66-CW-BRA). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagacacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ854705_PreC_P-A Feature FT:CDS KJ854705_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 67-CW-BRA). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagacacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ854706_PreC_P-A Feature FT:CDS KJ854706_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 753-CW-BRA). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagacacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccatcctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctgaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ854707_PreC_P-A Feature FT:CDS KJ854707_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 895-N-BRA). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcaccgcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ854708_PreC_P-A Feature FT:CDS KJ854708_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 16-S-BRA). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcayctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ854709_PreC_P-A Feature FT:CDS KJ854709_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 24-S-BRA). Complete genome. [Hepadnaviridae] (length=645 residues).
nnnnnnctttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgrgaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KJ854710_PreC_P-A Feature FT:CDS KJ854710_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 274-SE-BRA). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM243029_PreC_P-A Feature FT:CDS KM243029_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate TAC455). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgaatatttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM519452_PreC_P-A Feature FT:CDS KM519452_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_G1862T_Mutant_SA). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatactgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggcaataatttggaaga
tccagcatccagggatctagtagttaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM519453_PreC_P-A Feature FT:CDS KM519453_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_Wild_SA). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactagatactgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggcaataatttggaaga
tccagcatccagggatctagtagttaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM519454_PreC_P-A Feature FT:CDS KM519454_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A2_WT_BEL). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606647_PreC_P-A Feature FT:CDS KM606647_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba10a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccattataaagaatttggagctactgtggagttactctcatttttgcctttggacttctttc
cttccgcccgggatctactagagacagcctcagctctgtatcgggaatccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaaatattgtggtttcata
tttcttgccttacttttggaagagatactgtccttcagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606648_PreC_P-A Feature FT:CDS KM606648_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba14a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606649_PreC_P-A Feature FT:CDS KM606649_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba15a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagcctctgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagacacagcctcagctttgtatcgggaatccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccatactatgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagctcaggcaactattgtggtttcata
tttcttgccttacttttggaagacaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tacaagaagaactccctcgcctcgcacacgaatatctcaatcgccgcgccgcaaaagatctcaatctcggcaatctcaat
gttag
>gnl|hbvcds|KM606650_PreC_P-A Feature FT:CDS KM606650_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba16a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacctttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
ctgccgtcagagatctcctagataccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattgtctgctggggggaattgatgactctaggtacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606652_PreC_P-A Feature FT:CDS KM606652_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba20a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606653_PreC_P-A Feature FT:CDS KM606653_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba21a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttc
cttccgtcaaagatctcctagacaccgcctcagctctgtatcgagatgccttggagtctcctgagcattgctcacctcac
catactgcactcaggcaagaaattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606656_PreC_P-A Feature FT:CDS KM606656_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba26a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttagaaga
tccagcatccagggatcaagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606657_PreC_P-A Feature FT:CDS KM606657_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba29a). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctaccgcggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtttcgacaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgacgactctaggtgcctgggtgggtaataatttggaaga
tcaagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagacactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606658_PreC_P-A Feature FT:CDS KM606658_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba31a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccattataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctatc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctggtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606659_PreC_P-A Feature FT:CDS KM606659_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba33a). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctatgctgggtggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctggtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccacca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606660_PreC_P-A Feature FT:CDS KM606660_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba34a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
cataccgcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tctcttgccttacttttggaagagaaactgtacttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606661_PreC_P-A Feature FT:CDS KM606661_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba35a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagacaaactgtacttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagacgaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606662_PreC_P-A Feature FT:CDS KM606662_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba36a). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgcctcatgacttctttc
cgtcggcgccagacctcctggataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgcacaccccac
catactgcactcaggcaagccattctctgctggggggaattgacgactctaggttcctgggtgggtaataatttgcaaga
tcaagcatccagggatcaagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagacgttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactgctgttattagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaat
gttag
