HBVdb

Dataset for nucleotide sequence P of genotype A

[Download (right click)] [Alignment] [Repertoires]

1170 sequence(s)

>gnl|hbvcds|AB014370_P_P-A Feature FT:CDS AB014370_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 11D11HCC). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaacattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggttcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaaactctgcaggatcccagagtcagggg
tctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaacgatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgccccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB064314_P_P-A Feature FT:CDS AB064314_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggttccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
ttccctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
agcacccgggtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
ctgttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcccttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatgtacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB076678_P_P-A Feature FT:CDS AB076678_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala14). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcc
tttcctaaaatccatttacaagaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaacctt
attatcctgatcaagtagttaatcattatttccagacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
taccaaaacctcgcaaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggctacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggcaatgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctcgcacatctcgtcaacct
cctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
ctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcaggacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtaattggaagttggggttcattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaactgcctgttaatcgacctgttgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgccttaatgcctttgtatgcatgtatacaagcaaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagcaggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB076679_P_P-A Feature FT:CDS AB076679_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala35). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagagaccgaggcgggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttgttgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcc
tttcctaagatccatttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaag
aagattgaaattaattatgcctgctagattttatcctaaccgcactaaatatttgcctctagacaaagggattaaacctt
attattctgatcaagtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
taccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagactgggacttcaaccccatcaaggaccgctggccacaagccaaccaggt
aggagtgggagcgttcggcccagggttcactcccccacacggaggtgttttggggtggaaccctcaggctcagggcatat
tgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcagggaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccgtgcagtggaatttcacagctttccaacaagccctacaagatcccagagtcagggg
catatatcttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgttgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggt
tccacccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgcttgatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttctt
ctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcctgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaa
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaacttcatgggatacgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttaggaaacttcctgtcaatcgacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgccttaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggttggggcttggctatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcgaaactcat
tgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtgctgccaactggattc
ttcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB116076_P_P-A Feature FT:CDS AB116076_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-USA1911). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgccgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaagtatctgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccgtgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcagggg
tctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacaaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcaaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgcttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcttgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtcaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgcccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB116077_P_P-A Feature FT:CDS AB116077_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-USA2126). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
catgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtgtttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaagacctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctttcgcggaaatatacatcatttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB116078_P_P-A Feature FT:CDS AB116078_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-USA712). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctaaccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctttcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB116079_P_P-A Feature FT:CDS AB116079_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TR1). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB116080_P_P-A Feature FT:CDS AB116080_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TR2). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaagttaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcggaccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggacatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB116081_P_P-A Feature FT:CDS AB116081_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TR3). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcaaacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatattttcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaactccactgccttccaccaagctctgcaggatcccaaagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctctgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB116082_P_P-A Feature FT:CDS AB116082_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN1). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaaaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgttcctatctttaatcctgaatggcaaaccccttct
tttcctaaaattcatttacatgaagacattgctaataagtgtcagcaatttgtaggccctctcactgtaaatgaaaaaag
aagactgaaattaattatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tgaccacagtgccagcagtacctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaaactctgcaagataccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccgactattgcctctcacatctcgtcaatct
cctcgaggattggggaccctgcgccgaacatggagaacatcacatcaggactcctaagacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggcgaag
tctgtacagcatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatgggttatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaactgcctgtcaatcgacctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggatgtat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB116083_P_P-A Feature FT:CDS AB116083_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN36). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttct
tttccaaaaattcatttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctaggttttatcctaacagcacaaaatatttgcctctagacaaagggattaaacctt
attatcctgatcaggtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattttatat
aagagggaaacttcacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttgaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccaggactcactcccccacacggaggtgtcttggggtggagccctcaggctcagggcatat
tgaccacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagccctgcaagatcccagagtcagggg
cctgtatattcctgctggtggctccagttcaggaactctcaaccctgttcccaatattgcctctcacatatcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctg
cacgagtcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacatgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctgaatttcatgggttatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcagagaattgcgggt
cttttgggttttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcaaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgcggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggaccgataattctgtcgtcctctctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccttcgcgaggccgcttgggactgtat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggaaaccaccgtga
>gnl|hbvcds|AB116084_P_P-A Feature FT:CDS AB116084_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN81). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgcgaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatccctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgattggcaaactccttct
tttcctaaaattcatttacatgaagaccttgctaataggtgtcagcaatttgtaggccctctcactgcaaatgaaaagag
aagactgaaattaattatgcctgctaggttttatcctaacagcacaaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttaaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaagaccactggccacaagccaaccaggt
aggagtgggagctttcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagccctgcaagatcccagagtcagggg
cctgtatattcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
aacacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcagggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctgaatttcatggggtatgtaattggaagttggggtaccttgccgcaggatcacattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgctttaatgcctttgtatgcatgtatacaggcgaaaca
ggcttttactttctcgccaacttacaaggcctttctacgtcaacagtatatggacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB116085_P_P-A Feature FT:CDS AB116085_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN83). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttct
tttcctaaaattcatttacatgaagacattgctaataggtgtcaacaatttgtaggccctctcactgtaaatgaaaaaag
aagactgaaattaattatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tgnccacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctgtccaccaagctctgcaagatcccagagtcagggg
cctgtatattcctgctggtggctccagttcaggaacactcaaccctgttccaactattgcctctcacatctcgtcaatct
cctcgaggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
ntcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaaccttctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggaccttgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagttattcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctgaatttcatggggtatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcagagaattgtgggt
cttttgggcttcgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaaaccaccgtga
>gnl|hbvcds|AB116086_P_P-A Feature FT:CDS AB116086_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-IND18). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagctatttgtaggccctctcactgtaaatgaaaagag
aagactgaaattaattatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacacgacattatttacatactctttggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcaattggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccgtgaagtggaattccacaactttccaccaagctctgcaagatcccagagtcaggag
cctgtatcttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggcgaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatggggtatgtaattggaagttggggtacattgccacaggagcatatta
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtcaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctagggtgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggtcgcttgggactctat
cgtcccctgctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB116087_P_P-A Feature FT:CDS AB116087_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-IND8). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgacgagtccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcataaggtgggaaattttgctgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttct
tttcctaaaattcatttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaag
aagactgaaattaattatgcctgctaggttttatcctaacagcacaaaatatttgcctttggacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggatttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcatacgggccagggttcactcccccacacggaggtgtcttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcaatggaattccacagctttccaccaaactctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaactattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctgaatttcatgggttatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaactcaaacactgttttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctagggtgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggatgttt
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB116088_P_P-A Feature FT:CDS AB116088_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-NEP30). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgattggcaaactccttct
tttcctaaaattcatttacatgaagacattgctaataggtgtcaacaatttgtaggccctctcactgtaaatgaaaaaag
aagactgaaattaattatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttacgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggat
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
gggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaactattgcctctcacatctcgtcaatct
cctcgaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggg
atcacccgggtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaayttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccctttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggttctgggggccaaa
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttatgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctgaatttcatgggttatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaamtcaaacactgttttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcagagaattgtgggt
cttttgggcttcgccgctccatttacacaatgtggttaccctgcattaatgcctttatatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctacgtcaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgcggccgcttggggctgtat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB116089_P_P-A Feature FT:CDS AB116089_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-NEP39). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatccctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttct
tttcctaaaattcatttacatgaagacattgctaataggtgtcaacgatttgtaggccctctcactgtaaatgaaaaaag
aagactaaaattaattatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtcttttggggtggagccctcaggctcagggcatat
tgaccacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaactattgcctctcacatctcgtcaatct
cctcgaggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttctcgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctg
cacgactcctgctcgaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccacg
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctgaatttcatgggttatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcagagaattgtgggt
cttttgggcttcgccgctccatttacacaatgcggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaaatgcacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggatgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgcggccgcttggggctgtat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgaacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB116090_P_P-A Feature FT:CDS AB116090_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-NEP40). Complete genome. [Hepadnaviridae] (length=2517 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttccaaaaattcatttacatgaagacattgctaataggtgtcagcaatttgtaggccctcttactgtaaatgaaaagag
aagactgaaattaattatgcctgctaggttttatcctaacagcacaaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaaccagacattatttacatactctttggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcattcgcaaaggca
tggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagccaattca
aacaatccagattgggacttcaaccccatcaaggaccactggccgcaagccaaccaggtaggagtgggagcattcgggcc
agggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattgaccacagtgccagcagtgc
ctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctcag
gccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtgg
ctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctg
cgccgaacatggagaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaga
atcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggcca
aaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgc
ggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttg
cccgtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaa
ctctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctt
tcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgta
gggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtcc
ctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattc
cctgaatttcatggggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgtt
ttagaaaacttcctatcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctcca
ttcacacaatgtggttaccctgccttaatgcctttgtatgcatgtatacaagcaaaacaggcttttactttctcgccaac
ttataaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttg
ctgacgcaacccccactggctggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatc
catactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgt
cctctctcggaaatatacatcgtttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgttt
acgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccg
taccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcactt
cgcttcacctctgcacgttgcatggaaaccaccgtga
>gnl|hbvcds|AB116091_P_P-A Feature FT:CDS AB116091_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH1). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactgaaattaattatgcctgctagattttatcctaacagcactaaatacttgcctctagacaaagggattaaacctt
attatcctgatcaagtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattctgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggatcactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tgaccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatacagtggaattccacagcttttcgccaagctctgcaagatcccagagtcagggg
cctgtatcttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
agcacccgtgtgtcntggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggaacctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctgaatttcatggggtatgtaattggaagttggggttcattgccacaggatcatattg
tacaaaaaatcaaacgctgttttagaaaacttcctgtcaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggttaccctgccttaatgcctttgtatgcatgtattcaagcaaaaca
ggcttttactttctcgccaacttacaaggcctttctgaatcaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcngcgctgaatcccgcggacgacccttcgcggggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB116092_P_P-A Feature FT:CDS AB116092_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH20). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcataaggtgggaaattttactggactttattcttctactgtccctatctttaatcctgaatggcaaacaccgtct
tttcctaaaattcatttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaag
aagactgaaattaattatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaaactt
attatcctgatcaggtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcatattgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaacccgctgggattctttcccgatcatcagttggac
cctgcattcggagccaatgcaaacaatccagattgggacctcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcatttggaccagggctcactcccccacacggaggtgttttggggtggagccctcaggctcaaggcatat
tggccaccgtgccaacagtgcctcctcctgcctccaccaatcggcagtcgggaaggcagcctactcccatttctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaactattgcctctcacatctcgtcaatct
cctcgaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
agcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctg
cacgactcctgctcaagggaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttggggtttcgcaaaattcctatgggagtgggcctcagtccgtttctcttgtctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggcttttagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttacaccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctgaatttcatgggttatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtaaatcgacctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgcagctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaggcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactcat
cggaactgataattctgtcgtcctttctcggaagtatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccttcgcgaggccgcttggggctgtat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB116093_P_P-A Feature FT:CDS AB116093_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH25). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactaaaattaattatgcctgccagattttatcctaacagcactaaatatttgccactagataaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggatcactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tgaccacagtgccagcaggtcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctgcaagatcccagagtcagggg
cctgtatcttcctgctggtggctccagttcaggaacactcaaccctgttcccaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgtgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gccacccgtgtgtcntggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctagcaa
aacaaagagatggggttattcactaaatttcatggggtatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaattaagcattgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttataaggcctttctaagtaaacaatatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtgctgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgcggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB116094_P_P-A Feature FT:CDS AB116094_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH4). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactgaaattaattatgcctgctagattttatcctaacagcactaaatacttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttnatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttgga
catcaacacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttgggggggagccctcaggctcagggcatat
tggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcgccaagctctgcaagatcccagagtcagggg
cctgtatcttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcagggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggaacctgcagaacctg
cacgactcctgctcaaggcaactctacgtttccctcatgttgctgtacaaaacctacgggtggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgcttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctgaatttcatggggtatgtaattggaagttggggttcattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaataggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggttaccctgccttaatgcctttgtatgcatgtattcaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctgagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagctaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB126580_P_P-A Feature FT:CDS AB126580_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-RU204). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacagggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggagggtggt
catcaaaacctcgcaaaggcatggggacgaatctttctggttccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacaggcatcctcaggccaagcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaagacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgaatccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacatatagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaagcactgttttaggaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacagtgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttacnccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB194950_P_P-A Feature FT:CDS AB194950_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMR983). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtggggaattttactgggctttattctcatactgtacctatctttaatcctgaatggcaaactccttct
tttccaaagattcatttgcaggaggacattattgatagatgtcaacaatttgtaggccctctcactgtaaatgaaaaaag
aagattaaaattaattatgcctgctagattctatcctaacagcaccaaatatttgccactagacaaagggattaaacctt
attatcctgagcatgtagttaatcattacttccaggccagacattatttacatactctttggaaggcgggtattctatat
aagagggaaactacacgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
taccaaaacctcgcaaaggcatggggacaaatctgtctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatcccgattgggacttcaaccccatcaaggaccactggccacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcaaggcacat
tgactacagtgccagcagtacctcctcctgcctccgccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccataaagtggaattccccagctttccaccaagctctgcaagatcccagagtcaaggg
cctgtattttcctgctggtggctccagttcaggaacagtaagccctgttccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggactatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacttgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
actgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaccaa
aacaaaaagatggggttattccctaaacttcatgggctacataattggatgttggggagcattgccacaggatcatattg
tgcaaaaaatcaaagattgttttcgaaaacttcctgttaacagacctattgattggaaagtatgtcaacgcattgtgggt
cttttgggctttgcagctccattcacacaatgtggataccctgctttaatgcctttgtacgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctatgccaagtgtttgctgacgcaacccccactggctggggcttggccatgggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgcttgggactctat
cgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB194951_P_P-A Feature FT:CDS AB194951_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMR82). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgttcctatctttaatcaggaatggcaaactccttct
tttcctaagattcatctacatgaggacattattaatagatgtcaacaatttgtgggccctctcaatgtaaatgaaaaaag
aagattgaagttaattatgcctgctagattttatcctaatagtaccaaatatttgcccctagacaaagggattaaacctt
attaccctgatcatgtagttaatcattactttcaggcaagacattatttacatactctttggaaggctggtattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
taccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaacccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacatggaggcgttctggggtggagccctcaggctcagggcacat
tgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaagaagacagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacaaatttccaccaagctctgcaagatcccagagtcagggg
cctgtatcttcctgctggtggctccagttcaggaacagtcaaccctgctccgaatattgcctctcacatctcgtcaatct
cctcgaggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttctcgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
agcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggggtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccattgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttggctttgggcatacatttaaaccctaacaa
aacaaaaagatggggttattcccttaacttcatgggatacataattggaagttggggatcattgccacaggatcatattg
tacaaaaacttaaacactgttttagaaaacttcctgttaacagacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggataccctgctttaatgcctttgtatgcatgtatacaagctagaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgctcggcaacggc
ctggtctatgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaactcat
tgggactgataattctgtcgtcctttctcggaaatatacatcttttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccggttgggactctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB194952_P_P-A Feature FT:CDS AB194952_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMR711). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtacctatctttaatcaggaatggcaaactccttct
tttcctaagattcatttacatgaggacattattaatagatgtcaacaatttgtaggccctctcaatgtaaatgaaaaaag
aagattgaaattaattatgcctgctagattttatcctaacagtaccaaatatttgcccctagacaaagggattaaacctt
attatcctggtcatgtagttaatcattactttcaggcaagacattatttacatactctttggaaggctggcattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggtcggt
taccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaacccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggagttctggggtggagccctcaggctcagggcacat
tgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacaaagttccaccaaactctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtcaaccctgctccgaatattgcctctcacatctcgtcaatct
cctcgaggattggggaccctgcgccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggga
agcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaatcctaacaa
aacaaaaagatggggttattcccttaacttcatgggatacataattggcagttggggatcattgccacaggatcatattg
tacaaaaacttaaacactgttttagaaaacttcctgttaacagacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggataccctgctttaatgcctttgtatgcatgtatacaagctagaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaacactcat
tgggactgataattctgtcgtcctttctcggaaatatacatcttttccatggctgctaggttgtactgccaactggattc
ttcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccggttgggactctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB205118_P_P-A Feature FT:CDS AB205118_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TJ1-1-2). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaacaactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccggatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattctggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccctccaccaagctctgcaggaacccagagtcagggg
tccgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacgtctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggga
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggaccaacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
actgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
caggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggcctatct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB222707_P_P-A Feature FT:CDS AB222707_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate UZTBV102). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagagaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttccgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaacaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaataattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttctcgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggg
accacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctacttccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggcatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggatcattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB241114_P_P-A Feature FT:CDS AB241114_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PhHCC01). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttct
tttcctaaaattcatttacatgaagacattgctaatagatgtcaacaatttgtaggccctctcactgtaaatgaaaaaag
aagactgaaattaattatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggtggggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggatcactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactccccctcacggaggtgttttggggtggagccctcaggctcagggcatat
tggcaacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagaatcagggg
cctgtattttcctgctggtggctccacttcaggaacagtcaaccctgttccaactattgcctctcacatctcgtcaatct
cctcgaggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctgaatttcatgggttatgtaattggaagttggggtacattgcctcaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttggggctgtat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB241115_P_P-A Feature FT:CDS AB241115_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PhCH09). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactatccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
acgactgaaattaattatgcctgctagattttatcctaacagcactaaatatttacctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaaccttgctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcagagccaattcaaacaatccagattgggacctcaaccccgtcaaggacccctggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtcttttggggtggagccctcaggctcagggcatat
tgaccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctacttccaggatcaacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctgaatttcatggggtatgtaattggaagttggggtacattgccacaggatcatatta
tacaaaaaatcaaacactgttttagaaaacttcctgttaatcggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggctttcactttctcgccaacttacaaggcctttctaaataaacagtacatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctagggtgtactgccaactggatac
ttcgcgggacgtcctttgtttacgtcccatcagcgctgaatcccgcggacgacccctcgcgcggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB246335_P_P-A Feature FT:CDS AB246335_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttct
tttcctaaaattcatttacatgaagacattgctaatagatgtcaacaatttgtaggccctctcactgtaaatgaaaaaag
aagactgaaattaattatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggtggggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggatcactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactccccctcacggaggtgttttggggtggagccctcaggctcagggcatat
tggcaacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagaatcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaactattgcctctcacatctcgtcaatct
cctcgaggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
akcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctgaatttcatgggttatgtaattggaagttggggtacattgcctcaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcagagaattgtgggt
cttttgggcttcgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB246336_P_P-A Feature FT:CDS AB246336_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgactggcaaactccttct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactgaaactaattatgcctgctagattttatcctcacagcactaaatatttgcctctagacaaagggattaaacctt
attatcctgatcacgtagttaatcattactttcagacccgacattatttacatactctttggaaggctgggatcctatat
aagagagaaactacacgtagcgcctcattttgcgggtcaccatatttttgggaacaagagctacatcatgggaggttggt
catcaaaacctcacaaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttctggggtggagccctcaggctcagggcatat
tggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccgtgcggtggaattccacaactttccaccaaactctgcaagatcccagagtcagggg
cctgtatcttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgcgttacaggcg
gggtttttctcgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgtctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgcagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttatgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctgaatttcatggggtatgtaattggaagttggggtacattgccacaggatcatatta
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctagggtgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccctcgcgaggtcgcttggggctctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB246337_P_P-A Feature FT:CDS AB246337_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattgggagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgccccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactttct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB246338_P_P-A Feature FT:CDS AB246338_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggcctatct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB300366_P_P-A Feature FT:CDS AB300366_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient8). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatattttcccttagacaaaggaattaaacatt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggactccaaccccatcaaggaccactggccagtagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaactccactgccttccaccaagctctgcaggatcccaaagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctctgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgattcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB300367_P_P-A Feature FT:CDS AB300367_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient9). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacaacatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggcactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB362931_P_P-A Feature FT:CDS AB362931_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccgctggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcaaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
actgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacgtacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtgtctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcctttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB453979_P_P-A Feature FT:CDS AB453979_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH1). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB453980_P_P-A Feature FT:CDS AB453980_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH2). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatttacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB453981_P_P-A Feature FT:CDS AB453981_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH3). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggcctatct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB453982_P_P-A Feature FT:CDS AB453982_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH4). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggtcctcttactgtaaatgaaaagcg
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attacccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgaagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcgaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggactccaaccccatcaaggaccactggccagaggccaatcaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatttacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB453983_P_P-A Feature FT:CDS AB453983_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH5). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtgttctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcgaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtcttttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcaaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggcttttagctatatggatgatgtggtattgggggcgaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacagacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaggctaaaca
ggctttcactttctcgccaacgtacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtgtctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcctttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgtttgggactctat
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB453984_P_P-A Feature FT:CDS AB453984_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH6). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggg
agcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacaacatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aaccaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaaccttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgtcaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtcaacagtacaggaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaacgctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcatttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgattcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB453986_P_P-A Feature FT:CDS AB453986_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH8). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttcc
tttcctaaaattcatttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaag
aagactgaaattaattatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaacctt
attatcctgatcaggtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aggagagaaactacacgcagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggatttcaatcccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttccggaacactcaaccctgttccaactattgcctctcacatatcgtcaacct
cctcgaggattggggaccctgcggcgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggg
accacccgtgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaaa
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttactccctaaatttcatgggttatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtgggtaccctgccttaatgcctttgtatgcatgtatacaatcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB453987_P_P-A Feature FT:CDS AB453987_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH9). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactggactttattcttctactgtccctatctttaatcctgaatggcagactccttct
tttcctaaaattcatttacatgaagacatttctaacaggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
gagactaaaattaattatgcctgctaggttttaccctaacagcactaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctgtctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccaacagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatacagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
agcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctgaatttcatggggtatgtaattggaggttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttatcctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtacacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB453988_P_P-A Feature FT:CDS AB453988_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH10). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
acgactgaaattaattatgcctgctagattttatcctaacagcactaaatatttgcctctagataaagggattaaacctt
attatcctgatcaggtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgtgttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggg
agcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccattgtttggctttcagctatatggatgatgtggtactgggggcaaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttatctttgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctgaatttcatgggatatgtaattggaagttggggtacattgccacaggatcatatta