>gnl|hbvcds|KM606663_PreC_P-A Feature FT:CDS KM606663_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba38a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagataccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606665_PreC_P-A Feature FT:CDS KM606665_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba40a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606666_PreC_P-A Feature FT:CDS KM606666_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba41a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606669_PreC_P-A Feature FT:CDS KM606669_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba45a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagataccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606671_PreC_P-A Feature FT:CDS KM606671_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba50a). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggcgcttctgtggagttactctcgtttttacctcatgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctatttcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaagtgacggctctaggtgaatgggtgggtaataatttgcaaga
tcaagcatccagggatctagtagtcaattatgttgatactaatatgggattaaagattaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgacacaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606672_PreC_P-A Feature FT:CDS KM606672_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba54a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctggtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagca
tatagaccaccaaatgcccctatcttatcaacacctccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606673_PreC_P-A Feature FT:CDS KM606673_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba55a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgatttctttc
cttccgtccgggatttacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcaccgcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606674_PreC_P-A Feature FT:CDS KM606674_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba56a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606676_PreC_P-A Feature FT:CDS KM606676_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba59a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctatgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatcaagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606677_PreC_P-A Feature FT:CDS KM606677_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba60a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttagaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606678_PreC_P-A Feature FT:CDS KM606678_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba61a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttagaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606680_PreC_P-A Feature FT:CDS KM606680_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba66a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttagaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606683_PreC_P-A Feature FT:CDS KM606683_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba69a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606684_PreC_P-A Feature FT:CDS KM606684_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba71a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606685_PreC_P-A Feature FT:CDS KM606685_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba72a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606687_PreC_P-A Feature FT:CDS KM606687_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba75a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606688_PreC_P-A Feature FT:CDS KM606688_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba78a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=644 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgccgagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcggcaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccgttctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagacactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gtta
>gnl|hbvcds|KM606691_PreC_P-A Feature FT:CDS KM606691_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba82a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606692_PreC_P-A Feature FT:CDS KM606692_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba83a). Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctggtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcaaatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606693_PreC_P-A Feature FT:CDS KM606693_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba84a). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctagtcatctcttgtacatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggcgctactgtggagttactctcttttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgcacacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccc
tatagaccactaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606694_PreC_P-A Feature FT:CDS KM606694_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba85a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctggtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606695_PreC_P-A Feature FT:CDS KM606695_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba86a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=642 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctacaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagataccgcctcagctctatatcgagaagccttagagtctcatgagcattgctcacctcac
catactgcactcaggcaagccattctatgctggggggaattgatgactctagctacctgggcgggtaataatttggaaga
tccagcatccagggatctagtagtcaattacgttaatactaacatgggtttaaagatcaggcaaatactgtggtttcata
tatcctgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccacct
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcacaagatctcaatctcgggaatctcaat
gt
>gnl|hbvcds|KM606700_PreC_P-A Feature FT:CDS KM606700_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba100a). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=644 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gtta
>gnl|hbvcds|KM606737_PreC_P-A Feature FT:CDS KM606737_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba13a). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactcttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactctcatttttgccttctgacttctttc
cttccgtccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagagatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcctgccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606742_PreC_P-A Feature FT:CDS KM606742_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttttgacttctttc
cttccgtcagagatttcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctttgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606746_PreC_P-A Feature FT:CDS KM606746_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba14). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606748_PreC_P-A Feature FT:CDS KM606748_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba51). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctaatgtacatgtaccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgatttctttc
cttccgtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcaccgcat
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatttagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KM606749_PreC_P-A Feature FT:CDS KM606749_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba56). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctggtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP168422_PreC_P-A Feature FT:CDS KP168422_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KN136). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtccyactgttcaagcctccaagctgtgccttggatggct
ttagggcatggacatcgacccttataaagaatttggagctactgtggagttactctcktttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctctgcgctatatcgggaagccttagagtctcctgagcattgctcacctcat
catacagcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtcgtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagaygwcgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP168423_PreC_P-A Feature FT:CDS KP168423_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate NRB517). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctytgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP168424_PreC_P-A Feature FT:CDS KP168424_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KSM571). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctctcctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggagga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP168425_PreC_P-A Feature FT:CDS KP168425_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MBS119). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattttctggtgggtggaattaatgactctagctacctgggtgggtaataatttggagga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP168426_PreC_P-A Feature FT:CDS KP168426_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KSM05). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggktggct
ttggggcatggacattgacccctataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtgcgggatctacttgatacagccttagctctgtatcgggaagccttagagtctccngagcattgctcaccycac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttagaaga
tccagcatccagggatctagtagtcaattatgttaatactcacatgggcctaaaaattagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggwcccc
tagaagaagaactccctcgcctcgcmgacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP168427_PreC_P-A Feature FT:CDS KP168427_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EMB201). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtgcgggatctacttgatacagcctcagctctgtaccgagaagccttagagtctcctgagcattgctcacctcat
cacacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttagaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcata
tttcttgccttacttttggaagagaaattgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP168428_PreC_P-A Feature FT:CDS KP168428_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KN195). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttccgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgcacacctcac
catactgcactcaggcaagccgttctatgctggggggaattaatgactctagctacctgggtgggtaataatttggacga
tcmagcatccagggatctagtagtcaattatgttaatactcacatgggcctaaagatcaggcaactgttgtggtttcata
tttcttgccttacttttggaagaraaactgtccttgagtatttagtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgtcgcgaccgaggyaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|KP168429_PreC_P-A Feature FT:CDS KP168429_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KN033). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgycttctgacttctttc
cttccgtccgggatctactagatacascctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctggtgggkggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcaggcaactgttgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttagtgtctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP168430_PreC_P-A Feature FT:CDS KP168430_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate NRB10). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactgttgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttagtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP168431_PreC_P-A Feature FT:CDS KP168431_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KSM03). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcatggctcacctcac
catactgcactcaggcaagccattctttgctggggggacgtaatgaatctagctacctgggtgggtactaatttggaaga
tccagcatccagggatctggtagtcaattatgttaatactaccataggcctaaagatcaggcaactgttgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaat
gttag
>gnl|hbvcds|KP168432_PreC_P-A Feature FT:CDS KP168432_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EMB213). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcttcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactgttgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtatctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP168433_PreC_P-A Feature FT:CDS KP168433_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate NRB04). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctytgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactgttgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP168434_PreC_P-A Feature FT:CDS KP168434_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KSM564). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctgctagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccggcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP168435_PreC_P-A Feature FT:CDS KP168435_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MBS117). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtgcgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaatatgggcctaaagattagacaactgttgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP274925_PreC_P-A Feature FT:CDS KP274925_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS-1). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacggagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP274927_PreC_P-A Feature FT:CDS KP274927_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS-3). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatctagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP274928_PreC_P-A Feature FT:CDS KP274928_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS-4). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatgatgtcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP718085_PreC_P-A Feature FT:CDS KP718085_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-12-1-26). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgatttctttc
cttccgtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcaccgcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP718086_PreC_P-A Feature FT:CDS KP718086_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-03-02-1-60). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgatttctttc
cttccgtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcaccgcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP718087_PreC_P-A Feature FT:CDS KP718087_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1897). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagataccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcagrcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP718088_PreC_P-A Feature FT:CDS KP718088_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1162). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP718089_PreC_P-A Feature FT:CDS KP718089_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1249). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcytcagctctatatcgagaagccttagagtytcctgagcattgctcacctcac
catactgcactcaggcaagccattytytgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP718090_PreC_P-A Feature FT:CDS KP718090_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1348). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctytgcctaatcatctyttgtacatgtcccmctgttcmagcctycaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP718091_PreC_P-A Feature FT:CDS KP718091_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1771). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctytgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcytcagctctatatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP718092_PreC_P-A Feature FT:CDS KP718092_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1891). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatytyttgtacatgtcccactgttcaagcctycaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattytstgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaaratcaggcaactattgtggtttcaya
tatcytgccttacttttggaagagagacsgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP718093_PreC_P-A Feature FT:CDS KP718093_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1202). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaacttttacacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP718094_PreC_P-A Feature FT:CDS KP718094_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 8757_TR). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtgtaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP718095_PreC_P-A Feature FT:CDS KP718095_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 8809_TR). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcagaggcaggtcccc
tagaagaagaaccccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP718096_PreC_P-A Feature FT:CDS KP718096_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-0004). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcataatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactatcatttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP718097_PreC_P-A Feature FT:CDS KP718097_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GP13-1943). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP718098_PreC_P-A Feature FT:CDS KP718098_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3106_HIV). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP718099_PreC_P-A Feature FT:CDS KP718099_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GP13-378). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP718100_PreC_P-A Feature FT:CDS KP718100_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 137_HIV). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatytcctagacaccgcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccrgcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctcyagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP718101_PreC_P-A Feature FT:CDS KP718101_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GP11-3018). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccacatcccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP718102_PreC_P-A Feature FT:CDS KP718102_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GP12-1400). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatcttttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctactcgacaccgcttcagccctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccytcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaat
gttag
>gnl|hbvcds|KP857058_PreC_P-A Feature FT:CDS KP857058_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccacctaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP857059_PreC_P-A Feature FT:CDS KP857059_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcatctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagaccttgtacttgaatatttggtctcttttggagtgtggattcgcactcctccaccc
tatagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagaggaagcaaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaat
gttag
>gnl|hbvcds|KP857060_PreC_P-A Feature FT:CDS KP857060_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccgcctgacttctttc
cttccgccagagatctgctagacaccgccgcagcactgtttcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccagtctctgctgggtggaattgatgactctagctacctgggtgggtaataatttgcaaga
tacagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaatgcttccggaaactactgttattagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaayctcaat
gttar
>gnl|hbvcds|KP857061_PreC_P-A Feature FT:CDS KP857061_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctcatgacttttttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcagctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaacggggccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP857062_PreC_P-A Feature FT:CDS KP857062_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagaggttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP857063_PreC_P-A Feature FT:CDS KP857063_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagatactgtacttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP857064_PreC_P-A Feature FT:CDS KP857064_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagaggctcctgagcattgctcacctcac
catactgcactcaggcaagccattctatgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactcacatgggattaaagatcaggcaactattgtggtttcaca
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggtgtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttcttagacgacgggaccgaggcaggtcccc
tagaggaagaactccctcgcctcgcagacgcagatctaaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|KP857065_PreC_P-A Feature FT:CDS KP857065_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttatc
cttccgtccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcagctcac
catacagcaatcaggcaagccattctctgctggggggaattaatgactctagccacctgggtgggaaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaagttgtccttgagtatttggtctcttttggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagaggccgagcccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcact
gttag
>gnl|hbvcds|KP857066_PreC_P-A Feature FT:CDS KP857066_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctagtcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggcgcttctgttgagttactctcgtttttgccttctgacttctttc
cttccgtcaaagatctctatgacaccgccttagctctgcatcgagaagccttagagtctccggagcattgcacacatcat
catactgcactcaggcaagccattctctgctggggggacttgatgaatctagctaactgggtgggtactaatttggacga
tccagcatccagggatctagtagtcaattatgtgaataccaacatggggttaaagatcaggcaattattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccactaaatgcccctatcttatcaacacttccggaatgtactgttgttagacaacggggccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP857067_PreC_P-A Feature FT:CDS KP857067_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcaaagatctcctagacaccgcctcagctctgtatcgagatgccttagagtctgctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggatgtgatgactctaggtacctgggtgggtaataatttggatga
tccagcatccagggatcaagtagtcaattatgttaatactaacatgggcttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagacagactgtagttgaatatttgatctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttrttagacgaagggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctagggaatctcaat
gttaa
>gnl|hbvcds|KP857068_PreC_P-A Feature FT:CDS KP857068_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctattcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagcgctttatcgagatgccttggagtctcctgagcattgctcacctcac
catactgcaatcaggcaaatcgttctctgctggggggatgtaatgaatctagctacctgggtgggtagtaatttgcaaga
tccagcatccagggatcaagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
catcttgccttacttttggaagagatactgtagttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccactaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgacgcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP857069_PreC_P-A Feature FT:CDS KP857069_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggaattactctcgtttttgccttctgacttctttc
cttccgccagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcatctcac
catactgcactcaggcaagccattctctgctggggggaattgacgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatcaagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcata
tatcttgcattacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaaatactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP857070_PreC_P-A Feature FT:CDS KP857070_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacatcgacccttataaagaatttggagcgtctgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaaagcttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggacttgacgactctaggttcctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacctttggaagggatactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccagtaaatgcccctatcttatcaacacttccggaaactactgttgttagatcccgaaaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP857071_PreC_P-A Feature FT:CDS KP857071_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacatcgacccttataaagaatttggagcgtctgtggagttactctcatttttgccttctgacttctttc
cttccgtcagagatcttctagacaccgcctcagctctgtatcgagaaascttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggacttgacgactctaggttcctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacctttggwagggatactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tataggccagtaaatgcccctatcttatcaacacttccggaaactactgttgttagatcccgaaaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP857072_PreC_P-A Feature FT:CDS KP857072_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctattcacctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttccgccagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcatggctcatctcac
catactgcactcaggcaagccattctctgctggcaggaagtaacgactctagcttcctgggtgggtactaatttggatga
tccatcatccagggatcaagtagtccattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tctcttgccttacttttggaagagatattgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttaa
>gnl|hbvcds|KP857073_PreC_P-A Feature FT:CDS KP857073_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttttatc
cttccgtcagagatctcctagacaccgccacagctctgtatcgagaagccttagagtctcctgagcattgctcagctcac
catactgcaatcaggcaagccattctatgctggggggaattgatgactctagcttcctgggtgggtgctaatttggacga
tccagcatccagggatcaagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagacacactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggcgggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP857074_PreC_P-A Feature FT:CDS KP857074_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcctaatgacttctatc
cttccgtcaaagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcagctcac
catactgcactcaggcaagcaattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tcaagcatccaggaatctagtagtcgattatgttaataataacgtgggtttaaggctcaggcaactattgtggtttcatg
tatcttgccttacttttggaagagagacggtacttgaatatttagtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP857075_PreC_P-A Feature FT:CDS KP857075_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagagtttggagctagtgtggagttactctcgtttttgccttctgacttttttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtcttctgagcattgctcacctcac
catactgcactcaggcaagccgctctctgctggtgggaattgacgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagacagactgtagttgagtatttgatctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggactctagat
gttag
>gnl|hbvcds|KP857076_PreC_P-A Feature FT:CDS KP857076_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcctttttgccttctgacttctttc
cttccgccagagatctcctagacaccgcctcagctctgtatagagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaagtgacgkmtctagctacctgggtgggtactaatttggacga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
catcttgcattacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaacc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaat
gttag
>gnl|hbvcds|KP857077_PreC_P-A Feature FT:CDS KP857077_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctattgacttctatc
cttccgtcagagatctcatagaaaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagcaattctctgctggggggaattgatgactttagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtagttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaacaaatgcacctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP857078_PreC_P-A Feature FT:CDS KP857078_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
ttgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttc
cttccaccaaagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctttgctggggggatgtgatgactctaggtacctgggtgggtaataatttggaaga
tcaagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagattaggcaactattgtggtttcaca
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagaccacgacaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaat
gttga
>gnl|hbvcds|KP857079_PreC_P-A Feature FT:CDS KP857079_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgccactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgagatcttctagacaccgcctcagctttgtatcgagaagccttagagtctcctgagcatgkctcacctcac
catactgcactcaggcaagccattctmtgctggggggawgtgatgactctaggtacctgggtgggtrataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttactttcggaagagacactgtacttgaatatttggtstctttcggagtgtggattcgcactcctccagcc
tatagaccacmaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctagggaacctcaat
gttag
>gnl|hbvcds|KP857080_PreC_P-A Feature FT:CDS KP857080_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccgttctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatcaagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagawgwcgagaccgaggcagggcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP857081_PreC_P-A Feature FT:CDS KP857081_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttc
cttccgtcaaagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcmtgagcattgcacacctcac
catactgcactcaggcaagccattctctgctggggggacgtgatgaatttagctacctgggtgggtgctaatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccaccc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctagggaacctcaat
gttag
>gnl|hbvcds|KP857082_PreC_P-A Feature FT:CDS KP857082_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggcgccactgtggagttactctcttttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtttcgcgacgccttagagtctcctgagcattgcacacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgtgaatactaacatgggtacaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttgtcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP857083_PreC_P-A Feature FT:CDS KP857083_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgcactcctcac
catactgcactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccc
tatagaccactaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|KP857084_PreC_P-A Feature FT:CDS KP857084_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgccagagatctcctagccaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctatgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcgattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaacaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP857085_PreC_P-A Feature FT:CDS KP857085_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcctattgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgcacacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatcaagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacatgaatatttagtctcttttggagtgtggattcgcactcctccagcc
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaat
gttag
>gnl|hbvcds|KP857086_PreC_P-A Feature FT:CDS KP857086_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggcgcttctgcgcagttgctctcgtttttgcctgctgatttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggttggaattgatgactctagctacctgggtgggtaataatttggatga
tccagcatccagggatcaagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagacagactgtagttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccactaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP857087_PreC_P-A Feature FT:CDS KP857087_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacctgtataaagaatttggagctactgtggagttactctcttttttgcctcatgacttctatc
cttccgtcagagatctcctagacaccgcctcggctctgtttcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattgtctgctggggggaattgaacactctaggtacctgggtgggtaataatttggaaga
tcaagcatccagggatctagtagtcaattatgttaataataacatgggtataaagatcaggcaactgttgtggtttcatg
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacccagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaat
gttag
>gnl|hbvcds|KP857088_PreC_P-A Feature FT:CDS KP857088_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtctcactgttcaagcctccaagctgtgccttaggtggct
ttgaggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctcttgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcac
catactgcaatcaggcaagccattctctgctggggggaattgatgactctagctaactgggtgggtaataatttggatga
tccagcatccagagatctagtagtcaattatgttaataacaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagaaatactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagct
tatagaccactaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP857089_PreC_P-A Feature FT:CDS KP857089_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcccctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacatcgacccttataaagaatttggagctactacggaattactctcgtttttgccttctgacttctttc
ctaacatcagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcagctcac
catactgcactcaggcaagccattatctgctggggggaattgatgagtctagctacctgggtgggtggtaatttgcaaga
tcaagcatccagggatctagtagtcaactatgttaatattaacatgggtttaaagatcaggcaaatattgtggtttcata
tatcttgccttacttttggaagagagacggtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcctatcaacacttccggaaacttgtgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KP857090_PreC_P-A Feature FT:CDS KP857090_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=645 residues).
atgtaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggcgcttctgtggagttactctcttttttgccttctgacttctttc
cttccgcccgagacctcctagataccgcctcagctctatatcgggaagcactagagtctcctgagcattgctcacctcat
catacagcactcaggcaagccattctctgctggggggatgtaacgactctagctacctgggtgggtactaatttggaaga
tccagcatccagggatcaagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtacttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgatgcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcttaat
gttag
>gnl|hbvcds|KP857091_PreC_P-A Feature FT:CDS KP857091_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=642 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctcatgacttctttc
cttccatcagagatctcctagacaccgcctcggctctgtatcgagaagccttagagtctcctgagcattgctcacatcac
cataccgcaatcaggcaagccattctctgctggggagaattgacgactctagctacctgggtgggtactaatttggacga
tccaggatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagacactgtacttgaatttttggtctcttttggagtgtggattcgcactcctccggcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacggggaggcaggtcccctag
aagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgtt
ag
>gnl|hbvcds|KP857092_PreC_P-A Feature FT:CDS KP857092_PreC_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctgggtggaattgaygactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatcaagtagtcaattatgttaatactaacatgggtttaaagctcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtaattgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccatcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KP995108_PreC_P-A Feature FT:CDS KP995108_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 203-Cirrhosis). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctatc
cttccgtcagagatctcgtagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcatggctcacctcac
catactgcactcaggcaagccattgtctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaat
gttag
>gnl|hbvcds|KR905425_PreC_P-A Feature FT:CDS KR905425_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICI-24). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagacacagcctcagctctatttcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattactgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaattgctgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KR905426_PreC_P-A Feature FT:CDS KR905426_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICI-28). Complete genome. [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcat
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatcaagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgttcttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KR905427_PreC_P-A Feature FT:CDS KR905427_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICI-30). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccgtataaagaatttggagctactgtggagttgctctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcatcagctttatatcgggaagccttagaggctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctgggtggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagatactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagtc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaat
gttag
>gnl|hbvcds|KR905429_PreC_P-A Feature FT:CDS KR905429_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICI-35). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgcacaccgcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KR905430_PreC_P-A Feature FT:CDS KR905430_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICI-47). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KR905431_PreC_P-A Feature FT:CDS KR905431_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICI-77). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT151611_PreC_P-A Feature FT:CDS KT151611_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 398). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctacggtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggagttratgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT151612_PreC_P-A Feature FT:CDS KT151612_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 500). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactagcgagttactctcttttttgccttctgacttctttc
cttccgtycgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccgttctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtttctttcggagtgtggatccgcactcctccaccc
tatagaccagcaaatgcccctatcttatcaacacttccggaaactactgttattagaggaagaggccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT151613_PreC_P-A Feature FT:CDS KT151613_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 792). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgtcaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT151614_PreC_P-A Feature FT:CDS KT151614_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 969). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactkttcaagcctccaagctgtgccttggrtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagacacagcctcagctctatatcgggaagccttagagtctcctgagcattgctctcctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT151615_PreC_P-A Feature FT:CDS KT151615_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 191). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgaccattataaagaatttggagctactgtggagttactctcatttttgcctyytgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggagttratgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcy
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT151616_PreC_P-A Feature FT:CDS KT151616_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 655). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagaatctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT151617_PreC_P-A Feature FT:CDS KT151617_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 803). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactagcgagttactctcttttttgccttctgacttctttc
cttccgttcgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccgttctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtttctttcggagtgtggatccgcactcctccaccc
tatagaccascaaatgcccctatcttatcaacacttccggaaactactgttattagaggaagaggccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT151618_PreC_P-A Feature FT:CDS KT151618_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 590). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtacttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT347087_PreC_P-A Feature FT:CDS KT347087_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM265). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctacttgatacagcctcagcactgtatcgggaagccttagagtctcctgagcattgctcacctcat
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tcctgcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctccttcggggtgtggattcgcactcctccagcc
tatagacccccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT347088_PreC_P-A Feature FT:CDS KT347088_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM285). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tcctgcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcacccctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT366466_PreC_P-A Feature FT:CDS KT366466_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C-EICI.7). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagacacagcctcagctctatttcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattactgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaattgctgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT366467_PreC_P-A Feature FT:CDS KT366467_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C-EICI.9). Complete genome. [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcat
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatcaagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgttcttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT366468_PreC_P-A Feature FT:CDS KT366468_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C-EICI.27). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT366469_PreC_P-A Feature FT:CDS KT366469_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C-EICI.28). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagacacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtatctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT366470_PreC_P-A Feature FT:CDS KT366470_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C-EICI.31). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT366471_PreC_P-A Feature FT:CDS KT366471_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C-EICI.50). Complete genome. [Hepadnaviridae] (length=645 residues).
ctgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttc
cttccgtccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT749822_PreC_P-A Feature FT:CDS KT749822_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL19). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctcatgacttttttc
cttccgtcagagatctactagacaccgcctcagctctgtatagagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctatgctggggggaattgatgactctagctacctgggtgggtaataacttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactactgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacaccgggaccgaggcaggtctcc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT749824_PreC_P-A Feature FT:CDS KT749824_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL2b). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattggggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT749825_PreC_P-A Feature FT:CDS KT749825_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL4a). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatctagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT749826_PreC_P-A Feature FT:CDS KT749826_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL4b). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatctagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT749829_PreC_P-A Feature FT:CDS KT749829_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL7). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT749830_PreC_P-A Feature FT:CDS KT749830_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL5b). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT749831_PreC_P-A Feature FT:CDS KT749831_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL8). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactcttgctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaataccaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT749832_PreC_P-A Feature FT:CDS KT749832_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL10). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttaatctcgtttttgcctgctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcagctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcgtgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT749833_PreC_P-A Feature FT:CDS KT749833_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL9b). Non-functional genomic sequence. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttc
cttccgtcagagatctcgtagacaccgcctcagctctgcatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattgtctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT749834_PreC_P-A Feature FT:CDS KT749834_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL9a). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatctagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcatacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT749835_PreC_P-A Feature FT:CDS KT749835_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL9c). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT749836_PreC_P-A Feature FT:CDS KT749836_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL12). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT749837_PreC_P-A Feature FT:CDS KT749837_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL15). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcat
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT749838_PreC_P-A Feature FT:CDS KT749838_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL16). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT749839_PreC_P-A Feature FT:CDS KT749839_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL5d). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatctagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaacaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT749840_PreC_P-A Feature FT:CDS KT749840_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL18). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT749842_PreC_P-A Feature FT:CDS KT749842_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL4e). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatctagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT749843_PreC_P-A Feature FT:CDS KT749843_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL5c). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctatgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT749844_PreC_P-A Feature FT:CDS KT749844_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL25). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctacttgacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT749846_PreC_P-A Feature FT:CDS KT749846_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL4f). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatctagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT749847_PreC_P-A Feature FT:CDS KT749847_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL4d). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatctagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT749849_PreC_P-A Feature FT:CDS KT749849_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL4c). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatctagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KT749850_PreC_P-A Feature FT:CDS KT749850_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL21). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KU605516_PreC_P-A Feature FT:CDS KU605516_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1486F1). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=642 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gt
>gnl|hbvcds|KU605517_PreC_P-A Feature FT:CDS KU605517_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1486F2). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=642 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gt
>gnl|hbvcds|KU605518_PreC_P-A Feature FT:CDS KU605518_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM8787F1). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=642 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tcctgcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcacacctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gt
>gnl|hbvcds|KU605519_PreC_P-A Feature FT:CDS KU605519_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM8787F3). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=642 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tcctgcatccagggatctagtagtcaattatgttaatactaacatgggcctcaaaatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcacacctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gt
>gnl|hbvcds|KU605520_PreC_P-A Feature FT:CDS KU605520_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1163F1). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=642 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tcctgcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gt
>gnl|hbvcds|KU605521_PreC_P-A Feature FT:CDS KU605521_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1163F2). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=642 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tcctgcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gt
>gnl|hbvcds|KU605522_PreC_P-A Feature FT:CDS KU605522_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1163F4). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=642 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tcctgcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gt
>gnl|hbvcds|KU605532_PreC_P-A Feature FT:CDS KU605532_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1486Baseline). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtcagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcac
catactgcactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcata
tatcttgccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KU605533_PreC_P-A Feature FT:CDS KU605533_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM8787Baseline). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaaatttttcacctctgcataatcatctcttattcatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tcctgcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcacacctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KU605534_PreC_P-A Feature FT:CDS KU605534_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM8787F2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tcctgcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcacacctccagct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KU605535_PreC_P-A Feature FT:CDS KU605535_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1163Baseline). Complete genome. [Hepadnaviridae] (length=644 residues).
tgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctt
tggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttcc
ttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcacc
atacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagat
cctgcatccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcatat
ttcttgccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcct
atagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccct
agaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatg
ttag
>gnl|hbvcds|KU605536_PreC_P-A Feature FT:CDS KU605536_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM4643Baseline). Complete genome. [Hepadnaviridae] (length=642 residues).
caaatttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttg
gggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttcctt
cagtacgggatctacttgatacagcatcagctctgtatcgggaagccttagaatctccggagcattgctcccctcaccat
acagcactcaggcaagccattctatgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatcc
agcatccagggatttagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcatattt
cttgccttacttttggaagagaaactgtccttgagtatttagtctctttcggagtgtggatacgcactcctccagcctat
agaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctag
aagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgtt
ag
>gnl|hbvcds|KU605537_PreC_P-A Feature FT:CDS KU605537_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM4643F1). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtacgggatctacttgatacagcatcagctctgtatcgggaagccttagaatctccggagcattgctcccctcac
catacagcactcaggcaagccattctatgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatttagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttagtctctttcggagtgtggatacgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KU605538_PreC_P-A Feature FT:CDS KU605538_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM4643F2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtacgggatctacttgatacagcatcagctctgtatcgggaagccttagaatctccggagcattgctcccctcac
catacagcactcaggcaagccattctatgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatttagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttagtctctttcggagtgtggatacgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KU605539_PreC_P-A Feature FT:CDS KU605539_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM4643F3). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtacgggatctacttgatacagcatcagctctgtatcgggaagccttagaatctccggagcattgctcccctcac
catacagcactcaggcaagccattctatgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatttagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttagtctctttcggagtgtggatacgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KU736918_PreC_P-A Feature FT:CDS KU736918_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Tanzania_1). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacagctattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KU736919_PreC_P-A Feature FT:CDS KU736919_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Tanzania_2). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttcagtccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacagctattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccc
tagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
gttag
>gnl|hbvcds|KU736920_PreC_P-A Feature FT:CDS KU736920_PreC_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Sudan_10). Complete genome. [Hepadnaviridae] (length=645 residues).
atgcaactttttcacctctgcctaatcatctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccttataaaraatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cttccgtccgggatctwctagatacmgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcac
catacagcactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcata
tttcttgccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcc
tatagaccacctaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccc
tagaagaagaactccc