tacaaaaaatcaaacactgtttcagaaaacttcctgtcaatcggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcaaaaca
ggctttcactttctcgccaacttacaaggcctttctatgtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctatgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctagggtgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccctcgcggggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB453989_P_P-A Feature FT:CDS AB453989_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH11). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgataccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcataaggtgggaagttttactggactttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
acgactgaaattaattatgcctgctagattttatcctaacagcactaaatatttgcctctagataaagggattaaacctt
attatcctgatcaggtagttaatcattactttaaaacccgacattatttacatactctttggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaacccgctgggattcttccccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccctgtcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaaactctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagaggg
ggccaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtgctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaaa
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctgaatttcatggggtatgtaattggaagttggggcacattgccacaggatcatatta
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcaaaaca
ggctttcactttctcgccaacgtacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggatgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccctcgcggggccgcttgggactctat
cgtccccttctccgtctgccgttccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB480036_P_P-A Feature FT:CDS AB480036_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgcctttcaccaagctctgcaggatcccagagtcagggg
tctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggcctatct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB480038_P_P-A Feature FT:CDS AB480038_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB480039_P_P-A Feature FT:CDS AB480039_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatattttcccttagacaaaggaattaaacatt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggactccaaccccatcaaggaccactggccagtagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaactccactgccttccaccaagctctgcaggatcccaaagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctctgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgattcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB480040_P_P-A Feature FT:CDS AB480040_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtatyttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcktggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccattgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttrcatggcgaccaccgtga
>gnl|hbvcds|AB480041_P_P-A Feature FT:CDS AB480041_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcatgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB549213_P_P-A Feature FT:CDS AB549213_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagatccatttacaagaggacattattaataggtgtcaacaatttgtgggacctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcatttgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
agcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggcatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgcagctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cgggactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB697487_P_P-A Feature FT:CDS AB697487_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No1). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaatttcaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB697488_P_P-A Feature FT:CDS AB697488_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No2). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgnctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB697489_P_P-A Feature FT:CDS AB697489_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No3). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB697491_P_P-A Feature FT:CDS AB697491_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No6). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagargaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB697492_P_P-A Feature FT:CDS AB697492_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No7). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagccacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcgccagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggga
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccaccagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgttctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB697493_P_P-A Feature FT:CDS AB697493_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No8). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagcgggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggattgggcctcagtccgtttctcatggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtmtgtcaaagaattgtgggt
cttttgggctttgctgcaccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtmaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB697495_P_P-A Feature FT:CDS AB697495_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No10). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagcgggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgcaccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB697496_P_P-A Feature FT:CDS AB697496_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No11). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB697497_P_P-A Feature FT:CDS AB697497_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No14). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagcaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB697498_P_P-A Feature FT:CDS AB697498_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No15). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgcttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB697499_P_P-A Feature FT:CDS AB697499_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No16). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB697501_P_P-A Feature FT:CDS AB697501_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No19). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB697503_P_P-A Feature FT:CDS AB697503_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No22). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB697504_P_P-A Feature FT:CDS AB697504_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No23). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB697505_P_P-A Feature FT:CDS AB697505_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No25). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcayttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB697506_P_P-A Feature FT:CDS AB697506_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No28). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttccygttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaaccyttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggcctatct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB697507_P_P-A Feature FT:CDS AB697507_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No29). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatccwacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtrttctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggcctatct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB697508_P_P-A Feature FT:CDS AB697508_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No31). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB697509_P_P-A Feature FT:CDS AB697509_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No32). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaacccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB697511_P_P-A Feature FT:CDS AB697511_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No36). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgattggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcaaggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaatagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttrtcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgttaccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB697512_P_P-A Feature FT:CDS AB697512_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No37). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgtctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AB775198_P_P-A Feature FT:CDS AB775198_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB10-0707). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagcgggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgcaccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB775199_P_P-A Feature FT:CDS AB775199_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB10-0708). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagcgggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaarctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgcaccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB775200_P_P-A Feature FT:CDS AB775200_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB12-0925). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagcgggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggctattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgcaccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB775201_P_P-A Feature FT:CDS AB775201_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB12-0929). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagcgggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggctattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgcaccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB937791_P_P-A Feature FT:CDS AB937791_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB05-0890). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacatttctaataggtgtcaacaatttgtaggccctctcactgtaaatgaaaagag
acgactgaaattaattatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggcaacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctgaatttcatggggtatgtaattggaagttggggtacattgccacaggatcatatta
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctagggtgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccctcgcgaggtcgcttgggactgtat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB937792_P_P-A Feature FT:CDS AB937792_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1205). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagcgggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgcaccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB937793_P_P-A Feature FT:CDS AB937793_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-0302). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagcgggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgcaccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB937794_P_P-A Feature FT:CDS AB937794_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-0666). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagcgggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgcaccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB937795_P_P-A Feature FT:CDS AB937795_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1191). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgttagtatccctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttct
tttccaaaaattcatttacatgaagacattgctaatagatgccagcaatttgtgggccctctcactgtaaatgaaaagag
aagactgaaattaattatgcctgctaggttttatcctaacagcacaaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttccgttcccaaccctctgggattctttcccgrtcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagccttcgggccagggttcactcccccacacggcggtgttctggggtggagcccgcaggctcagggcatat
tggccacagtgccaacagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccaccgctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcagggacactcaaccctgttccaaatattgcctctcacatctcatcaatct
ccttgaagactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctamttccaggatccacaacaaccagcacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatrtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatwcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctgaatttcatggggtatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaaaactgttttagaaaacttcctgtcaatcgacctattgattggaaagtctgtcagagaattgtaggt
cttttgggctttgccgctccatttacacaatgtggttaccctgctttaatgcctttgtatgcatgtatacaagcaaaaca
ggcttctactttctcgccaacttacaaggcctttctaagtaaacagtatatggacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtccttcctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaaaccaccgtga
>gnl|hbvcds|AB937796_P_P-A Feature FT:CDS AB937796_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1196). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacatttctaataggtgtcaacaatttgtaggccctctcactgtaaatgaaaagag
acgactgaaattaattatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggcaacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctgaatttcatggggtatgtaattggaagttggggtacattgccacaggatcatatta
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctagggtgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccctcgcgaggtcgcttgggactgtat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB937797_P_P-A Feature FT:CDS AB937797_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1204). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttrttagacgamgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaayctcaatgttagtattcctt
ggactcacaaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgmatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggcccyctcackgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggamggctggtattctatat
aagagggmaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcmaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccytcaggctcaggrcataw
cgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagccyactcccatctctccacct
mtaagagamagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcagggg
tctgtatcttcctgctggtggctccagttcagamacagtaaaccctgctccgaatattgcctctcacatctcgtcamtct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcagggttcctaggaccccggctcgtgttacaggcg
gggttttycttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggga
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctcyaatttgtcytg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgccgctatgcctcatcttcttattggttctt
ctggattatcaaggtatattgcccgtttgtcctctaattccaggatcaacakcaaacartacgggasgrtgcaaaayctg
cacgaytcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatattgtattgggggccaaa
tctgtacagcatcgtgagtccctttatactgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacccaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccataccgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgttctctcgcggaaatatacttcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccatcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB937798_P_P-A Feature FT:CDS AB937798_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB14-0383). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcgaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgtttcagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AF043560_P_P-A Feature FT:CDS AF043560_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA2). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcttaaggtgggaaactttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacattgctaataggtgtcagcaatttgtaggccctcttactgtaaatgaaaagag
aagactgaaattaattatgcctgctaggttttatcctaacagtactaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatggggtatgtaattggaagttgggrtacattgccacaggatcrtattg
tacaaaaaatcaaacactgttttagaaaacttcctatcaatcgacctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatktacacaatgtggttaccctgcattaatrcctttgtatgcatgtatacaagcaaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactcat
cgggactgacaattctgtcgtcctttctcggaaatatacatcgtttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AF043580_P_P-A Feature FT:CDS AF043580_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA3). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaaccctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctaactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacataaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgttcccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacncggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AF090838_P_P-A Feature FT:CDS AF090838_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattcctt
ggactcataaggtgggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaaaattcatttacaagaggacattattaataggtgtgaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaagttaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagagaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgt
tgaccccagtgtcaacaattcctcctcctgcctccgccaatcggcagtcaggaaggcagcccactcccatctctccacct
ctaagagacagtcatcctcaggcgatgcagtggaattccactgccttccaccaagctctgcaagaccccaaagtcagggg
tctgtattttcctgctggtggctccagttcagaaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
actgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttatgtaattggaagttgggggacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccttttacacaatgtggatatcctgccttaatgcccttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AF090839_P_P-A Feature FT:CDS AF090839_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacatgaggacattattaataggtgtcaacaatttgtggggcctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagaccaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttcggttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggcccgcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagccctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggccttcctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
cgggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AF090840_P_P-A Feature FT:CDS AF090840_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtggggcctctcactgtaaatgaaaaggg
aagattgagattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagaccaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttcggttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctttccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggccttcctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AF090841_P_P-A Feature FT:CDS AF090841_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaaaattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgttaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagagaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cccgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccggggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgt
tgaccccagtgtcaacaattcctcctcctgcctccgccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaagccatgcagtggaattccactgccttccaccaagttctgcaagaccccagagtcagggg
tctgtattttcctgctggtggcttcagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttatgtaattggaagttgggggacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccttttacacaatgtggatatcctgccttaatgcccttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtatttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaactcat
cggaactgacaattctgttgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AF090842_P_P-A Feature FT:CDS AF090842_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttactcttctactgtccctatctttaatcctgaatggcaaaccccttct
tttcctaaaattcatttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaag
aagactgaaattaattatgcctgctaggttttatcccaacagcacaaaatatttgcctttagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaactattgcctctcacatctcgtcaatct
cctcgaggattggggaccctgtgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacagcatcttgagtccctttataccggtgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattcactgaatttcatgggttatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttatcctgcattaatgcctttgtatgcatgtatacaagcaaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgcggaacc
tttgtggctcctctgccgatccatactgcggaactcctggccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgagggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AF143298_P_P-A Feature FT:CDS AF143298_P_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBx, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacaattccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttacgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtgaagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgactattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgggttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgttgccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacagacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cgggactgacaattctgtcgtcctctcgcgcaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AF143302_P_P-A Feature FT:CDS AF143302_P_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacctccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatttcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctgtctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacgctaaatattttcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttctcaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaatcaggt
aggagtgggagcattcgggccagggctcacccctccacatggcggtattttggggtgaagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgcccgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcga
ggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacc
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggat
tatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccgtgcaaaacctgcacgac
tcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcc
catcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgta
cagcatcgtgaggccctttataccgctgtgaccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaa
aagatggggttattccctaaacttcatgggttacgtaattggaagttggggaacattgccacaggatcatattgtacaaa
agatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgccaaagaattgtgggtcttttg
ggctttgctgctccatttacacaatgtggatatcctgccttaatgcccttgtatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcctttcttagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggaac
tgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatccttcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccc
cttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AF297621_P_P-A Feature FT:CDS AF297621_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 78). Complete genome. [Hepadnaviridae] (length=2517 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtccctaattttaatcctgaatggcaaactccttcc
tttcctaaaattcatttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaag
aagattaaaattaattatgcctgctagattttatcctaacagcactaaatatttgcccttagacaaagggattaaacctt
attatcctgatcaagtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcattcgcaaaggca
tggggacgaatctttctgttcccaaccctctgggattccttcccgatcatcagctggaccctgcattcggagccaattca
aacaatccagattgggacttcaaccccatcaaggaccactggccacaagcccatcaggtaggagtgggagcattcgggcc
agggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacattgccagcagttc
ctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctcag
gccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtaaggggcctgtattttcctgctggtgg
ctccagttcaggaacactcaaccctgttccaaatattgcctctctcatctcgtcaatctcctcgacgactggggaccctg
tgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaga
atcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggcca
aaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgc
ggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttg
cccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaa
ctctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctt
tcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagttccatttgttcagtggttcgta
gggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcc
ctttataccactgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattc
cctaaactttatgggctatgtaattggaagttggggtacgttgcctcaggatcatattgtacagaaaatcaaaagctgtt
ttagaaaacttcctgtcaatagacctatcgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctcca
tttactcaatgtggttaccctgccttaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaac
ctacaaggcctttctcagtaaacagtatatgaacctttaccccgttgcccggcaacgccctggtctgtgccaagtgtttg
ctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatc
catactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaacttatcggaactgacaattctgtcgt
cctctcgcggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgttt
acgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccg
ttccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcactt
cgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AF297622_P_P-A Feature FT:CDS AF297622_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 79). Complete genome. [Hepadnaviridae] (length=2517 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaaccctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctaacagtaaatgaaaagag
aagattaaaattaattatgcctgctagattttatcctaacagcactaaatatttgcctttagacaaagggattaaacctt
attatcctgatcaagtagttaatcattacttccagaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctaaaaccttcgcaaaggca
tggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagccaactca
acaaatccagattgggacttcaaccccatcaaggaccactggccagccgccaaccaggtaggagtgggagcattcgggcc
agggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtcaacaattc
ctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctcag
gccatgcagtggaattccactgccttgcaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtgg
ctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctg
tgacgaacatagagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaga
atcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggcca
aaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgc
ggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttg
cccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaa
ctctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctt
tcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttagta
gggatttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcc
ctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaagagatggggttattc
cctaaacttcatgggttacgtaattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgtt
ttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctcca
tttacacaatgtggttaccctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaac
ttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttg
ctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatc
catactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgt
cctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgttt
acgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccg
ttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcactt
cgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AF297624_P_P-A Feature FT:CDS AF297624_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 80). Complete genome. [Hepadnaviridae] (length=2517 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaaccctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctaactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaactacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcattcgcaaaggca
tggggacgaatctttctgttcccaaccctctgggattccttcccgatcatcagttggaccctgcattcggagccaactca
aacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcattcgggcc
agggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtcaacaattc
ctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctcag
gccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtgg
ctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctg
tgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaga
atcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggcca
aaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgc
ggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttg
cccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaa
ctctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctt
tcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgta
gggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtcc
ctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactc
cctaaacttcatgggctatataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgtt
ttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctcca
tttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaac
ttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttg
ctgacgcaacccccactggctggggcttagccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatc
catactgcggaactcctggccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgt
cctctcgcggaaatatacatcatttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgttt
acgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctgtcgtccccttctccgtctgccg
taccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcactt
cgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AF297625_P_P-A Feature FT:CDS AF297625_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 84). Complete genome. [Hepadnaviridae] (length=2517 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttactcctctactgtccctatctttaatcctgaatggcaaactccttcc
tttcctaaaatccatttacatgaggacattattaataggtgtcagcaatttgtaggccctctaactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctaacagcaccaaatatttgcctctagacaaagggattaaacctt
attatcctgatcaagtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcattcgcaaaggca
tggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagccaattca
acaaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcattcggccc
agggcactcccctccacacggaggtgttttggggtggagccctcaggctcagggcatattgactacagtgccaacagttc
ctcccactgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctcag
gccatgcagtggaattccacagctttgcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtgg
ctccagttcaggaacactcaaccctgttcccaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctg
cgttgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaga
atcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggcca
aaattcgcagtacccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgc
ggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttg
cccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaa
ctctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctt
tcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgta
gggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcgtgagtcc
ctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactc
cctaaacttcatgggatatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgtt
ttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctcca
tttacacagtgtggttaccctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaac
ttacaaggcctttctaaatcaacagtatctgaacctttaccccgttgcccggcaacggtctggtctgtgccaagtgtttg
ctgacgcaacccccactggctggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatc
catactgcggaactcctagctgcttgttttgctcgcagcaggtctggagcaaaactcatcggaactgacaattctgtcgt
cctttctcgaaaatatacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgttt
acgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttggggctctatcgtccccttctccgtctgccg
taccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcactt
cgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AF536524_P_P-A Feature FT:CDS AF536524_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacccatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccctccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgggttacaggcg
gggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaagacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtattcatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttaggaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AF537371_P_P-A Feature FT:CDS AF537371_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgttagtattccct
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgccggctagattctatcctacccacactaagtatttgcccttagataaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatacagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacggaaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcaccgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacgaaaagatggggttattccctaaacttcatgggttatataattggaagttggggaacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtcaacagtacaggaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AF537372_P_P-A Feature FT:CDS AF537372_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagatgtcggggccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcttctacagtacctatcttcaatccggaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacaccaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaacccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaaatcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagggacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgagaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggg
agcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaatgccaggatcaacgacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctacgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgcagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcttgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aactaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacagacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctttcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AJ012207_P_P-A Feature FT:CDS AJ012207_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctacaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcaagggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AJ309369_P_P-A Feature FT:CDS AJ309369_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient X104). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggcgggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
gggagtgggggcattcgggccagggctcacccctccacacggcggtatcttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctccgagacagtcatcctcaggccacgcagtggaattccactgccttccaccaagcactgcaggatcccagagtcagggg
tccgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctaggctcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccggtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
actgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AJ309370_P_P-A Feature FT:CDS AJ309370_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient X104). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaacc
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggcgggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
gggagtgggagcattcgggccagggctcacccctccacacggcggtattttgggttggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctacgaaacagtcatcctcaggccatgcagtggaattccactgccttccaccaagcactgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggga
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgttggatgtgtctgcggcgttttaccatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
actgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggggcaaagctcat
cggcactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AJ309371_P_P-A Feature FT:CDS AJ309371_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient X104). Non-functional genomic sequence. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggcgggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcgaagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
gggagcgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctacgagacagtcatcctcaggccacgcagtggaattccactgccttccaccaagcactgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
actgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgccgtcctctcgcggaaatatacatcgtttccatgactgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AJ344115_P_P-A Feature FT:CDS AJ344115_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBsAg negative patient X27). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcatcacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctaccaacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttcaaaaccagacattatttacatactctttggaaggctggtattttatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcacat
tgaccacagtgccaacaattcctcctcctgcatccaccaatcggcagtcaggaaggcagcccactcccatctctccacct
ctcagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaagacccctgctcgggttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctg
gttatcgctggatgtgtctgcggcattttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctcaaactacaagatcaacaacaaccagtacgggatcatgcaaaacctg
cacgattcctgctcgcggcaaatctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcttgggctttcgcaagctacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccctttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctagcaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtaggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcttgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaccctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggatcc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cggcactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgttctgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AJ627226_P_P-A Feature FT:CDS AJ627226_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 20952). Non-functional genomic sequence. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattgataggtgtcaacaatttgtgggccctcttactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttgggaggctggtattttatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagatacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcaattggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcaggga
tcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgagga
ctggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggccacccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattat
caaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcc
tgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccat
cgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcaatttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtttggcttttagctatatggatgatgtggtattgggggccaagtctgtacag
catcgtgagtccctttataccgctgtaaccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaag
atggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaagatcatattgtacaaaaga
tcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggc
tttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcctgtatacaagctaaacaggctttcac
tttctcgccaacttacaaggcctttctacgtgaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgt
gccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagcttatcggaactga
caattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatccttcgcggga
cgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccctt
ctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggt
ccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AJ627227_P_P-A Feature FT:CDS AJ627227_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 21077). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttrttagacgamgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaatagrtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatctacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcctcattctgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctgtckgtycccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaacccagattgggacttcaatcccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggcattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagccatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccaaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcataataccgcagagtctagactcgtggtggacttctctcagttttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattaycaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggwccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagytatatggatgatgtggtmttggggaccaga
tctgtacagcatcgtgaggccctttwtaccgctgttaccaattttcttttgtctctgggtatacatataaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtctgtcaaagaattgtgggt
cttttgggctttgctgcyccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctgagtcaacagtacakgaacctttaccccgttgctcggcaacggc
caggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggractgacaattctgtcgtcctttcgcggaaatatacatcatttccatggctgctaggctgtgctgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcgrcgctgaatcccgcggacgacccctctcggggccgcttggggctctct
cgtccccttctccgtctgccgttccagccgtccacggggcgaacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AJ627228_P_P-A Feature FT:CDS AJ627228_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 34408). Non-functional genomic sequence. [Hepadnaviridae] (length=2526 residues).
atgcccctatcttatcaattcttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaaccctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctaactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccagaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctaccgcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatcccgattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccgtgcagtggaattccactgccrcccaccaagctctgcaggatcccaaagtcgatcc
tgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactg
gggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttg
ttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtg
tcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctgga
tgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaa
ggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgc
tcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgt
cctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcag
tggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcat
cgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatg
gggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatca
aacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggcttt
gctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcacttt
ctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgcc
aagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcct
ctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaa
ttctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgt
cctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctc
cgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccg
tgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AM180624_P_P-A Feature FT:CDS AM180624_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CAE168). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggamtctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtacctatctttaatcctgaatggcaaactccttct
tttccaaagattcatttacatgaggacattattaatagatgtcaacaatttgtaggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgcgagattttatcctaacagtaccaaatatttgccattagacaaagggattaaacctt
attatcctgatcatgtagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatat
aagagggaaactacacgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
taccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaycctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggt
aggagtgggagcatttggaccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcacat
tgactatggtgccagcggttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaagccctgttccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaaaacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattgtcarggtatgttgcycgtttgtcctctaattccaggatccamaaccaccagtacgggaccctgcagaacctg
cacgactcctgcacaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacttgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggcatacatttaaaccctaacaa
aacaaaaagatggggttattctctaaatttcatgggttacataattggaagttggggatcattgccacaagaycatattg
ttcaaaaamtcaaagactgttttagaaaacttcctgttaacagacctattgattggaaagtttgtcaacgcattgtgggt
cttttgggctttgccgctccgttcacacaatgtggataccctgctttaatgcctttgtacgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatgggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcttttccatggctgctaggctgtactgccaactggatac
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggrmtctac
cgtccccttctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AM184125_P_P-A Feature FT:CDS AM184125_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate O64). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcacaaggtggggaattttactgggctttattcttccactgtacctatctttaatcctgaatggcaaactccttcc
tttcccaggattcatttacatgaggacattattaataaatgtcaacaatttgtaggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctaccccaacagcaccaaatatttgccactagacaaagggattaaacctt
attatcctgatcatgtggttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatat
aagagggaaactacacgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
taccaaaacctcgcaaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatat
tgactaccttgccagcagttcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaagaacagtaagccctgttcagaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgcacaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacttgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggctacataattggatgttggggatcattgccacaagatcatattg
ttcagaaaatcaaagattgttttcgaaaactccctgttaacagacctattgattggaaagtatgtcaacgcattgtgggt
cttttgggctttgccgcttcattcacacaatgtggttaccctgctttaatgcctctgtacgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctatgccaagtgtttgctgacgcaacccccactggctggggcttggccatgggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcaaccggtctggagcaaaactcat
cgggacggataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggctgtactgccaactggattc
ttcgcgggacatcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AM184126_P_P-A Feature FT:CDS AM184126_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N35). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtggggaattttactgggctttattcttctactgttcctatctttaatcctgaatggcaaactccttct
tttcccaagattcatttacatgaggacattattaatagatgtcaacaatttgtaggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctaacagcaccaaatatttgccacttgacaaagggattaaacctt
attatcctgatcaggtagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatat
aagagagaaactacacgtagtgcttcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
taccaaaacctcgcaaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggatcactggccacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatat
tgactaccgtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatccgcaggccatgcagtggaattccacagctttccaccaagctctacaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaagccctgttccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgcacaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacttgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctatacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttgaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggctacatcattggatgttggggatcattgccacaagatcatattg
ttcacaaaatcaaagattgttttcgaaaacttcctgttaatagacctattgattggaaagtatgtcaacgcattgtgggt
cttttgggctttgccgctccattcacacaatgtggataccctgctttaatgcctctgtacgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctatgccaagtgtttgctgacgcaacccccactggctggggcttggccatgggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctggccgcttgttttgctcgcagccggtctggagcgaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcttttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcacgcggacgacccctctcggggtcgcttgggactctat
cgtccccttctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AM282986_P_P-A Feature FT:CDS AM282986_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttcaaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcgaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaatatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggaacaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccttcggatggaaattgcacctgtattc
ccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacgttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcctgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggggcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggttgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AM295795_P_P-A Feature FT:CDS AM295795_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattatcaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attacccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggccggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctgtctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctgagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AM295797_P_P-A Feature FT:CDS AM295797_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattatcaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attacccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggccggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctgtctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctgagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AM410963_P_P-A Feature FT:CDS AM410963_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattatcaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attacccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggccggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctgtctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctgagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AM494718_P_P-A Feature FT:CDS AM494718_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CAR204). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttaccgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcc
tttcctaaaatccatttacacgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaacgaaaagag
aagattaaaattaattatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaacctt
attatcctgatcaagtagttaatcattatttccagacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
taccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggctacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
ctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttctt
ctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaggacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggrgtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtaattggaagttgggggacattgccacaagatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttttcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccctcgcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY034878_P_P-A Feature FT:CDS AY034878_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBVKL). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaagctactgttgttagacaacgggaccgacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggacccataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattatcaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttcaaaaccagacattatttgcatactctttggaaggctggtattctatat
aagaggaaaaccacacgtagcgcatcaatttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccgtgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctcaaatttgtcctg
ggtatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatattgatgatgtggtattgggggccaag
tctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcaccttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctgttctgtgccaagtgtttgctgacgcaacccccactggctggggcttgcccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggcactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcagacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctttgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY128092_P_P-A Feature FT:CDS AY128092_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggctacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY152726_P_P-A Feature FT:CDS AY152726_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 8.22). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcttctacagtacctgtctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcaattggac
cctgcattcggagccaactcgaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccggggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctcagaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctagaacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaatgccaggatcaacaacaacaagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctacgttgccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
actgtacagcatcgtgaggccctttataccgctgttactaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacgtaattggcagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcctgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtcaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY161138_P_P-A Feature FT:CDS AY161138_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2541 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttct
tttcctaaaattcatttacatgaagatattactaataggtgtcaacaatttgtaggccctctcactgtaaatgaaaagag
aagactaaaattaattatgcctgctaggttttaccctaacagcacaaaatatttgcctctagacaaagggattaaacctt
attatcctgatcaggtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttgga
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcatttgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagtgcctccttctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctacaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
accacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctggtgctatgcctcatcttcttattggtt
cttctggattatcaaggtatgttgctcgtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaac
ctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgta
ttcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttacta
gtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatctggtactgggggcc
aagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaa
caaaacaaagagatggggttattccctgaatttcatgggatatgtaattggaagttggggtacattgccacaggatcata
ttgtacaaaaaatcaaaaattgttttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcagagaattgtg
ggtcttttgggctttgccgctccatttacacaatgtggttatcctgcattaatgcctttatatgcatgcatacaagcgaa
acaggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaac
ggcctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtgga
acctttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaact
catcgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactgga
ttcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgcttgggactg
tatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttc
tcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY161139_P_P-A Feature FT:CDS AY161139_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttct
tttcctaaaattcatttacatgaagatattactaataggtgtcaacaatttgtaggccctctcactgtaaatgaaaagag
aagactaaaattaattatgcctgctaggttttaccctaacagcacaaaatatttgcctctagacaaagggattaaacctt
attatcctgatcaggtagttaatcattactttcaagcccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttgga
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcatttgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagtgcctccttctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctacaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
accacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatctggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctgaatttcatggggtatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaaaattgttttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttatcctgcattaatgcctttatatgcatgcatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgcggccgcttgggactgtat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY233274_P_P-A Feature FT:CDS AY233274_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 0962). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcaggagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttactcctctactgtccctgtctttaatcctgaatggcaaactccttcc
tttcctaaaatccatttacatgaggacattattaataggtgtcaacaatttgtaggccctctcactgtaaatgaaaaaag
aagattgaaattaattatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaaggaattaaacctt
attatcctgatcaagtagttaatcattactttcagacccgacattatttacatactctttggaaggctgggattctatat
aagaaggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
cagccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccaacagtacctcccactgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatactgcctctcacatctcgccaatct
cctcgaggactggggaccctgcgtggaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatttcctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatggggtatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgccttaatgcctttgtatgcatgtatacaagcaaaaca
ggcttttactttctcgccaacttacaaggcctttctaaatcaacagtatatgaacctttaccccgttgcccggcaacggt
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctataggccatcagcgcatgcgcggaacc
tttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagcaggtctggagcaaaactcat
cggaactgacaattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttggggctctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY233275_P_P-A Feature FT:CDS AY233275_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 163). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgcccctatctttaatcctgaatggcaaactccttcc
tttcctaaaatccatttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagattgaagttaattatgcctgctagattttatcctaacagcacgaaatatttgcctctagacaaagggattaaacctt
attatcctgatcaagtagttaatcattacttccaaaccagacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
cctcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagactggaacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcttacggcccagggctcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tgactacagcgccagtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtatcttcctgctggtggctccagttcaggaacacacaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaagactggggaccctgcgttgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
ctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattaccaaggtatgttgcccgtttgtcctctaattccaggatctacaacaacgagtacgggaccttgcaagacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccctttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatgggatatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgtttcagaaaacttcctgtcaatcgccctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgcagctccctttacacaatgtggttaccctgccttaatgcctttatatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctgagtaaacagtatatggacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcgaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacttcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY233276_P_P-A Feature FT:CDS AY233276_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1839). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgagatcgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaggacatcattgataggtgtcagcaatttgtaggccctctaactgtaaatgaaaagag
aagattaaaattaattatgcctgctagattttatcctaacagcaccaaatatttgcctctagacaaagggattaagcctt
attatcctgatcaagtagttaatcattacttccagaccagacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
cagcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccccctgggattctttcccgatcatcagttggac
cctgcattcagagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggctacagtgccaccagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcatctcacatctcgtcaatct
cctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattaccagggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaacttcatgggatatgtaattggaagttggggtacgttgccacaggatcatattg
tacaaaaaatcaaatgctgttttagaaaacttcctatcaatcgacctattgattggagagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcaaaaca
ggcttttactttctcaccaacttaccaggcctttctaagtaaacaatatatgaacctttaccccgttgcccggcaacggc
ttggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcagaactcctagctgcttgttttgctcgcagcaggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaaaccaccgtga
>gnl|hbvcds|AY233278_P_P-A Feature FT:CDS AY233278_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacatttctaacaggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaag
aagactgaaattaattatgcctgctagattttatcctaacagcaccaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttcaaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
agcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctgaatttcatggggtatctaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttaaaaaacttcctgtcaatcggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggctttcactttctcgctaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggcaatcggccatcagcgcatgcgtggagac
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgacaattctgtcgtcctttctcggaaatatacaccatttccatggctgctaggttgtactgccaactggattc
ttcgagggacgtccttcgtctacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggtcgcttgggactctat
cgtcccctactccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttcaca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY233279_P_P-A Feature FT:CDS AY233279_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 28). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgagatcgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaggacattattaataggtgtcagcaatttgtaggccctctaactgtaaatgagaagag
aagattaaaattaattatgcctgctagattttatcctaacagcaccaaatatctgcctttagacaaagggattaagcctt
attatcctgatcaagtagttaatcattactttcagaccagacattatttacatactctttggaaggctggaattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggc
cagcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcgtat
tggctacagtgccaccagttcttcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcatctcacatctcgtcaatct
cctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctagggcccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattaccaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaacttcatgggatatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaatgctgttttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcaaagaattgtgagt
cttttgggctttgctgctccatttacacaatgtggttaccctgccttaatgcctttgtatgcatgtatacaagcaaaaca
ggcttttattttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtccttgctcggaaatatacatcatttccatggctgctaggttgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctat
cgtccccttctccgtctgccgttccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY233280_P_P-A Feature FT:CDS AY233280_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 2). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccaccgtgccagcgatgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgcgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctctgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggtcgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY233281_P_P-A Feature FT:CDS AY233281_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 303). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcc
tttcctaaaatccatttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagattgaagttaattatgcctgctagattttatcttaacagcattaaatatttgcctctagacaaagggattaaacctt
attatccagatcaagtagttaatcattacttccaaaccagacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
cctcaaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagaccgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcttacggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tgactacagcgccagtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
tctgtatcttcctgctggtggctccagttcaggaacacacaaccctgttccaaatattgcctctcacatctcgccaatct
cctcgaagactggggaccctgcgttgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
ctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattaccaaggtatgttgcccgtttgtcctctaattccaggatctacaacaacgagtacgggaccttgcaagacctg
cacgactcctgctcaaaacaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccctttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatgggatatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgtttcagaaaacttcctgtcaatcgccctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgcagctccctttacacaatgtggttaccctgccttaatgcctttatatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctgagtaaacagtatatggacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcgaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacttcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY233282_P_P-A Feature FT:CDS AY233282_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 306). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttactcttctactgtccctgtgtttaatcctgaatggcaaactccttcc
tttcctaaaatccatttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaccctt
attatcctgatcaagtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
cagccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagactgggacttaaaccccatcaaggaccactggccagaagccaaccaggt
aggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagtcctcaggctcagggcatat
tggctacagtgccagcagttcctcccactgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaatactcaaccctgttccaaatactgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgttgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
ctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttgtcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattaccaaggtatattgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtaattggaagttggggtacattgccacaggatcatatta
tacaaaaaatcaaacactgttttaggaaacttcccgtcaatcgacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcaaaaca
ggcttttactttctcgccaacttacaaggcccttctaaatcaacagtatatgaacctttaccccgttgcccggcaacggt
ctggtctgtgccaagtgtttgctgacgcaactcccactggctggggcttggctataggccatcagcgcatgcgtggaacc
cttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcat
cggaactgacaattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY233283_P_P-A Feature FT:CDS AY233283_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4038). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggccccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttactcttctactgtccctgtctttaatcctgaatggcaaactccttcc
tttcctaaaatccatttacatgaggacattatcaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaacctt
attatcctgatcaagaagttaatcattacttccaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaagctacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacatcatgggaggttggt
cagccaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggctacagtgccagcagttcctcccactgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatactgcctctcacatctcgtcaatct
cctcgaggattggggaccctgcgttgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
ctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctgaacttcatgggatatgtaattggaagttggggctcattgccacaggatcatatta
tacaaaaaatcaaacactgttttaggaaacttcctgtcaatcgacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgccttaatgcctttgtatgcatgtatacaagcaaaaca
ggcttttactttctcgccaacttacaaggcctttctaaatcaacaatatatgaacctttaccccgttgcccggcaacggt
ctggtctgtgccaagtgtttgctgacgcaactcccactggctggggcttggccataggccatcagcgcatgcgcggaacc
cttgtggctcatcagccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcat
cggaactgacaattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY233284_P_P-A Feature FT:CDS AY233284_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 5283). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcc
tttcctaaaatccatttacatgaggacattattaataggtgtcagcaatttgtaggccctctcaccgtaaatgaaaagag
aagattgaagttaattatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaacctt
attatcctgatcaagtagttaatcattacttccaaaccagacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggcctcaagccaaccaggt
aggagtgggagctttcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggctacagcgccagtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacacacaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaagactggggaccctgcgttgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
cacacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattaccaaggtatgttgcccgtttgtcctctaattccaggatctacaacaacgagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaacttcatggggtatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgccttaatgcctttgtatgcatgtatacaagcaaaaca
ggcttttactttctcgccaacttacaaggcctttctaaatcaacagtatatgaacctttaccccgttgcccggcaacggt
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctataggccatcagcgcatgcgcggaacc
tttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagcaggtctggagcaaaactcat
cggaactgacaattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttggggctctct
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY233285_P_P-A Feature FT:CDS AY233285_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 795). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttactcttctactgtccctgtgtttaatcctgaatggcaaactccttcc
tttcctaaaatccatttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaacctt
attatcctgatcaagtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
cagccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagtcctcaggctcagggcatat
tggctacagtgccagcagttcctcccactgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaatcccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaccactcaaccctgttccaaatactgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgttgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
ctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccccgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtaattggaagttggggtacattgccacaggatcatatta
tacaaaaaatcaaacactgttttaggaaacttcctgtcaatcgacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgccttaatgcctttgtatgcatgtatacaagcaaaaca
ggcttttactttctcgccaacttacaaggcctttctaaatcaacagtatatgaacctttaccccgttgcccggcaacggt
ctggtctgtgccaagtgtttgctgacgcaactcccactggctggggcttggctataggccatcagcgcatgcgcggaacc
tttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcat
cggaactgacaattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaaaccaccgtga
>gnl|hbvcds|AY233286_P_P-A Feature FT:CDS AY233286_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 818). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccgt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaaaattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgttaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaagacccctgctcgggttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttctt
ctggattatcaaggtatgttgcccgtttgtcctctacttccaggatcaacaacaaccagtacggggccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaacacctacggatggaaattgcacctgtattc
ccatcccatcgtcctggactttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccgctgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcacacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccaatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgccccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtcagtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY233287_P_P-A Feature FT:CDS AY233287_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 8225). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgagatcgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggggggaaactttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaggacattattaataggtgtcagcaatttgtaggccctttaactgtaaatgaaaagag
aagattaaaattaattatgcctgctagattttatccaaacagcaccaaatatttgcctctagacaaagggattaagcctt
attatcctgatcaagtagttaatcattacttccagaccagacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
caacaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggctacagtgccaacagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcatctcacatctcgtcaatct
cctcgaggattggggaccctgcgctgaacatggagaacattacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcccgtcctccaatttgtcctg
gttatcgcgggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattaccaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggtctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgcttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaacttcatgggatatgtaattggaagttggggtacgttgccacaggatcatattg
tacaaaaaatcaaatgctgttttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgccttaatgcctttgtatgcatgtatacaagcaaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtcaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgagtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagcaggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY233288_P_P-A Feature FT:CDS AY233288_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 823). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatccctt
ggactcataaggtgggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcc
tttcccaaaattcatttacacgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctaacagcaccaaatatttgcctctagacaaagggattaaacctt
attatcctgatcaagtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
taccaaaacctcgcaaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggctacagtgccagcagtgcctcctcctgcctccgccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctttcacatctcgtcaatct
cctcgaggattggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
ctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaggacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtaattggaagttggggtacattgccacaggatcatattg
tacagaaaatcaaacactgtttcagaaaacttcctgtcaatcgacctgctgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgccttaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctgagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctataggccatcagcgcatgcgtggaacc
tttatggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggcctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccatcgtga
>gnl|hbvcds|AY233289_P_P-A Feature FT:CDS AY233289_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 833). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttactcttctactgtccctgtgtttaatcctgaatggcgaactccttcc
tttcctaaaatccatttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaacctt
attatcctgatcaagtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
cagccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagtcctcaggctcagggcatat
tggctacagtgccagcagttcctcccactgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaatactcaaccctgttccaaatactgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgttgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
ctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctactgctatgcctcatcttcttattggttctt
ctggattaccagggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctgaacttcatgggatatgtaattggaagttggggtacattgccacaggatcatatta
tacaaaaaatcaaacactgttttaggaaacttcctgtcaatcgacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgccttaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctgagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctataggccatcagcgcatgcgtggaacc
tttatggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcat
cggaactgacaattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgttccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaaaccaccgtga
>gnl|hbvcds|AY233290_P_P-A Feature FT:CDS AY233290_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 85). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtacctaagtttaatcctgaatggcaaactccttcc
tttcctaacattcatttacatgaggatattattaataggtgtcagcaatttgtaggccctctcactaaaaatgaaaaaag
aagattaaaattgattatgcccgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaacctt
attatccagatcaaatagttaatcattacttccagaccagacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagatacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttccaaaccctctgggattccttcccgatcatcaactggac
cctgcattcggagccaattcaaacaatcccgattgggacttcaaccccatcaaggaccactggccacaagccaatcaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacattgccaacagttcctcctcctgcctcgaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggctatgcagtggaattccaccgctttccaccaagctctgcaagatcccagagtcagggg
cctgtatttccctgctggtggctccagttcaggaatactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgacgactggggaccctgtgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaaaaatcctcacaataccgcagagtctagacttgtggtggacttctctcaattttccaggggg
cccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggtactt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccaccatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaa
tctgtacaacaccttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccagaacaa
aacaaagagatggggttattccttaaactctatgggctatgtaattggaagttggggttccctgccacaggatcatattg
tacaaaaaatcaaatgctgttttagaaaacttcctgtcaatagacctatcgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctacgtcaacagtatctgaacctttaccccgttgcccggcaacggc
ttggtctgtgccaagtgtttgctgacgcaaccccccctggctggggcttggctatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgccctttcgcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttggggatctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgaacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AY373428_P_P-A Feature FT:CDS AY373428_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagatattattaataggtgtcaacaatttgagggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctaggttttaccctatcagcacaaaatatttgcctctagacaaagggattaaacctt
attatcctgatcaggtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttgga
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
agaaatgggagcatttgggccagggttcactcccccacacggaggtgttttggggtggagccctcaagctcagggcatat
tggccacagtgccaagagtgcctcattgtgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctacaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggttttacttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctgaatttcatggggtatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaaaattgttttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttatcctgcattaatgcctttatatgcatgcatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaaggaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgcttgggactgtat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY373429_P_P-A Feature FT:CDS AY373429_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagtagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattctgctactgtccctatctttaatcctgaatggcaaacaccttct
tttcctaaaattcatttacatgaagacattattaataggtgtcaacaatttgtaggccctctcactgtaaatgaaaaaag
gagactgaaattaattatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccaatggccacaagccaaccaggt
aggagtgggagcatttgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tgaccacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccaccg
ctaagaaacagtcatcctcaggccatacagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaactactgcctctcacatctcgtcaatct
cctcgaggattggggaccctgcgccgaacatggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcaggtatatggatgatgtggtattgggggccaag
tctgtacaacaccttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaa
aacaaagagatggggttattccctgaatttcatggggtatgtaattggaagttggggtacattgccacaggatcatattg
aacaaaaaatcaaacactgttttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcagagaattgtgggt
cttttgggcttcgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY373432_P_P-A Feature FT:CDS AY373432_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactggactttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaaa
aagattgaacttaattatgcctgctaggttgtatcctatcagcacgagatatttgcctttacacaaagggattaaacctt
attatcctgatcttgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattctggccagggctcactcccccacacggaggtgttttggggtggagccctcacgctcagggcatat
tggccacagcgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcagaatcccaaagacagggg
tctgtatcttcctgctggtggctccagttcaggaacactcaaccctgttccaactattgcctctcacatatcgtcaatct
cctcgaggattggggaccctgcgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggcatacatttaaaccctaacaa
aacaaagagatggggttactccctaaattttatgggttatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcaragaattgtgggt
cttttgggctttgccgctccatttacacaatgtgggtaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcacggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagaaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY707087_P_P-A Feature FT:CDS AY707087_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-N10). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttcaaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcgaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaatatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggaacaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccttcggatggaaattgcacctgtattc
ccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacgttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcctgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggggcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggttgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY738139_P_P-A Feature FT:CDS AY738139_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatcttcaatcctgaatggcaaactccttcc
ttccctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggctctctcactgtaaatgaaaaaag
aagattgaaattaattatgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacgggggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacattaggattcctaggacccctgctcgtgttacaggcg
gtgtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttggccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagttggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttactaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaagaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tgcaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcgtggagaccaccgtga
>gnl|hbvcds|AY738140_P_P-A Feature FT:CDS AY738140_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatcttcaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggctctctcactgtaaatgaaaaaag
aagattgaaattaattatgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacgggggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccaccg
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtcttttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacattacatcaggactcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggg
aacacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattctcaaagtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagttggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttactaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tgcaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtgggtatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccatcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcgtggagaccaccgtga
>gnl|hbvcds|AY738141_P_P-A Feature FT:CDS AY738141_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatcttcaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggctctctcactgtaaatgaaaaaag
aagattgaaattaattatgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacgggggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccaccg
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtcttttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacattacatcaggactcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggg
aacacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattctcaaaatatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagttggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttactaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tgcaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccgtcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcgtggagaccaccgtga
>gnl|hbvcds|AY738142_P_P-A Feature FT:CDS AY738142_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatcttcaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggctctctcactgtaaatgaaaaaag
aagattgaaattaattatgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacgggggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccaccg
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtcttttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacattacatcaggactcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggg
aacacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattctcaaagtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagttggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggccttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttactaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tgcaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcgtggagaccaccgtga
>gnl|hbvcds|AY738143_P_P-A Feature FT:CDS AY738143_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatcttcaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggctctctcactgtaaatgaaaaaag
aagattgaaattaattatgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacgggggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctctggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacattaggattcctaggacccctgctcgtgttacaggcg
gtgtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttggccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagttggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttactaattttcttttgtctctgggtatacatttaaactctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tgcaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgtcaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggagatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcgtggagaccaccgtga
>gnl|hbvcds|AY862867_P_P-A Feature FT:CDS AY862867_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H4-zhus). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccaccaaggaccactggccagcagccaaccaggt
aggagtgggagcatttgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggttccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgcagctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cgggactgacaattctgttgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtccgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY862868_P_P-A Feature FT:CDS AY862868_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H4-zhus). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgagaagag
aagattgaaattaattatgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcatttgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgcagctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cgggactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgttgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY902775_P_P-A Feature FT:CDS AY902775_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MTB162). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaag
aagattaaaattaattatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaacaagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggaaccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaactccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacgtaattggaagttgggggacattgccacaagatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaaaggattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatggacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
aggaactgacaattctgtcgtcctttcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY903452_P_P-A Feature FT:CDS AY903452_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccctcttttcct
aaaattcatttacatgaagatattgccaataggtgtcagcaatttgtaggccctcttactgtaaatgaaaagagaagact
aaaattaattatgcctgctaggttttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatc
ctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagg
gaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaa
aacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgca
ttcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagt
gggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggcca
cagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgta
ttttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcga
ggactggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacc
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaaattgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggat
tatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgac
tcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaa
gagatggggttattccctaaatttcatggggtatgtaattggaagttggggtaccttgccacaggatcatattgtacaaa
aaatcaaacactgttttagaaaacttcctatcaatcgccctattgattggaaagtctgtcagagaattgtgggtcttttg
ggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
gctcctctgtcgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggac
tgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattcttcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtccc
cttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY934763_P_P-A Feature FT:CDS AY934763_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ik3346). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtacctatctttaatcctgaatggcaaactccttct
tttcctaagattcatttacatgaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctaacagcactaaatatttgcccctagacaaagggattaaacctt
attatcctgatcaggtagttaatcattacttccaaactcgacattatttacatactctgtggaaggctggtattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
taccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgaacatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccaaaagccaatcaggt
aggagtgggagcatttggaccagggttcacccccccacacggaggtgttctggggtggagccctcaggctcagggcatat
tgactacagtgccagcagttcctcctactgcctccaccaatcggcagtcaggaaggcaacctactcccatatctccacct
ctaagagacagtcacccccaggcagtgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaacct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggactatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacggggccttgcagaagctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcatcatgggctttcggaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaaaagatggggttataccctaaacttcatgggttacagaattggaagttggggatcattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaataggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccctttacacaatgtggataccctgccttaatgcctttatatgcatgtattcaagctaagca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcctgttttgctcgcagcaggtctggggcaaaactcat
cgggactgataattctgtcgtcctctctcggaaatatacatcctttccatggctgctaggatgtactgccaactggatac
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctat
cgtccccttctccgtctgccgtaccgaccgacgacggggcgaacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY934764_P_P-A Feature FT:CDS AY934764_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9210699). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggacacataaggtgggaaattttactgggctttattcctctactgtacccatctttaatcctgaatggcaaactcctact
tttcccaagattcatttacatgaggacattgttaataggtgtcaacaatttgtgggtcctctcacagtaaatgaaaaaag
aagattaaaattgattatgcctgctagattctatcctaacagtacgaaatatttgcccctagacaaaggaattaaacctt
attatcctgatcatgtagttaatcattacttccagacccgacattatttacatactctttggaaggctggtattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
taccaaaacctcgcaaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaacacaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctcctcacggaggtgttctggggtggagccctcaggctcagggcatat
cgactactgtgccagcagttcctcctcctgcctgcaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaatagtaaaccctgttccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcatcatgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtatggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggatcattgccacaggatcatattg
tacaaaaaatcaaaaattgttttagaaaacttcctattaataggcctattgattggaaagtatgtcaaagaattgtgggt
ctgttgggctttgcagctccctttacacaatgtggataccctgccttaatgcctttgtatgcgtgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatgtgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactgggtggggcttggccattggccatcagcgcatgcgcggaacc
tttgtggctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaactcat
tgggactgataattctgtcgtcctctctcggaaatatacctcctttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY934765_P_P-A Feature FT:CDS AY934765_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 24306). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtccccatctttaatcctgaatggcaaactccttct
ttccctaaaatccatttacatgaggacattattaatagatgtcagcaatttgtaggccctctcactgtcaatgaaaagag
aaggttgaaattaattatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaaggaattaaacctt
attatcctgatcaagtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaggagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaycaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagtkcctcctcctgcctccrccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagamagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaatactcaaccctgttccaaatattgcctcgcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaagatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagaaatggggttattccctaaacttcatggggtatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggctatcctgccttratgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatggacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcgggaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcacggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AY934766_P_P-A Feature FT:CDS AY934766_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 24233). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtccccatctttaatcctgaatggcaaactccttct
ttccctaaaatccatttacatgaggacattattaatagatgtcagcaatttgtaggccctctcactgtcaatgaaaagag
aaggttgaaattaattatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaaggaattaaacctt
attatcctgatcaagtagttaatcattacttccagacccgacattatttacatactctttggaaggckggkattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
cttcaaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaatcaggt
aggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggctacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcggcgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
ctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggctctt
ctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctagcaa
aaccaagaaatggggttattccctaaacttcatggggtatgtaattggaagttggggtacattgccacaagatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggctatcctgccttgatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatggacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcacggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|AY934767_P_P-A Feature FT:CDS AY934767_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 27178). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccgt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacattactactaggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactgaaattaattatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaaggaattaaacctt
attatcctgatcaggtagttaatcattactttcaaacccgacattatttacatactctttggaaggcggggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaatactcaaccctgttcccaatattgcctcgcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaattttatggggtatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggataccctgcattaatgcctttatatgcgtgtatacaagcgaaacg
ggcttttactttctcgccaacttacaaggcctttctgaggaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggttggggcttggctatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggcctctat
cgtccccttctccgtctgccgtaccatccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY934768_P_P-A Feature FT:CDS AY934768_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 25830). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactcctgct
tttcctaaaattcatttacatgaagacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactgaaattaattatgcctgctagattttatcctaacagcactaaatatttgcccctagacaaaggaattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagaaagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaatactcaaccctgttccaaatattgcctcgcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtactggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatggttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaattttatgggttatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggataccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctgagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctcgcagcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgacaattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY934769_P_P-A Feature FT:CDS AY934769_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 23719). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacattactaataggtgtcagcaatttgtaggccctctcacggtaaatgaaaagag
aaaactgaaattaattatgcctgctagattttatcctaacagcactaaatatttgcccctagacaaaggaattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggatttcaaccccatcaaggaccgctggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaatactcaaccctgttccaaatattgcctcgcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctgaattttatggggtatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggataccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccgacttacaaggcctttctgagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggttggggcttggctatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcagacgacccctcgcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaaaccaccgtga
>gnl|hbvcds|AY934770_P_P-A Feature FT:CDS AY934770_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 953642). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacattactaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactgaaattaattatgcctgctagattttatcctaacagcactaaatatttgcccctagacaaaggaattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttacgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaatactcaaccctgttccaagtattgcctcgcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctgaattttatggggtatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacccaatgtggataccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctgagtaaacaatatatgaacctttaccccgttgctcgacaacggc
ctggtctgtgccaagtatttgctgacgcaacccccactgggtggggcttggctatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcacggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY934771_P_P-A Feature FT:CDS AY934771_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 27439). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatttttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacattattaacaggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
acgactgaaattaattatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaacctt
attatcctgatcaggtggttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggat
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagtgcctcctcctgcctccgccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctacaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaatacctcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattrtcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatgggttacgtaattggcagttggggtacattaccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaaccggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttatatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
tgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggatgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY934772_P_P-A Feature FT:CDS AY934772_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1908). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcc
tttcctaaaatccatttacatgaggacattattaataggtgtcagcaatttgtgggtcctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttttcctaacagcaccaaatatttgcctctagacaaagggattaaacctt
attatcctgatcaagtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatactcttgggaacaagagctacatcatgggaggttggt
taccaaaacctcgcaaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggctacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtatcttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
cccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctgattccaggatccacaacaaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggttttgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaacttcatgggatatgtaattggaagttggggtacattgccacaggatcatatta
tacaaaaaatcaaacactgttttagaaaacttcctctcaatcgacctattgattggaaagtatgtcaacgaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttacccggccttaatgcccttgtatgcatgtatacaggcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcgcggcaacggc
ctggtctatgccaagtgtttgctgacgcaacccccactggctggggcttggctattggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagcygcctgttttgctcgcagccggtctggagcaaamctcat
cgggactgataattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctagggtgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcacggggccgcttgggtctctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AY934773_P_P-A Feature FT:CDS AY934773_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9414346). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggcaattttaccgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcc
tttcctaaaatccatttacacgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagattaaaattaattatgcctgctagattttatcccaacagcactaaatatttgcctctagacaaagggattaaacctt
attatcctgatcaagtagttaatcattatttccagacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
taccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaatcaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggctacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgtcgaacatggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
ctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttrtcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaggacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtaattggaagttggggtacattaccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctatcaatcgacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtgggtaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcacggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaraccaccgtga
>gnl|hbvcds|AY934774_P_P-A Feature FT:CDS AY934774_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9615549). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcagactccttct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
gagactaaaattaattatgcctgctaggttttaccctaacagcactaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggcgggtattctatat
aagagggaaactacacgtagcgcctcattttgcgagtcgccatattcttgggaacaagagctacatcataggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tgaccacagtgccaacagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctgaatttcatggggtatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttaggaaacttcctgtcaatcggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cggaactgataattctgtcgtcctttcgcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaaaccaccgtga
>gnl|hbvcds|DQ020002_P_P-A Feature FT:CDS DQ020002_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 380). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttacggggctttattcttctactgtccctatctttaatcctgaatggcatactccttcc
tttcctaaaatccatttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagattaaaattaattatgcccgctagattttatcctaacagtactaaatatttgcctctagacaaaggaattaaacctt
attatccagatcaagtagttaatcattacttccagactcggcattatttacatactctctggaaggcagggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagactgggacttcaaccccaacaaggatcactggccacaagccaaccaggt
aggagtgggagccttcggcccagggttcactcctccacacggaggtattttggggtggagccctcaggctcagggcatat
tggctactttgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaggatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
ctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaacttcatgggatatgtaattggaagttggggtacattgccacaggatcatatta
tacaaaaaatcaaacactgttttagaaaacttcctgttaatcgacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggttatcctgccttaatgcccttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaactcccactggctggggcttggctatcggccatcagcgcatgcgcggaacc
tttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacttcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaggccaccgtga
>gnl|hbvcds|DQ020003_P_P-A Feature FT:CDS DQ020003_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 5780). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgtgaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagaatgaaattaattatgcctgctaggttctatcctaacagcactaaatatttgcctctagataaagggattaaacctt
actatcctgatcatgtagttaatcattactttcaaaccagacattatttacatactctttggaaggctggaattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
cagcaaaacctcgcaaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggctattccctaaattttatggggtatataattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcacggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacctcatttccatggctgctagggtgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcacggggccgcttggggctctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|DQ298161_P_P-A Feature FT:CDS DQ298161_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaacattcatttacaagaggacattattgatcggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagagaatccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catccaaacctcgcaaaggcatggggacgaatctttcagttcccaacccgctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcagggaggcagcccactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccattgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatccccacaataccgcagagtctagactcgtggtggacttctctcagttttctagggga
agcacccgtgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctgctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggactatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccatcatgttgctgtacaaaacctacggatggaaattgcacatgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatttggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattaccacaggatcatattg
tacaaaagatcaaagactgttttagaaaacttcctgttaacaggcctattgattggaaagtctgtcaaagaattgtgggt
cttttgggctttgctgcgccatttacacaatgtggatatcctgccttaatgcctttgtatgcaagtatacaagctaagca
ggctttcactttctcgccaacttacaaggcctttctacgtcaccagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaagctcat
cggaactgacaattctgtcgtcctttcacggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccgcggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|DQ298162_P_P-A Feature FT:CDS DQ298162_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Non-functional genomic sequence. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatttcaatcgccgcgtcacagaagatctcgatctcggggatcccaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaacattcatttacaagaggacattattgatcggtgtcaataatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatacttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagagaatccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catccaaacctcgcaaaggcatggggacgaatctttcagttcccaacccgctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcagggaggcagcccactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcagggctcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggga
agcacacgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggactatcaaggtatgttgcctgtttgtcctctaattccaggatcaacaactaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccatcatgttgctgtacaaaacctacggatggaaattgcacatgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatttggtattgggggccaaa
tctgtgcaacatcgtgaggccctttataccgctgttatcaattttctgttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattaccacaggatcatattg
tacaaaagatcaaggactgttttagaaaactccctgttaacaggcctattgattggaaagtctgtcaaagaattgtgggt
cttttgggctttgctgcgccatttacacaatgtggatatcctgccttaatgcctttgtatgcaagtatacaagctaagca
ggctttcactttctcgccaacttacaaggcctttctacgtcaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggcggctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacgtcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|DQ298163_P_P-A Feature FT:CDS DQ298163_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaacattcatttacaagaggacattattgatcggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtgttctatat
aagagagaatccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catccaaacctcgcaaaggcatggggacgaatctttcagttcccaacccgctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggatttcaaccccatcaaggacaactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcagggaggcagcccactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggga
agcacacgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggactatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcctgttgctgtacaaaacctacggatggaaattgcacatgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatttggtattgggggccaag
tctgtacagcatcgtgagtccctttacaccgctgttacaaattttctgttgtctctgggtattcatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggcagttggggaacattaccacaggatcatattg
tacaaaagatcaaagactgttttagaaaacttcctgttaacaggcctattgattggaaagtctgtcaaagaattgtgggt
cttttgggctttgctgcgccatttacacaatgtggatatcctgccttaatgcctttgtatgcaagtatacaagctaagca
ggctttcactttctcgccaacttacaaggcctttctacgtcaccagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccctcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaagctcat
cggaactgacaattctgtcgtcctttcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|DQ298164_P_P-A Feature FT:CDS DQ298164_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttagtattccgt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaacattcatttacaagaggacattattgatcggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaatccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catccaaacctcgcaaaggcatggggacgaatctttcagttcccaacccgctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaagaaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcaccccaccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcagggaggcagcccactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatct
ccgcgaggactggggaccctgtgaggaacatggagaacatcacatcaggactcctaggacccctactcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggga
agcacccgtgtgtcttggccaaaattcgcagtccccaacctgcaatcactcaccaacctcctgtcctccgatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggactatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcctgttgctgtacgaaacctacggatggaaattgcacatgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatttggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttacaaattttctgttgtctctgggtattcatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggcagttggggaacattaccacaggatcatattg
tacaaaagatcaaagactgttttagaaaacttcctgttaacaggcctattgattggaaagtctgccaaagaattgtgggt
cttttgggctttgctgcgccatttacacaatgtggatatcctgccttaatgcctttgtatgcaagtatacaagctaagca
ggctttcactttctcgccaacttacaaggcctttctacgtcaccagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccctcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattccgtcgtcctttcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|DQ298165_P_P-A Feature FT:CDS DQ298165_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggctggtcccatagaagaagaact
ccctcgcctcgcagacgcagatcccaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttagtattccgt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaacattcatttacaagaggacattattgatcggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaatccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catccaaacctcgcaaaggcatggggacgaatctttcagttcccaacccgctgggattctttcccgatcatcagttgggc
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcaccccaccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcagggaggcagcccactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggactcctaggacccctactcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggga
agcacccgtgtgtcttggccaaaattcgcagtccccaacccgcaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggactatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcctgttgctgtacaaaacctacggatggaaattgcacatgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatttggtattgggggccaag
tctgtacagcatcgtgtgtccctttacaccgctgttacaaattttctgttgtctctgggtattcatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggcagttggggaacattaccacaggatcatattg
tacaaaagatcaaagactgttttagaaaacttcctgttaacaggcctattgattggaaagtctgtcaaagaattgtgggt
cttttgggctttgctgcgccatttacacaatgtggatatcctgccttaatgcctttgtatgcaagtatacaagctaagca
ggctttcactttctcgccaacttacaaggcctttctacgtcaccagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccctcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaagctcat
cggaactgacaattctgtcgtcctttcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|DQ315784_P_P-A Feature FT:CDS DQ315784_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EI03101). Non-functional genomic sequence. [Hepadnaviridae] (length=2535 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttct
tttcctaaaattcatttacatgaagacattgctaataagtgtcagcaatttgtaggccctctcactgtaaatgaaaaaag
aagactgaaattaattatgcctgctaggttttatcctaacagtacaaaatatttgcctttagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttccaaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcatttgggccagggttcactcccccacacggcggtgtgttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtgttccacagctttccaccaagctctgcaagatgttagaaacagggccct
gaatcttcctgctggtggctccagttcaggaacactcaaccctgttccaactattgcctctcacatctcgtcaatctcct
cgaggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcgggg
tttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagc
acccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggtt
atcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctg
gattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcac
gactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattccca
tcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgcca
tttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtct
gtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaac
aaagagatggggttattccctgaatttcatggggtatgtgattggaagttggggtacgttgccacaggatcatattgtac
aaaaaatcaaacactgttttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcagagaattgtgggtctt
ttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggc
ttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggcctg
gtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaaccttt
gtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcattgg
gactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattcttc
gcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgt
ccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatct
gccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|DQ315785_P_P-A Feature FT:CDS DQ315785_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EI0386). Non-functional genomic sequence. [Hepadnaviridae] (length=2514 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctcctgtccctatctttaatcctgaatggcaaaccccttct
tttcctaaaattcatttacatgaagacattgctaataggtgtcaacaatttgtaggccctctcactgtaaatgaaaaaag
aagactgaaattaattatgcctgctaggttttatcctaatagcacaaaatatttgcctttagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcattcgcaaaggca
tggggacgaacctttctgtccccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagccaattca
aacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcattcgggcc
agggttcactccaccacacggaggtgttttggggtggacccctcaggctcagggcatattagccacagtgccagcagtgc
ctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctcag
gccatgcagtgttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctc
cagttcaggaacactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgc
cgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagcacgggaccttgcaaaacctgcacgactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccct
gaatttcatggggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgtttta
gaaaacttcctgtcaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggcttcgccgctccattt
acacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggctttcactttctcgccaactta
caaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctg
acgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccat
actgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcct
ttctcggaaatatacatcgtttccatggctgctaggttgtactgccaactggattcttcgcgggacatcctttgtttacg
tcccgtcggcgctgaatcccgcggacgacccctcgcgcggccgcttggggctgtatcgtccccttctccgtctgccgtac
cgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgc
ttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|DQ315786_P_P-A Feature FT:CDS DQ315786_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EI057). Non-functional genomic sequence. [Hepadnaviridae] (length=2535 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaatattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttct
tttccaaaaattcatttacatgaagacattgctaatcggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactgaaattaattatgcctgctaggttttaccctaacagcacaaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgtcttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagtgcctcctcctgcctccaccaatcggaagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtgttccacagctttccaccaagctctgcaagatcccagagtcaggggcct
gtatcttcctgctggtggctccagttcagggactctcaaccctgttcccaatattgcctctcacatatcgtcaatctcct
cgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcgggg
tttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatc
acccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggtt
atcgctcgatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctg
gattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcac
gactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattccca
tcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgcca
tttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtct
gtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaac
aaagagatggggttattccctgaatttcatgggttatgtaattggaagttggggtacattgccacaggatcatattgtac
aaaaaatcaaacactgttttagaaaacttcctgtcaatcgacctattgattggaaagtatgtcagagaattgtgggtctt
ttgggttttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggc
ttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggcctg
gtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaaccttt
gtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgg
gactgataattctgtcgtcctctctcggaaatatacatcatttccatggctgctaggttgtactgccaactggatactac
gagggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccttcgcgaggccgcttgggactgtatcgt
ccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatct
gccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|DQ788725_P_P-A Feature FT:CDS DQ788725_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate serum 07/92). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctgtctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatattttcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaatcaggt
aggagtgggagcattcgggccagggctcacccctccacatggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccacgcagtggaattccactgccgtccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgccccatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacgtaattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcccttgtatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|DQ788728_P_P-A Feature FT:CDS DQ788728_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate serum 05/96). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacctccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatttcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctgtctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatattttcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttctcaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaatcaggt
aggagtgggagcattcgggccagggctcacccctccacatggcggtattttggggtgaagacctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcga
ggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacc
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcattttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggat
tatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccgtgcaaaacctgcacgac
tcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcc
catcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgta
cagcatcgtgaggccctttataccgctgtgaccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaa
aagatggggttattccctaaacttcatgggttacgtaattggaagttggggaacattgccacaggatcatattgtacaaa
agatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgctccatttacacgatgtggatatcctgccttaatgcccttgtatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctttgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggaac
tgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatccttcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccc
cttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgcgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EF103278_P_P-A Feature FT:CDS EF103278_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ran60). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggagactactgttgttagatgtcgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttct
tttccacaaattcatttacatgaagatattgctaataggtgtcagcaatttgtgggccctctcactgtaaatgaaaagag
aagactgaaattaattatgcctgctaggttttatcctaacagcacaaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtaattaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcgaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggatactttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgtcttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagtgcctcctcctgcctccaccaatcgacagtcaggaaggcagcctactcccatctctccaccc
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaaactctgcaagatcccagagtcagggg
cctgtattctcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctcgcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
accacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgcagctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtctctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtcactttataccgctgttaccaattttcttttgtctttgggtatacatttaaatcctaacaa
aacaagaagatggggttattccctgaatttcatgggttatgtaattggaagttggggtacattgccacaggatcatatta
tacaaaaaatcaaacactgttttaaaaaacttcctgtcaatcgacctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtgggacc
tttgtgtctcctctgccgatccatactgcggaactccaagccgcttggtttgctcgcagccggtctggagcaaaactcat
cggaactgacaattctgtcgtcctctctcggaaatatacatcagttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtccttagtctacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctgtat
cgtccccttctccgtccgccgtaccgtccgacctcggggcgcacctctctttacgcggtctccccgtctgtgccttctca
cctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EF208113_P_P-A Feature FT:CDS EF208113_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient B, serum 05/93). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcacggtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcattttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcaccgtgagtccctttatactgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattaccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacagacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaagca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctttcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU054331_P_C-A Feature FT:CDS EU054331_P_C-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtggggaattttactgggctttattcttctactgtacctatctttaatcctgaatggcaaactccttct
tttcccaagattcatttacatgaggacattattaatagatgtcaacaatttgtaggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctttcctaacagcactaaatatttgccacttgacaaagggattaaacctt
attatcctgatcatgtagttaatcattacttccaggcccgacattatttacatactctttggaaggccggtattctatat
aagagggaaactacaagtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
taccaaaacctcgcaaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaagctcagggcatat
tgactaccgtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctacaagatcccagagtcagggg
cctgtattttcctgcggggtgctccagttcaggaacagtaagccctgttccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgcacaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacttgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcggtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggctacataattggatgttggggatcattgccacaagatcatattg
ttcaaaaactcaaagattgttttcgaaaacttcctgttaacagacctattgattggaaagtctgtcaacgcattgtgggt
cttttgggctttgccgctccatttacacaatgtgggtaccctgctttaatgcctctgtacgcatgtatacaagccaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctatgccaagtgtttgctgacgcaacccccactggctggggcttggccatgggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatctttcccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcacgcggacgacccctctcggggccctttggtcatttct
cgtccccttctctgtctaacattccgaacgaccacggagcgcacctctcattccactgcctacccgtctgtgccttctca
tctgacggaccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|EU086721_P_P-A Feature FT:CDS EU086721_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HRO/w4601-2002). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacagacctattgattggaaagtatgtcaaagaatcgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU185786_P_P-A Feature FT:CDS EU185786_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU11). Non-functional genomic sequence. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
ccggcattcggagccaactcaaacaatccagattgggacttcaatcccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccrcacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaacaatcgkcagtcaggaaggcagcctactcccatctctccacct
ctragagacastcatcctcaggccatgcagtggaattccactgccttcctccaagytctsgaggrtccctgagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgsctctcacatctcgtcwatct
ccgmgaggactggggaccctgtgacgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccacagaatctagactcgtggtggacttctctcaattttctaggggg
akcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattgggtcct
ctggattatcaaggtattttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtasaawacctacggatgraarttgcacctgtayws
csrtcccatcgtcctgggcttkcgcaaaatacctatgggagtggggctcagcccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattskgggccaag
tctgtacagcatcgtgagtmcctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tgcaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
aggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU185787_P_P-A Feature FT:CDS EU185787_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU4). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatcttywatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagatkgggacttcaaccccatcaaggtccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccmmagaatctagactcgtggtggacttctctcaattttctaggggg
agcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattgggtctt
ctggattatcaaggtattttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaarttgcacctgtayws
csatcccatcgtcctgggcttkcgcaaaatacctatgggagtggggctcagcccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtasagcatcgtgagtmcctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tgcaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
aggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU185789_P_P-A Feature FT:CDS EU185789_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU8). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcamcaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattawttmtgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgygggtcaccatawtcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggtccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactgkggaccctgtgacgaacatggagaacatyayatcaggactcctaggacccctgctygtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccacagaatctagactcgtggtggacttctctcaattttctaggggg
agcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattgggtctt
ctggattatcaaggtattttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaarttgcacctgtayws
csrtcccatcgtcctgggcttkcgcaaaatacctatgggagtggggctcagcccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtmcctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tgcaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
aggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU366129_P_P-A Feature FT:CDS EU366129_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA92). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgagtccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccctct
tttcctaaaattcatttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactgaaattaattatgcctgctaggttttatcctaacagcactaaatatttgcctttagacaaagggattaaacctt
attatcctgatcaggtggttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagggwatccacacrtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggcctcaagccaatcaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttctggggtggagccctcaggctcagggcatac
tgrccacrgygccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagccctgcaagatcccagagtaagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctkgatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagcg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaaa
tctgctcaacaccttgaagccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttactcccttaatttcatggggtatgtaattggaagttggggtacgttgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctatcaatcggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacgcaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgacaattccgtcgtcctgtctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|EU410082_P_P-A Feature FT:CDS EU410082_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ph81). Non-functional genomic sequence. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcagactccttct
tttccaaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
gagactaaaattaattatgcctgctaggttttaccctaacagcactaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacacgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacaacatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccattggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccaacagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatttctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattcactgaatttcatggggtatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttaggaaacttcctgtcaatcggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcaccaacttacaaggcctttctaagcaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaaaccaccgtga
>gnl|hbvcds|EU414132_P_P-A Feature FT:CDS EU414132_P_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaygwcgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatytyaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaacaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaaratcaaacactgttttaraaaacttcctgttaacaggcctattgattggaaagtatgtcaaaraattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctatgccaagtgtttgctgacscamcccccactggctggggctkggccataggccatcascgcatgcgtggaacc
tttgtggctcctctgccratccatactgcgraactcctasccgcttgttttgctcgcasccggtctggagcaaagctcat
cgraactgacaattctgtcgtcctctcgcgraaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctraatcccgcgracracccctctcggggccgcttggractctct
cgtccccttctccgtctgccgttccagccraccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgkgtgcacttcgcttcacctctgcnnnnnnnnnnnnnnnnnnnnnnn
>gnl|hbvcds|EU414133_P_P-A Feature FT:CDS EU414133_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacggaaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatscagatcaggtagttaatcattacttcmaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaacaggt
rggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaaaaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU594383_P_P-A Feature FT:CDS EU594383_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaatattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctacaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttctgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttgatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU594384_P_P-A Feature FT:CDS EU594384_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggcaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccatct
ctaagagacagtcatcctcaggcaatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU594385_P_P-A Feature FT:CDS EU594385_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccattggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgcagggctttcccccactgtttggctttcagctatatggatgatatggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
tgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU594386_P_P-A Feature FT:CDS EU594386_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggcaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggcaatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttttt
ctggattatcaaggtatgttgcccgtttgtcctataattccaggatcaacaacaaccagtacgggaccatgcaaaacatg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU594387_P_P-A Feature FT:CDS EU594387_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcaattggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggttcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatacagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggcactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU594388_P_P-A Feature FT:CDS EU594388_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggcgggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU594389_P_P-A Feature FT:CDS EU594389_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggtcctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctaaccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccagccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
ctgttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU594390_P_P-A Feature FT:CDS EU594390_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggacctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtgggacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU594391_P_P-A Feature FT:CDS EU594391_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggacctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccaacagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattctctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU594392_P_P-A Feature FT:CDS EU594392_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggacctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtgggacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU594393_P_P-A Feature FT:CDS EU594393_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatccaagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatacacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU594394_P_P-A Feature FT:CDS EU594394_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU594395_P_P-A Feature FT:CDS EU594395_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccct
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU747320_P_P-A Feature FT:CDS EU747320_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate V51). Non-functional genomic sequence. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctcttcagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgccagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctatatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagattctagactcgtggtggaattctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagaatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaactgtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggacatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaacaccgtga
>gnl|hbvcds|EU859898_P_P-A Feature FT:CDS EU859898_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P45). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcaaacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtgggtatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859899_P_P-A Feature FT:CDS EU859899_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P44). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859900_P_P-A Feature FT:CDS EU859900_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P42). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgccaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaagggg
atcacccgtgtgtcttgggcaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859901_P_P-A Feature FT:CDS EU859901_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P37). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859902_P_P-A Feature FT:CDS EU859902_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P32). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttgggaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859903_P_P-A Feature FT:CDS EU859903_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P40). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859904_P_P-A Feature FT:CDS EU859904_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P39). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859905_P_P-A Feature FT:CDS EU859905_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P38). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859906_P_P-A Feature FT:CDS EU859906_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P30). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859907_P_P-A Feature FT:CDS EU859907_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P29). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcaggga
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
ggtatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859908_P_P-A Feature FT:CDS EU859908_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P28). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859909_P_P-A Feature FT:CDS EU859909_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P31). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859910_P_P-A Feature FT:CDS EU859910_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P27). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttgggaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859911_P_P-A Feature FT:CDS EU859911_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P26). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtaccgatctttaatcctgactggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgcacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859912_P_P-A Feature FT:CDS EU859912_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P23). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttggtagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859913_P_P-A Feature FT:CDS EU859913_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P24). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgcagctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859914_P_P-A Feature FT:CDS EU859914_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P20). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859915_P_P-A Feature FT:CDS EU859915_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P07). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859916_P_P-A Feature FT:CDS EU859916_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P03). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859917_P_P-A Feature FT:CDS EU859917_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P13). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859918_P_P-A Feature FT:CDS EU859918_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P17). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859919_P_P-A Feature FT:CDS EU859919_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P19). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859920_P_P-A Feature FT:CDS EU859920_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P21). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagatggaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859921_P_P-A Feature FT:CDS EU859921_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P08). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaaccttcaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859922_P_P-A Feature FT:CDS EU859922_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P09). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859923_P_P-A Feature FT:CDS EU859923_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P15). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgcctttcaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtgaatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859924_P_P-A Feature FT:CDS EU859924_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P16). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatttctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttatatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859925_P_P-A Feature FT:CDS EU859925_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P22). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859926_P_P-A Feature FT:CDS EU859926_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P06). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859927_P_P-A Feature FT:CDS EU859927_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P25). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaaaccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtttccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859928_P_P-A Feature FT:CDS EU859928_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P01). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859929_P_P-A Feature FT:CDS EU859929_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P43). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859930_P_P-A Feature FT:CDS EU859930_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C126). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859931_P_P-A Feature FT:CDS EU859931_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C96). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctctgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859932_P_P-A Feature FT:CDS EU859932_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C69). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagataaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccaacagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttttcgccaacttacaaggcctttctacgtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggttgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactttct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859933_P_P-A Feature FT:CDS EU859933_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C67). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccaacagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859934_P_P-A Feature FT:CDS EU859934_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C60). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaattccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaacatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatcccgattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacactcatcctcaggccatacagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatgcaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaag
tctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctaccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859935_P_P-A Feature FT:CDS EU859935_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C14). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctaaccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctttcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859936_P_P-A Feature FT:CDS EU859936_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C10). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctaaccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacctgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctttcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859937_P_P-A Feature FT:CDS EU859937_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C40). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctcgccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctctgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859938_P_P-A Feature FT:CDS EU859938_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C133). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagagaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctaccgcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccgtgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggg
atctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccacg
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagctgcctgttttgctcgcagccggtctggagcaaaactcat
cggcacggacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859939_P_P-A Feature FT:CDS EU859939_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C130). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtgaacaatttgtgggccctctcactgtaaatgaaaaaag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaagccatgcagtggaattccactgccttccaccaagctctacaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgggttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccacg
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacattattggaagttggggaacattaccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttggggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859940_P_P-A Feature FT:CDS EU859940_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C122). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggtcctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggagcattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859941_P_P-A Feature FT:CDS EU859941_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C153). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccaacagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859942_P_P-A Feature FT:CDS EU859942_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C110). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggttatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859943_P_P-A Feature FT:CDS EU859943_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C109). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccaacagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtcacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859944_P_P-A Feature FT:CDS EU859944_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C105). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccaacaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctacaggatcccagagtcagggg
tctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctgggctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattccgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactgtct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859945_P_P-A Feature FT:CDS EU859945_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C102). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaacaagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcccttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859946_P_P-A Feature FT:CDS EU859946_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C155). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggtcctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggagcattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatacatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859947_P_P-A Feature FT:CDS EU859947_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C85). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctacttccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggagcattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859948_P_P-A Feature FT:CDS EU859948_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C151). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaatcaggt
aggagtgggagcattcgggccagggctcacccctccacacgggggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859949_P_P-A Feature FT:CDS EU859949_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C152). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaatcaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859950_P_P-A Feature FT:CDS EU859950_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C64). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaagtagttaatcattacttccaaacaagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcga
ggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctaaactcgtggtggacttctctcaattttctagggggatcacc
cgtgtgtcttggccaagattcgcagtccccaacctccaatcactcaccaacctcctgtcctcgaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggat
tatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgac
tcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcc
catcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgta
cagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaa
aagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattgtacaaa
agatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgctccatttacacaatgtggatatcctgccttaatgcccttgtatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaac
tgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatccttcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccc
cttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859951_P_P-A Feature FT:CDS EU859951_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C62). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccaatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859952_P_P-A Feature FT:CDS EU859952_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C56). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttagtatccctt
ggactcataaggtgggaaattttactgggctttattctactactgtacctacctttaatcctgattggcaaactccttct
tttcctaagattcatttacatgaggacattattaataggtgtcaacattttgtgggccctcttactgtaaatgaaaaaag
aagattgaaattaattatgcctgctaggttctatcctaccagcactaaatatttgcccctagacaaagggattaaaccct
attatccagatcaggtagttaatcattacttccagactcgacattatttacatactctttggaaggctggtattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaacacctcgcataggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcaggctcagggcatat
tgaccacagtgccaaaggttcctcctcctgcctcgaccaatcggcagtcaggaaggcagccgactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacaaccttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaaaccctgttcagaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgtaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctcgactcgtggtggacttctctcaattttctaggggg
atcacccgcgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggtactt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggaaccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctattaccaattttcttttgtctttgggtatacatctaaaccctaacaa
aacaaagagatggggttactccctaaacttcatgggatatgtaattggaagttggggaacattaccacaggatcatattg
cacaaaaacttaaacactgttttagaaaacttcctgttaataggcctattgattggaaggtatgtcaacgaattgtgggt
cttttgggctttgccgctccttttacacaatgtggataccctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgatgcaacccccactggctggggcttggccattggccatcagcgcatgcgcggaacc
tttgcggctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagcaggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcttttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggtcgcttgggactctat
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859953_P_P-A Feature FT:CDS EU859953_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C55). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcggccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctcattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctctgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859954_P_P-A Feature FT:CDS EU859954_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C42). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccaacagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859955_P_P-A Feature FT:CDS EU859955_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C39). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctctattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctaaccacactaagtatttgcccttagacaaaggaattaaacctt
attatcccgatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggaggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaagct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaag
tctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|EU859956_P_P-A Feature FT:CDS EU859956_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C35). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctctattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctaaccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaagct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ349224_P_P-A Feature FT:CDS FJ349224_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H71). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaatcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ349296_P_P-A Feature FT:CDS FJ349296_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtagggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctactgtacctatctttaatcctgaatggcaaactccttct
tttcctaagatacatttacatgaagacattattgataggtgtcagcaatttgtgggccctctcactataaatgaaaagag
aagattaaaattgattatgcccgctagattctatcctaacagcacaaaatatttgccactagacaaaggaattaaacctt
attatcctgatcaggtggttaatcattactttcagacccgtcattatttacatactctgtggaaggcgggtattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttgga
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtattctggggtggagccctcaggctcagggcacat
tgactaccgtgccaacagttcctcctcctgcctccaccaatcggcagtcaggaaggcagccgactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctacaagatcccagagtcagggg
cctgtattttcctgctggtgggtccagttcaggaacagtcagccctgttccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggttttgggggccaag
tctgtacaacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaaatactaacaa
aacaaaaagatggggttattccctgaacttcatgggatacataattggaagttggggatcattaccacaggatcatattg
tacaaaaaattagacactgttttagaaaacttcctgttaataggcctattgattggaaagtgtgccaaagaattgtgggt
cttttgggctttgccgctccctttacacaatgtggctaccctgctttaatgcctttgtacgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacagggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
caggtctatgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcacaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcgtttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggggctgaatcccgcggacgacccctctcggggccgcttggggctctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|FJ692554_P_P-A Feature FT:CDS FJ692554_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_24063). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctccactgtacctagctttaatcctgaatggcagactccttct
tttcctaagattcatttacatgaggacattattaatagatgtcaacaatttgtgggccctcttactgtaaatgaaaagag
aagattgaaattgattatgcctgctagattctatcctaacagtaccaaatatttgcctctacacaaagggattaaacctt
attatcctgatcagatagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatat
aagagggaaaccactcgtagcgcctcattttgcgggtcaccatattcctgggaacaagagctacatcatgggaggttgga
tatcaaaacctcgcaatggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaagcaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcacat
tgactacagtgccagcagttcctcctcctgtctccgccaatcggcagtcaggaaggcagcctacacccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaaactctacaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgctccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcaaaagctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatatggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggcatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtaattggaagttggggatcattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaactccctgtcaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctagaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatggacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgcggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggaaaccaccgtga
>gnl|hbvcds|FJ692557_P_P-A Feature FT:CDS FJ692557_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48004). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactaaaattaattatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatgggttatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692558_P_P-A Feature FT:CDS FJ692558_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48008). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgtggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgagtggcaaactccgtct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactaaacttaattatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctgtggaaggctgggatcctatat
aaaagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggggccaattcaaacaatccagattgggacttcaacccmgtcaargaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccggtagttcctcctcctgcctctaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccctgmagtggaattccacagctttacacmaaactcagcaagatcccagagtcagggg
cctrtatttccctgctggtggctccagttcaggaacactcaaccctgttccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gtgtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcctgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccctttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggttctgggggccaag
tctgtacaacatcttgagtccctttataccgctgttascaattttcttttrtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatgggttatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacaatatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccattggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccttcgcggggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692559_P_P-A Feature FT:CDS FJ692559_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48032). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacrcttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggamtctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccgtct
tttcctaaaattcatttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactgaaattaattatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctgtggaaggctgggatcctatat
aagagggaaaccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcaattggac
cccgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatttctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtatcttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcaaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatgggttatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttatcctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692561_P_P-A Feature FT:CDS FJ692561_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48040). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaractgctgttgttagatgtcgagcccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccgtct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactaaaattaattatgcctgctagrttttatcctaacagcaccaaatatttgcctctagacaaagggattaaacctt
attatcctgatcaggtagttaatcattactttcaaacccgacattatttacatactctgtggaaggctggratcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaycctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaggt
rggagtgggagcattcgggccagggttcactcccccacacggaggtgtkttggggtggagccctcaggctcagggcatat
tggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gccacacgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaaa
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatgggctatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacaatatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccttcgcggggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692562_P_P-A Feature FT:CDS FJ692562_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48044). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactggactttattcttctactgtccctgtctttaatcctgaatggcaaactccgtct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactaaaattaattatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaaggaattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctgtggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatacagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaaaaatactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcactgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gycacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctkgatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaag
tctgtacaacatcttgaatccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatgggttatgtaattggatgttggggtgcattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcaaagaattgtgggt
ctcttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaattggattc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgacaacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692563_P_P-A Feature FT:CDS FJ692563_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48049). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtycctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactaaaattaattatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttctkttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatgggttatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggttaccctgcattaatgcctttatatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccttcgcggggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692564_P_P-A Feature FT:CDS FJ692564_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48074). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggccgaggcaggtcccctcgaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactgaaattaattatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcctgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaacccagattgggacttcaaccccgtcaaggaccactggccacaggccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacaatgccagcagttcmtcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
accacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacatgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatggggtatgtaattggaagttggggtacattgccacaggatcatatta
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctagggtgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgcggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692565_P_P-A Feature FT:CDS FJ692565_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48077). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagrccgaggcaggtcccctmgaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggsaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactgaaattaattatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcctgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaacccagattgggacttcaaccccgtcaaggaccactggccacaggccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacartgccagcagttcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatrcagtggaattccacaactttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
wccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacatgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatwcatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatggggtatgtaattggaagttggggtacattgccacaggatcatatta
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctagggtgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgcggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692566_P_P-A Feature FT:CDS FJ692566_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48090). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccctct
tttcctaaaattcatttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactgaaattaattatgcctgctaggttttaccctaacagcactaaatatttgcctttagacaaaggaattaaacctt
attatcctgatcaggtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatat
aagagagaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattccttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactccaccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacggtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccacatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcaaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttactcccttaatttcatggggtatgtaattggaagttggggtacattgccacaggatcatatta
tacaaaaaatcaaacaatgttttagaaaacttcctatcaatcggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtcaacagtatatgaacctttaccccgttgcccggcaacggc
ccggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaamactcat
cgggactgacaattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccttcgcgaggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692567_P_P-A Feature FT:CDS FJ692567_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48113). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggagactactgttgttagatgtcgaaaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacmtcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacatttctactaggtgtcaggaatttgtaggccctctcactgtaaatgaaaarag
aagactgaaattaattatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctggaatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcctgggaacaagagctacatcatgggaggttggt
catcgaaacctcgcaaaggcatggggacgaacctttctgttcccaaycctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaayccagattgggacttcaacccagtcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacractttccaycaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
accacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
ggtatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaaccaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacatgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtgtggctttcagctatatggatgatgtggtactgggggccaar
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaa
aacaaagagatggggatattccctaaatttcatggggtatgtaattggaagttggggtacattgccacaggatcatatta
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctagggtgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgcggtcgcttggggctctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692571_P_P-A Feature FT:CDS FJ692571_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50011). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccacgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttccaaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactaaaattaattatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtatcttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatgggttatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaccagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggaraccaccgtga
>gnl|hbvcds|FJ692572_P_P-A Feature FT:CDS FJ692572_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50013). Non-functional genomic sequence. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaaaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccgtct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactaaaattaattatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaagggattaagcctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctgtggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcgaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttctcgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatryttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatgggttatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcacggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccttcacggggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggcccgtgtgcacttcgmttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692574_P_P-A Feature FT:CDS FJ692574_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50015). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccgtct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactaaaattaattatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctgtggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatgggttatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctctgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccttcgcggggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692575_P_P-A Feature FT:CDS FJ692575_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50020). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggyaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccctct
tttccaaaaattcatttacatgaagacattgctgataggtgtcagcaatttgtaggccctcttactgcaaatgaaaagag
aagactgaaattaattatgcctgctaggttttatcctaacagtactaaatatttacctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatat
aagagagaaactacacgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cccgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatrt
tgrccacagtgccagcagttcctcctcctgcctccwccaatcggcagtcaggvaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccrtgcagtggaattccacagctttccaccaagctctgcaagatcccaaagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
awcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattrtcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatwcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccaytgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacaycttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatgggttatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctatcaatcggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcaaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtatcwgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaacctcat
cgggactgacaattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgcttggggctctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692576_P_P-A Feature FT:CDS FJ692576_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50022). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaggacgaccccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccgtct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactaaaattaattatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaagggattaaacctt
attatcctgatcaggtagttaatcattactttcaaacccgacattatttacatactctgtggaaggctgggatcctatat
aagagggaaacttcacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaacacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaaytccacagctttccaccaarctctgcaagatcccagartcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgctgaatatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaaa
actgtacaacatcttgagtccctttatactgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatgggttatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacaatatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccttcgcggggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692577_P_P-A Feature FT:CDS FJ692577_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50024). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccgtct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactaaaattaattatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaagggattaaacctt
attatcctgatcaggtagttaatcattactttcaaacccgacattatttacatactctgtggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccattggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtatcttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaag
actgwacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatgggctatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacaatatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccttcgcggggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692578_P_P-A Feature FT:CDS FJ692578_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50083). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactaaaattaattatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cccgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaagt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatgggttatgtaattggaagttggggtacattgccacaggagcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692579_P_P-A Feature FT:CDS FJ692579_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50084). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactaaaattaattatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cccgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaagt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatgggttatgtaattggaagttggggtacattgccacaggagcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692580_P_P-A Feature FT:CDS FJ692580_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50085). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactaaaattaattatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cccgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaagt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatgggttatgtaattggaagttggggtacattgccacaggagcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692581_P_P-A Feature FT:CDS FJ692581_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50086). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactaaaattaattatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cccgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaagt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatgggttatgtaattggaagttggggtacattgccacaggagcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692582_P_P-A Feature FT:CDS FJ692582_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50088). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactaaaattaattatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cccgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaagt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatgggttatgtaattggaagttggggtacattgccacaggagcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692583_P_P-A Feature FT:CDS FJ692583_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50089). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactaaaattaattatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cccgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaagt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatgggttatgtaattggaagttggggtacattgccacaggagcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692584_P_P-A Feature FT:CDS FJ692584_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50090). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactaaaattaattatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cccgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaagt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatgggttatgtaattggaagttggggtacattgccacaggagcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692585_P_P-A Feature FT:CDS FJ692585_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50091). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactaaaattaattatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cccgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaagt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatgggttatgtaattggaagttggggtacattgccacaggagcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692587_P_P-A Feature FT:CDS FJ692587_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50115). Non-functional genomic sequence. [Hepadnaviridae] (length=2520 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgcaaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactggkctttattcctctactgtccctatctttaatcctgaatggcaaactccttcc
tttccaacaatccatttacatgaggacattattrataggtgtcagcaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctaggttttttcctaacagcactaaatatttgcctctagacaaagggattaaacctt
attatcctgatcaagtagttaatcattacttccaaacccgacattatttacatactctgtggaaggcggggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcaaacctcgcaaag
gcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagccaac
tcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcattcgg
cccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctacagtgccagcag
ttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcct
caggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctgg
tggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggacc
ctgcgttgaacatggagaacatcacatcaggattcccaggacccctgctcgagttacaggcggggtytttcttgtggaca
agaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggcccacccgtgtgtcgtgg
ccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtc
tgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatg
ttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaagg
caactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttggg
ctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttc
gtagggctttcccccactgyttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgag
tccctttataccgctgtaaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggtta
ttccctaaacttcatgggatatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacact
gttttaggaaacttcctgtcaatcgacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgccgct
ccatttacacaatgtggttaccctgccttgatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgcc
aacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgt
ttgctgacgcaacccccactggttggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccg
atccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgataattctgt
cgtcctgtctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttg
tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccacttctccgtctg
ccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgca
cttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692588_P_P-A Feature FT:CDS FJ692588_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50119). Complete genome. [Hepadnaviridae] (length=2541 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccggcaaggcaggtcccctagaagaaga
actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattc
cttggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactcct
tcttttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaa
gagaagactaaaattaattatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaac
cttattatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatccta
tataagagggaaactacacgtagcgcctcattttgcgggtcaccatattcctgggaacaagagctacatcatgggaggtt
ggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttg
gaccctgcattcggagccaattcaaacaacccagattgggacttcaaccccgtcaaggaccactggccacaagccaacca
ggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggca
tattggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctcca
cctctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctgcaagatcccagagtcag
gggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacaactcgtcaa
tctcctcgaggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacag
gcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagg
gggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtc
ctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggtt
cttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaac
ctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgta
ttcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttacta
gtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggcc
aagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaa
caaaacaaagagatggggttattccctaaatttcatggggtatgtaattggaagttggggtacattgccacaggatcata
ttctacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaggtatgtcagagaattgtg
ggtcttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaa
acaggctttcactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaac
ggcctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtgga
acctttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacct
catcgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctagggtgtactgccaactgga
ttcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgcggtcgcttgggactc
tatcgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttc
tcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692590_P_P-A Feature FT:CDS FJ692590_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50152). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagactgaaattaattatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaacctt
attatcctgatcatgtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcctgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaacccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacatgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatggggtatgtaattggaagttggggtacattgccacaggatcatatta
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctagggtgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgcggtcgcttggggctctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccgccgtga
>gnl|hbvcds|FJ692591_P_P-A Feature FT:CDS FJ692591_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50167). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacatttytaatagrtgtcagcaatttgtrggccctctcactgtaaatgaaaagag
aagaytgaaattrattatgcctgctagattttatcctaacagcacyaaatatttgccyctasacaaagggattaaacctt
attatcctgatcatrtagttaatcattactttcaarcccgacattatttacatactctttggaaggctgggatyctatat
aagagggaaacyacwcgtagcgcctcattttgcgggtcaccatattcytgggaacaagagctacatcatgggaggttggw
catcaaaacctcgcaaaggcatggggacgaayctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaaytcaaacaacccagattgggacttcaaccccrtcaaggaccactggccacaagccaaycaggt
aggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacarctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacatgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaatttcatggggtatgtaattggaagttggggtacattgccacaggatcatatta
tacaaaaaatcaaacactgttttagaaaacttcctgtcaatcggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgcattaatgcctttgtatgcatgtatacaagcgaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctagggtgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgcggtcgcttggggctctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccgccgtga
>gnl|hbvcds|FJ692592_P_P-A Feature FT:CDS FJ692592_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50175). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcc
tttccaaaaatccatttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctaggttttttcctaacagcactaaatatttgcctctacacaaagggattaaacctt
attatcctgatcaagtagttaatcattacttccaaacacgacattatttacatactctttggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagatacatcatgggaggttggt
taccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagactgggacttcaaycccatcaaggaccactggccacaagccaaccaggt
aggagtgggagcatttggcccagggttcactcccccacacggaggtgttttggggtggagcccgcaggctcagggcatag
tggctacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaggatccaaaagtcagggc
cctgtattttcctgctggtggctccagttcaggaacgctcaaccctgttccmaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcgttgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
ctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaawttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttctt
ctggattaccagggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccwcg
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaactttatgggatatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttaggaaacttcctgtcaatcgacctattgattggaaagtatgtcaacgaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgccttaatgcctttatatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggttggggcttggctatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaacctcat
tgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692593_P_P-A Feature FT:CDS FJ692593_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48054). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactrctgttgttagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttgsactc
ataaggtgggaaattttactgggctttattcctctactgtacctagctttaatcctgactggcaaactcctgcttttcct
aaaattcatttacatgaggacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagayt
gaaattgattatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaaccttattatc
ctgatcagatagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatataagagr
gaaaccactcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggatatcag
cacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgca
ttcggagccaactcaaacaatccagattgggacttcaaccacatcaagaaccactggccacaagccaatcaggtaggagt
gggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgacta
cagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacccatctctccacctctaaga
gacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaaratcccaaagtcaggggcctgta
ttttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcgcatctcgtcaatctcctcga
ggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgcwcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcc
cgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggat
tatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgac
tcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcc
catcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggcttttccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgccgtaaccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaa
aagatggggttattccctaaacttcatgggatatgtaattggaagttggggatcattgccacaggatcatattgtacaaa
aaatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgccgccccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctagacaggcttt
tactttctcgccaacttacaaggcctttctaagtacacagtatatgaacctttaccccgttgcccggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggac
tgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtactgccaactggattcttcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccc
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692595_P_P-A Feature FT:CDS FJ692595_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48093). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgataccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcataaggtgggaaattttactggtctttattcctctactgtgcctagctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaggacattattaatagatgtcagcaatttgtgggccctctcactgtaaatgaaaaaag
aagattgaaattgattatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaaggrattaaacctt
attatcctgatcagatagttaatcattactttcaggcccgacattatttacatactctttggaaggctggtattctatat
aagagggaatccactcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttgga
tatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaycctctgggattcyttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatcccgattgggacttcaaccacagcaaggaccactggccacaagccaatcaggt
rggagtgggagcatttgggccagggttcacccctccacacggaggtgtcctggggtggagccctcaggctcagggcatat
tgaccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagccyactcccatctctccacct
ctaagagacagtcatcctcaggccatrcagtggaattccacagctttccaccamgctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacttgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aactaaaagatggggttattccctaaacttcatgggatatgtaattggaagttggggatcattgccacaggatcatattg
tccaaaaaatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
tttttgggctttgccgccccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctagaca
ggcttttactttctcgcccacttacaaggcctttctaagtacacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692596_P_P-A Feature FT:CDS FJ692596_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48103). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcataaggtgggaaattttaccgggctttattcctctactgtgcctagctttaatcctgmatggcaaactccttct
tttcctaaaattcatttacatgaggacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattgattatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaacctt
attatcctgatcagatagttaatcattacttccaggctcgacattatttacatactctttggaaggctggtattctatat
aagagggaaaccactcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttgga
tatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaggaccactggccacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatat
tgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacccatctctccacct
ctaagagacagtcatcctcagrccatgcagtggaattccacwgctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcagggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtaattggaagttggggatcattgccacaggatcatattg
tccaaaaaatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgccccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctagaca
ggcttttactttctcgccaacttacaaggcctttctaagtacacaatatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccaatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
tgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692597_P_P-A Feature FT:CDS FJ692597_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48125). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacwacgamtccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttct
tttccyaaaattcatttacatgaggacattattaatagatgtcaacaatttgtgggccccctcactgtaaatgaaaaaag
aagattgaaattgattatgcctgctagattttatcctaacagcaccaaatatttgcccttacacaaagggattaaacctt
attatcctgatcagatagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatat
aagagggaatccactcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttgga
tatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaggaccactggccacaagccaagcaggt
aggagtgggagcattygggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatat
tgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacwcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagckttccaccaagctytgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacattacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtaattggargttggggatcattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgccccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctagaca
ggcttttactttctcaccaacttacaaggcctttctaagtacacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacrtcctttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcrcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692598_P_P-A Feature FT:CDS FJ692598_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50018). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttcc
tttcctaaaattcatttacatgaagacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattgattatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaacctt
attatcctgatcagatagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatat
aagagggaaaccactcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttgga
tatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaggaccactggccacaagccaatcaggt
gggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatat
tgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcatctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaatacctcagagtctagacttgtggtggacttctctcaattttctaggggg
atctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccrayttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattaycarggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctrttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtaattggaagttggggatcrttgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgccccatttacacaatgtggatatcctgccttaatgcctttgtatgcawgtatacaagctagaca
ggcttttactttctcgccaacttacaaggcctttctaagtacacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggaaaccaccgtga
>gnl|hbvcds|FJ692599_P_P-A Feature FT:CDS FJ692599_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50033). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcctatcgacacttcctgaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacattattaatagatgtcaacaatttgttggccctctcaatgtaaatgaaaagag
aagattgaaattgattatgcctgctagattttatcctaacaacaccaaatatttgcccctacacaaagggattaaacctt
attatcctgatcagatagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatat
aagagggaaaccactcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttgga
tatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggat
cctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaggaccactggccacaagccaatcaggt
aggagtgggcgcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatat
tgactacagtgccagcagttccccctcctgcctccaccaatcggcagtcaggaaggcagcctacgcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaagcgctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcacagaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccmtttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgaatccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtaattggaagttggggatcattgccacaggatcatatta
tacaaaaaatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgccccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctagaca
ggcttttactttctcgccaacttacaaggcctttctaagtacacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692600_P_P-A Feature FT:CDS FJ692600_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50034). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgasaccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttcc
tttcctaaaattcatttacatgaggacattattaatagatgtcaacaatttgtgggcyctctcactgtaaatgaaaagag
aagattgaaattgattatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaacctt
attatcctgatcagatagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatat
aagagggaaaccactcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttgga
tatcaacacctcgcaaaggcatggggacgaatctttckgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaggaccactggccacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatat
tgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacwcccatctctccaccy
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatyacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcagggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattc
ccatcccatcatcctgggctttcgyaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtaattggaagttggggatcattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgccccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctagaca
ggcttttactttctcgccaacttacaaggcctttctaaatacacagtatatgaacctttaccccgttgctcggcaacggc
cgggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692601_P_P-A Feature FT:CDS FJ692601_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50035). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaggacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattgattatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaacctt
attatcctgatcagatagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatat
aagagggaaaccactcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttgga
tatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaagraccactggccacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttctgggatggagccctcaggctcagggcatat
tgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtaattggaagttggggatcattgccacaggatcatattg
tacaaaaaatcaaacactgttttaggaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgccccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctagaca
ggcttttactttctcgccaacttacaaggcctttctaagtacacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcacaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692602_P_P-A Feature FT:CDS FJ692602_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50041). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaggacattattgatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattgattatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaacctt
attatcctgatcagatagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatat
aagagggaaaccactcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttgga
tatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaagaccactggccacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcayat
tgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacwcccatctctccacct
ctaagagacagtcatcctcaggccatgcaatggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtaattggaagttggggatcattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaacagrcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgccccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctagaca
ggcttttactttctcgccaacctacaaggcctttctaagtacacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692603_P_P-A Feature FT:CDS FJ692603_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50050). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagaactcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaggacattatcaatagatgtcaacaatttgtgggccctctcactgcaaatgaaaagag
aagattgaaattgattatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaacctt
attatcctgatcagatagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatat
aagagagaaaccactcgtagcgcctcattttgygggtcaccatattcttgggaacaagagctacatcatgggaggtcgga
yatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
ccygcattcggrgccaactcaaacaatccagattgggacttcaaccacatcaaggaccactggccacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatat
tgactacagtgccagcagttccgcctcctgcctccaccaatcggcagtcrggaaggcagcctacrcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaarctctgcaagatcccagagtcaggar
cctgtgtcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
cmtcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggttgacttctctcaattttctaggggg
atctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cactactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtaattggaagttggggatcattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgcagccccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctagaca
ggcttttactttctcgccaacttacaaggcctttctaagtacacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgcctgccgtaccggccgwccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tccgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692604_P_P-A Feature FT:CDS FJ692604_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50052). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaggacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattgattatgcctgccagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaacctt
attatcctgatcagatagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatat
aagagggaatccactcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttgga
tatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcaattggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaggaccactggccacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatat
tgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagcyctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtraaccctgctccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtaattggaagttggggatcattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaacaggcccattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgccccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctagaca
ggcttttactttctcgccaacttacaaggcctttctaagtacacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccataccgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692605_P_P-A Feature FT:CDS FJ692605_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50059). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgtact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaayctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaggacattattaatagatgtcaacaatttgtaggccctctcactgtaaatgaaaagag
aagattgaaattgattatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaacctt
attatcctgatcagatagttaatcattacttccaggctcgacattatttacatactctctggaaggctggtattctatat
aagagggaaaccactcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggtygga
tatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaggaccactggccacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatat
tgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaarctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatcttgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttckaggggr
atctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
wctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtaattggaagttggggatcattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgccccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctagaca
ggcttttactttctcgccaacttacaaggcctttctaagtacacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgagtgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692606_P_P-A Feature FT:CDS FJ692606_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50061). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttct
tttcctaagattcatttacatgaggacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaaaag
aagattgaaattgattatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaacctt
attatcctgatcagatagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatat
aagagggaaaccactcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttgga
tatcaactcctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaagaccactggccacaagccaatcaggt
aggagtgggagcatttggcccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatat
tgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacccatctctccacct
ctaagagacagccatcctcaggccatgcaatggaattccccagttttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattccyargacccccgctcgtgttacaggcg
gggtctttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtatctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccamcagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtgattggaagttggggatcattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
ctattgggctttgccgccccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctagaca
ggcttttactttctcgccaacttacaaggcctttctaagtacacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggcccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692607_P_P-A Feature FT:CDS FJ692607_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50068). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaggagaccgaggcaggtcccttagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtgcctagctttaaccctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattgattatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaacctt
attatcctgatcagatagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatat
aagagggaaaccactcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttgga
tatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaggaccactggccacaagccaatcaggt
gggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatat
tgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacccatctctccacct
ctcagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcacagaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttytatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtaattggaagttggggatcattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgccccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctagaca
ggctttcactttctcgccaacttacaaggcctttctaagtacacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcttttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggtctctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692608_P_P-A Feature FT:CDS FJ692608_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50075). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttct
tttcctaagattcatttacatgaggacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaaaag
aagattgaaattgattatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaacctt
attatcctgatcagatagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatat
aagagggaaaccactcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttgga
tatcaactcctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaagaccactggccacaagccaatcaggt
aggagtgggagcatttggcccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatat
tgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacccatctctccacct
ctaagagacagccatcctcaggccatgcaatggaattccacagctttccaccaagctctgcaagatcccagggtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacacctcgtcaatct
cctcgaggactggggaccctgtaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggactatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtaattggaagttggggatcattgccacaggatcatattg
tacaaaaaatcactcactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgccccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctagaca
ggcttttactttctcgccaacttacaaggcctttctacgtacacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692609_P_P-A Feature FT:CDS FJ692609_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50098). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgtact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaggacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattgattatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaacctt
attatcctgatcagatagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggtcgga
tatcaacaccccgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaggaccattggccacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatat
tgactacagtgccagcagttcctcctcttgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggatccctaggacccctgctcgtgttacaggcg
gggtttttcttgtggacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggga
atctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctatggacggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtaattggaagttggggatcattgccacaggatcatattg
tacaaaaaattaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgccccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctagaca
ggcttttactttctcgccaacttacaaggcctttctgagtacacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagctggtctggagcgaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692610_P_P-A Feature FT:CDS FJ692610_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50104). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagrccgaggcaggtcccctagaagacgtact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaggacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattgattatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaacctt
attatcctgatcagatagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggtcgga
tatcaacaccccgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaggaccattggccacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatat
tgactacagtgccagcagttcctcctcttgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaycaarmtctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggatccctaggacccctgctcgtgttacaggcg
gggtttttcttgtggacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggga
atctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctatggacggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtaattggaagttggggatcattgccacaggatcatattg
tacaaaaaattaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcagagaattgtgggt
cttttgggctttgccgccccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctagaca
ggcttttactttctcgccaacttacaaggcctttctragtacacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcyggtctggagcgaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgytaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692611_P_P-A Feature FT:CDS FJ692611_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50127). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaggacattatcaatagatgtcaacaatttgtaggccctctcactgtaaatgaaaagag
aagattgaagttgattatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaacctt
attatcctgatcagatagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatat
aagagagaaaccactcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggtcggm
tatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaggacccctggccacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatat
tgactacagtgccagcagttccccctcctgcctccaccaatcggcagtcaggaaggcagcctacacccatctctccacct
ctaagagacagtcatcctcaggcaayacagtggaattccacagctttccaccaagctctgcaagatcccacagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgataagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccgatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctgaacttcatgggatatgtgattggaagttggggatcattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctattaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgccccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctagaca
ggcttttactttctcgccaacttacaaggcctttctacgtacacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tccgccggcccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692612_P_P-A Feature FT:CDS FJ692612_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50132). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaayctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaagacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattgattatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaacctt
attatcctgatcagatagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatat
aagagggaaaccactcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttgga
tatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaggaccactggccacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatat
tgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagcgctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcacagaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaatwcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggyatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtaattggaagttggggatcattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgccccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctagaca
ggcttttactttctcgccaacttacaaggcctttctragtacacagtatatgaacctttaycccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcmggtctggagcgaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggtctctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ692613_P_P-A Feature FT:CDS FJ692613_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50156). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgagatcgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttct
tttcctaaaattcatttacatgaggacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaaytgattatgcctgctagattttatcctaacagcaccaaatatttgccattagacaaagggattaaacctt
attatcctgatcagatagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatat
aagagggaaaccactcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttgga
tatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
ccggcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaggaccactggccacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatat
tgactacagtgccagcaattcctcctcctgcctccaccaatcggcagtcaggaagacagcctacacccatctctccacct
ctaagggacagtcatcctcaggccatgcagtggaattccacagctttccaccaarccctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatattaccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcgtgaggccctttatgccgctgttaccaattttcttttgtctctgggcatacatttaaacccgaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtaattggaagttggggatcattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgccccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctagaca
ggcttttactttctcgccaacttacaaggcctttctaagtacacagtacatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacctcctttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggtctctat
cgtccgcttctccgtctgccgtaccaaccgtccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FJ904434_P_P-A Feature FT:CDS FJ904434_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate B21). Non-functional genomic sequence. [Hepadnaviridae] (length=2511 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttct
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaag
aagattgaaattaattatgcctgctagattctatcctacctacactaaatacttgccattagacaaagggatcaaaccct
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctgtggaaggctggtattctatat
aagagagaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattyggagccaactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggt
aggagtgggagcattcggcccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatat
tgacaacagtgtcaacagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatttctcctcmt
ctaagagacagtcatcctcaggtcatgcagwggaattccactgccatccaccaacatcagtttcatgctggtggctccag
ttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgaaga
acatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctc
acaataccgcagagtctagactcgtggtggacttctctcaattttctaggggagccacccgtgtgtcgtggccaaaattc
gcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtt
ttatcatatccctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtt
tgtcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctat
gtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcgtcctgggctttcgcaa
aatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccmtttgttcartggttcgtagggctt
tcccccactgtttggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcgtgagtcccttttt
accgctgttaccaattttcttttgtctttgggtatacatttaaaccccaacaaaacaaaaagatggggttactccctaaa
cttcatgggatacgtaattggaagttggggaactttgccacaggatcatattgtacaaaagcttaaacaatgttttagaa
aactacctgttaacaggcctattgattggaaagtatgtcagagaattgtgggtcttttgggcttcgctgctccctttaca
cagtgtgggtaccctgccttaatgcccttgtatgcatctatacaagcgaaacaggcttttactttctcgccaacttacaa
ggcctttctaagtaaacagtacatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacg
caacccccactggctggggcttggctataggccatcagcgcatgcgcggaacctttgtgtctcctctgccgatccatact
gcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataactctgtcgtcctctc
tcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcc
cgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccag
ccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttc
acctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FM199974_P_P-A Feature FT:CDS FM199974_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccgt
ggactcataaggtgggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcagactccttcc
tttcctaaaatccatttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctaacagcactaaatatttacctctagacaaagggattaagcctt
attatccagatcaagtagttaatcattacttccagacccgacattatttacatactctctggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagactgggacttcaaccccaccaaggaccactggccacaagccaatcaggt
aggagtgggagcattcggcccagggttcactcccccacacggaggtgtcttggggtggagccctcaggctcagggcaaat
tggctactttgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccamagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatatcgtcaatct
cctcgaggactggggaccctgcttcgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
ctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattaccagggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggcttttagctatatggatgatgtggtattgggggccaaa
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaacttcatgggwtatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaatcgacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttatcctgctttaatgcctttgtatgcatgtatacaagcaaaaca
ggcttttactttctcgccaacttacaaggcctttctaaatacacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaactcccactggctggggcttggctatmggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagcaggtctggagcgaaactcat
agggactgacaattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctak
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FM199976_P_P-A Feature FT:CDS FM199976_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggyaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcagactccttcc
tttcctaaaatccatttacatgaggacattattaatagatgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctaacagtactaaatatttgcctctagacaaagggattaaacctt
attatccagatcaagtagttaatcattacttccagacccgacattatttacatactctctggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctatctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagactgggacttcaaccccaccaaggaccactggccacaagccaaccaggt
aggagtgggagcattcggcccagggttcactcccccacacggaggtgtcttggggtggagccctcaggctcagggcatat
tggctactttgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacct
ctaagagacagtcatcctcaggccrtgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtatcttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcttcgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagacttgtggtggacttctctcaattttctaggggg
ctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaacttcatgggatatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaatcgacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttatcctgccttaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaaaggcgcaatatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaactcccactggctggggcttggctataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcgaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FM199977_P_P-A Feature FT:CDS FM199977_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggacgcataaggtgggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcc
tttcctaaaatccatttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctaacagtactaaatatttgcctctagacaaagggattaaacctt
attatccagatcaagtagttaatcattacttccagacccgacattatttacataccctctggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggr
catcaaaacctcgcaaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccgatcatcaattggac
cctgcattcggagccaattcaaacaatccagactgggacttcaaccccaccaaggaccactggccacaagccaaccaggt
aggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggctactttgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcttcgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
ctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattaccarggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatwcatttaaaccctaacaa
aacaaagagatggggttattccctaaacttcatgggataygtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaatcgacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttatcctgccttaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaaatacacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaactcccactggctggggcttggctataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaattggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctat
cgtccccttctccgtctgccgttccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FM199978_P_P-A Feature FT:CDS FM199978_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcc
tttcctaaaatccatttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctaacagtactaaatatttgcctctagacaaagggattaaacctt
attatccagatcaagtagttaatcattacttccagacccgacattatttacatactctctggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagactgggacttcaaccccaccaaggaccactggccacaagccaaccaggt
aggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggctactttgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcttcgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
ctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccmattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaacttcatgggatatgtaattggaagttggggtacattaccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaatcgacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttatcctgccttaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaaatacacagtatatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaactcccactggctggggcttggctataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctat
cgtccccttctccgtctaccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FM199979_P_P-A Feature FT:CDS FM199979_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactggcctttattcctctactgttcctatctttaatcctgaatggcaaactccttcc
tttcctaaaatccatttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctaatagtactaaatatttgcctctagacaaagggattaaacctt
attatccagatcaagtagttaatcattacttccagacccgacattatttacataccctctggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagactgggacttcaaccccaccaaggaccactggccacaagccaaccaggt
aggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggctactttgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaacaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcttcgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
ctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagaggtggggttactccctaaacttcatgggatatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaatcgacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttatcctgccttaatgcctttgtatgcatgtatacaagcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaaatacacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaactcccactggctggggcttggctatcggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcgtttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FM199980_P_P-A Feature FT:CDS FM199980_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcc
tttcctaaaatccatttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctaacagtactaaatatttgcctctagacaaagggattaaacctt
attatccagatcaagtagttaatcattacttccagacccgacattatttacataccctctggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaattcaaacaatccagactgggacttcaaccccaccaaggaccactggccacaagccaaccaggt
aggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggctactttgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcttcgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
ctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcamctctatgtttccctcatgttgctgtacaaaacytacggctggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaacttcatgggatatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaatcgacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttatcctgccttaatgcctttgtatgcatgtatacaatcgaaaca
ggcttttactttctcgccaacttacaaggcctttctaaatacacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaactcccactggctggggcttggctataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagctgcctgttttgctcgcagcaggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctccaggggcckcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FM199981_P_P-A Feature FT:CDS FM199981_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccrcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtccctatcttcaatcctgattggcaaactccttcc
tttcctaaaatccatttacatgaggacattattaayaggtgtcagcaatttgtaggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctaacagtactaaatatttgcctctagacaaagggattaaacctt
attatccagatcaagtagttaatcattacttccagacccgacattatttacatactctctggaaggctgggattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacmtcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccgatcatcaattggac
cctgcattcggagccaattcaaacaatccagactgggacctcaaccccaccaaggaccactggccacaatccaaccaggt
aggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatat
tggctactttgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcacatatcgtcaatct
cctcgaggactggggaccctgcttcgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
ctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattaccaaggtatrttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgcagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaagagatggggttattccctaaacttcatgggatatgtaattggaagttggggtacattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaatcgacctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggttatcctgccttaatgcctttgtatgcatgtatacaagcaaaaca
ggcttttactttctcgccaacttacaaggcctttctaaatacacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaactcccactggctggggcttggctataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcaaacctcat
cgggacrgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctccaggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FN545825_P_P-A Feature FT:CDS FN545825_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagawctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtacctatctttaatcaggaatggcaaactccttct
tttcctaagattcatttacatgaggacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaaaag
aagattgaaattaattatgcctgctagattttatcctaacagcaccaaatatttgcccttagacaaagggattaaacctt
attatcctgatcatatagttaatcattacttccaggctcgacattatttacatactctttggaaggctggtattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
taccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
ccggcattcggagccaactcaaacaagccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcaggctcagggcatat
tgaccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatacagtggaattccacaactttccaccaagctctgcaagatcccagagtaagggg
cctgtatcttcctgctggtggctccagttcaggaacagtaacccctgttccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaaraatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
agcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattgtcaaggtatgttgcccgtctgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggcatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggatcattgccacaggatcatattg
tacaaaaacttaaacactgttttcgcaaacttcccgttaacagacctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgccgctccatttactcaatgtggataccctgccttaawgcctttgtatgcatgtatacacgctaaaca
ggcttttactttctcgccaacttacaaggcctttctacgtaaacagtacatgaacctttaccccgttgcccggcaacggc
caggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacttcctttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgcttgggtctgtat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FN545826_P_P-A Feature FT:CDS FN545826_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcctctactgtacctatctttaatcctgaatggcaaactccttct
tttcctaagatacatttacatgaggacattattaataggtgtcagcaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcccgctagattctatcctaacagtacaaaatatttgcccttagacaaaggaattaaacctt
attatcctgatcaggtagttaatcattacttccagacccgtcattatttacatactctgtggaaggctggtattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttgga
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaatcaggt
aggagtgggagcatttgggccagggytcacccctccacacggaggtattctggggtggagccctcaggctcagggcatat
tgactacagtgccaacagttcctcctcctgcctccaccaatcggcagtcaggaaggcagccgactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaacatggagaacatcacatcaggattcctaagacccctgctcgggttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgccttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctcaaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacgaccagtacaggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgytgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggttttgggggccaag
tctgtacaacatcttgagtccctttttaccgctgtwaccaattttcttttgtctttgggtatacatttaaatacaaacaa
aacaaaaagatggggttattctctaaacttcatgggatacataattggaagttggggatcattaccacaggatcatattg
tacgaaaaattagacaatgttttagactacttcctgttaataggcctattgattggaaagtgtgtcaaagaattgtgggt
cttttgggctttgccgctccctttacacaatgtggctatcctgcattaatgcctttgtatgcatgtatacaaactaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttatggctcctctgccgatccatactgcggaactcctcgcagcttgttttgctcgcagccggtctggagcacaactcat
cgggactgataattctgtcgtcctctctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|FN545828_P_P-A Feature FT:CDS FN545828_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagggacccaggccggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaatcttactgggctttattcttctactgtacctatctttaatcctgaatggcaaactccttct
tttccaaagattcatttacacgaggacattattaatagatgtcaacaattcgtgggccctctcaccgtaaatgaaaagag
aagattaaaattaattatgcctgctagattttatcctaatagcaccaaatatttgcccctagacaaagggattaaacctt
attatcctgaacatatagttaatcattactttcaggcccaacattatttgcatactctttggaaggctggtattctatat
aagagggaaactacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagtgctacctcatgggaggttggt
tgccaaaacctcgcaaaggcatggggacgaatctgtctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggt
aggagtgggagcatttgggccaggrttcacccctccacacggcggtgttctggggtggagccctcaggctcagggcatac
tgacaacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctacaagatcccagggtcagggg
cctgtatttccctgctggtggctccaattcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggg
rtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctg
ctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcatcatgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcytggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacagcatcttgactccctttttaccgctgttaccaattttcttttgtctttgggcatacatttaaaccctaacaa
aaccaaaagatggggttattccctaaacttcatgggatacataattggaagttggggatcactgccacaggctcatattg
tacaaaaaatcaaacattgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatacccggccttaatgcctttgtatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctacgtaaccagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttcgcggaaatatacatcctttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgcttgggcctctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FN545829_P_P-A Feature FT:CDS FN545829_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgagctcggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtacctatctttaatcctgaatggcaaactccttct
tttccaaagattcatttacatgaggacattattaatagatgtcaacaattcgtgggccctctcaccgtaaatgaaaagag
aagattgaaattaattatgcccgctagattttatcctaacagcaccaaatatttgcccctagacaaagggattaaacctt
attatcctgaacatgtagttaatcattactttcaggcccaacattatttgcatactctttggaaggctggtattctatat
aagagggaaactacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
tgccaaaacctcgcaaaggcatggggacgaatctttcggttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccaacaaggaccactggtcacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggcggtgttctggggtggagccctcaggctcagggcatat
tgacaacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcttcctcaggccatacagtggaattccacaactttccaccaagctctgcaggatcccaaggtcagggg
cctgtatttccctgctggtggctccaattcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctg
ctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgttcccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggcatacatttaaaccctaacaa
aaccaaaagatggggttattccctaaacttcatgggatacataattggaagttggggatcactgccacaggctcatattg
tacaaaaaatcaaacattgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatacccggccttaatgcctttatatgcatgtatacaagctaaaca
ggcttttactttctcaccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggt
ctggtctgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagcrgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttcgcggaaatatacatcctttccatggctgctaggctgtactgccaactggattc
ttcgmgggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccctctcggggccgcttgggcctctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttcaca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FN545830_P_P-A Feature FT:CDS FN545830_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagggaccgaggtcggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcatcaggtgggaaattttactgggctttattcttctactgtacctatctttaatcctgaatggcaaactccttct
tttccaaagattcatttacatgaggacattattaatagatgycaacaattygtgggccctctcaccgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctaacagcactaaatatttgcccctagacaaagggattaaacctt
attatcctgaacatgtagttaatcattactttcaggcccgacattatttgcatactctttggaaggctggtattctatat
aagagggaaactacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttcgt
tgccaaaacctcgcaaaggcatggggacgaatctttctgttccaaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccaccaaggaccactggtcacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggcggtgttctggggtggagccctcaggctcagggcatat
tgacaacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccayccagtggmattccacaactttccaccaagctctgcaagatcccagggtcagggg
cctgtatttacctgctggtggctccaattcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggaytcctaggacmcctgctcgtgttacaggcg
ggatttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcatggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctg
ctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacgaccaccagyacgggaccctgccgaacctg
cacgactcctgctcaaggcaactctatgtttccctcctgttgttgtacaaaacctacggacggaaattgcacctgtattc
ccatcccctcatcatgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaaa
tctgtacaacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggcatacatttaaaccctaacaa
aaccaaaagatggggttattccctaaacttcatgggatacacaattggcagttggggatcactgccacaggctcatattg
tccaaaaaatcaaacattgttttaggaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatacccggccttaatgcctttatatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctacgtgaacaatatatgaacctttaccccgttgcccggcaacggt
ctggtctgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaacmctcat
cgggactgataattctgtcgtcctttcacggaaatatacatcctttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggcctatat
cgtccccttctccgtctgccgtatcgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FN545831_P_P-A Feature FT:CDS FN545831_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtgcctagctttaattctgaatggcaaactccttct
tttcctaagattcatttacatgaggacattattaatagatgtcaacaatttgtgggccctcttactgtaaatgaaaaaag
aagattgaaattgattatgcctgctagattctatcctaacagcaccaaatatttgcccctacacaaaggaattaaacctt
attatcctgatcagatagttaatcattactttcaggcccgacattatttacatactctttggaaggctggtattctatat
aagagggaaaccactcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttgga
tatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatat
tgactacagtgccagcagttcctcctcctgcctccgccaatcggcagtcaggaaggcagcctacacccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagcacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggcatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtaattggaagttggggatcattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgttaaccggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatggacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgttgtcctttctcggaaatatacatcctttccatggctgctaggctgtactgccaactggattc
ttcgcggaacgtcctttgtttacgtcccgtcgacgctgaatcccgcggacgacccctctcggggccgcttggggctctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FN545832_P_P-A Feature FT:CDS FN545832_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaygmagggaccgaggtcggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctmaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtacctatctttaatcctgaatggcaaactccttct
tttccaaagattcatttacatgaggacattattaataggtgtcaacaattcgtgggccctctcaacaaaaatgaaaagag
aagattaaaattaattatgcctgctagattttatcctaacagcaccaaatatttgcccctagacaaagggattaaacctt
attatcctgaacatgtagttaatcattactttcaggcccaacattatttgcatactctttggaaggctggtattctatat
argagggaaactacacgtagcgcatcattttgcgggtcaccatatwcttgggaacaagagctacatcatgggaggttggt
tgccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccaycaaggaccactggccacaggccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggcggtgttctggggtggagccctcaggctcagggcatat
tgacaacagtgccagcagttcctcctcctgcctccaccaatcggaggtcaggaaggcagcctactcccatttctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctgcaagatcccagggtcagggg
cctgtatttccctgctggtggctccaattcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgcccgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggg
awcacacgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtatctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctg
ctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgttgtataaaacctacggacggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggcatacatttaaaccctaacaa
aaccaaaagatggggttattccctaaacttcatgggatacataattggaagttggggatcactgccacaggatcatattg
tacaaaaaatcaracattgttttaggaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatacccggccttaatgccgttgtatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggt
ctggtctgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggggcaaacctcat
cgggactgataattctgtcgtcctttcgaggaaatatacatcctttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggcctctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FN545833_P_P-A Feature FT:CDS FN545833_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcacaaggtgggaaattttrcggggctttattcttctactgtacctatctttaatcctgaatggcaaactccttct
tttccaaagattcatttacatgaggacattattaatagatgtgaacaattcgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctaacagcaccaaatatttgcccctagacaaagggatcaaacctt
attatcctgaacatgtagttaatcattactttcaggcccgacattatttgcatactctgtggaaggctggtattttatat
aagagggaaactacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttcgt
taccaaaacctcgcaaaggcatggggacgaatctttctgtgcccaaccctctgggattttttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacgtcaaccccttcaaggatcactggccacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcacat
tgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacactcatcctcaggccattcagtggaattccacaactttccaccaagctctgcaagatcccagggtcagggg
cctgtatctccctgctggtggctccaattcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctrctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccrcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctg
ctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcctgttgttgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcrtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacagcaccttgagtccctttataccgctgttaccaattttcttttgtctttgggcatacatttaaaccctagcaa
aaccaaaagatggggttattccctaaacttcatgggatacataattggcagttggggatcactaccacaggatcatattg
tacataaaatcaaacattgttttagaaaacttcctgttaacaggcctattgattggaaagtctgtcaaagaattgtgggt
cttttgggcttcgctgctccatttacacaatgtggatacccagccttaatgcctttgtatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctacgtaaccagtatatgaacctttaccccgttgcccggcaacggt
ctggtctgtgccaagtatttgctgacgcaacacccactggttggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggggcaaaactcat
cgggactgacaattctgtcgtcctttcccggaaatatacatcatttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggcctctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
cctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FN545834_P_P-A Feature FT:CDS FN545834_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
gcactcataaggtgggaaattttacggggctttattcttctactgtacctatctttaatcctgaatggcaaactccttct
tttccaaagattcatttacatgaggacattattaatagatgtgaacaattcgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctaacagcaccaaatatttgcccctagacaaagggatcaaacctt
attatcctgaacatgtagttaatcattactttcaggcccgacattatttgcatactctgtggaaggctggtattttatat
aagagggaaactacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggtycgt
taymaaaacctcgcaaaggcatggggacgaatctttctgtgcccaaccctctgggattttttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacgtcaaccccttcaaggatcactggccacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatac
tgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacgcccatctctccacct
ctaagagacactcatcctcaggccattcagtggaattccacaactttccaccaagctctgcaagatcccagggtcagggg
cctgtatctccctgctggtggctccaattcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctrctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttrttggttctg
ctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcctgttgttgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaratwcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacagcaycttgagtccctttataccgctgttaccaattttcttttgtctttgggcatacatttaaaccctagcaa
aaccaaaagatggggttattccctaaacttcatgggatacataattggcagttggggatcactaccacaggatcatattg
tacataaaatcaaacattgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggcttcgctgctccatttacacaatgtggatacccagccttaatgcctttgtatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggt
ctggtctgtgccaagtatttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggggcaaaactcat
cgggactgacaattctgtcgtcctttcacggaaatatacatcatttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggcctctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
yctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FN545835_P_P-A Feature FT:CDS FN545835_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggccggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtacctatctttaatcctgaatggcaaactccttct
tttccaaagattcatttacacgaggacattattaatagatgtcaacaattcgtgggccctctcaccgtaaatgaaaagag
aagattaaaattaattatgcctgctagattttatcctaatagcaccaaatatttgcccctagacaaagggattaaacctt
attatcctgaacatgtagttaatcattactttcaggcccaacattatttgcatactctttggaaggctggtattctatat
aagagggaaactacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
tgccaaaacctcgcaaaggcatggggacgaatctgtctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggcggtgttctggggtggagccctcaggctcagggyatac
tgacaacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcartggaattccacaactttccaccaagctctacaagatcccagggtcagggg
cctgtatttccctgctggtggctccaattcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctg
ctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcatcatgggctttcgcaaaatacctatgggggtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggcatacatttaaaccctaacaa
aaccaaaagatggggttattccctaaacttcatgggatacataattggaagttggggatcactgccacaggctcatattg
tacaaaaaatcaaacattgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatacccggccttaatgcctttgtatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacycccactggttggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaactcat
cgggactgataattctgtcgtcctttcgcggaaatatacatcctttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggcctctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FN545836_P_P-A Feature FT:CDS FN545836_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtgcctaactttaatcctgaatggcagactccttct
tttcctaagattcatttacatgaggacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattgattatgcctgctagattctatcctaacagcaccaaatatttgcccctacacaaaggaattaaacctt
attatcctgatcaaatagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacgcgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttgga
tagcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatat
tgactacagtgccagcagttcctcctcctgcctccgccaatcggcagtcaggaaggcagcctacacccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctacaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
agcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
cwggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaactaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatatgtaattggaagttggggatcattgccacaggatcatattg
tacaaaaaatcaaacactgttttagaaaacttcctgtcaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaaactagaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatggacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaactcat
cgggactgataattctgtcgtcctttcacggaaatatacatcatttccatggctgctaggctgtactgccaactggattc
ttcgcggaacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FN545837_P_P-A Feature FT:CDS FN545837_P_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggtcggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtacctatctttaatcctgaatggcaaactccttct
tttccaaagattcatttacatgaggacattattaatagatgtcaacaatwcgtgggccctctcaccgtaaatgaaaagag
aagattgaaattaattatgcctgctaggttttatcctaacagcaccaaatatttgcccctagacaaagggattaaacctt
attatcctgatcaggtagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtrtyttatat
aagagagagacaacccatagcgcctcattctttgggtcaccatattcctgggaacaagatctacatcatgggaggttggt
tgccaaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggat
ccagcattcggagccaactcaaacmatccagattgggacttcaaccccatcaaggaccactggccaaaagccaaycaggt
aggagtgggagcatttggrccmgggytcacccctccacacggmggtgttctggggtggagccctcaggctcagggcatat
tgacaacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatccagtggagttccacaacttcccaccaagctctgcaagatcccagggtcagggg
ccctgctggtggctccaattcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgarga
ctggggaccctgcaccgaccatggagaacaycacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgt
gtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggamcctgcaaaacctgcacgactcc
tgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgtt
cagtggtycgtagggctttcccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaa
catcttgagtccctttttaccgctgttaccaattttcttttgtctttgggcatacatttaaaccctaacaaaaccaaaag
atggggttattccctaaacttcatgggatacataattggaagttggggatcactgccacaggatcatattgtacaaaaaa
tcaaacattgttttagaaaacttcctgttaacagacctattgattggaaagtgtgtcaaagaattgtgggtcttttgggc
tttgccgctccctttacacaatgtggatacccggccttaatgcctttgtatgcatgtatacaagctaaacaggcttttac
tttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgt
gccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggct
cctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcgggactga
taattctgtcgtcctttctcggaaatatacatcctttccatggctgctaggctgtactgccaactggattcttcgcggga
cgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtcccctt
ctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|FN545838_P_P-A Feature FT:CDS FN545838_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagactacggaaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtggggaattttactgggctttattcttctaccgtacctatctttaatcctgaatggcaaactccttct
tttcccaagattcatttacatgaggacattattaatagatgtcaacaatttgtaggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctaacagcaccaaatatttgccacttgacaaaggaattaaacctt
attatcctgatcatgtagttaatcattacttccaggcccgacattatttacataccctttggaaggctggtattctatat
aagagggaaactacacgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
taccaaaacctcgcaaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggactacaaccccatcaaggaccactggccacaagccaatcaggt
aggagtgggagcattcgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatat
cgactaccgtgccagcagttcctcctcctgcctccaccaatcggcagtcagggaggcagcctactcccatctctccacct
ctaagagacagtcatccgcaggccatgcagtggaattccacagmtttccaccaagctctgrmagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaagccctgttccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggg
agcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctg
ctggattgtcaaggtatgttgcccgtttgtcctccaattccaggatccacaacaaccagcacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggttttgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggyatacatttaaaccctaacaa
aacmaaaagatggggttattccctaaacttcatgggctacataattggatgttggggaacattaccacaagatcatattg
ttcacaaactcaaagattgttttagaaaacttcctgttaacagacctattgattggaaagtatgtcaacgcattgtgggt
cttttgggctttgccgctccatttacacaatgtggttaccctgctttaatgcctctgtacgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctatgccaagtgtttgctgacgcaacccccactggctggggcttggccatgggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcat
cgggactgataattctgtcgtcctttcccggaaatatacatcatttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggcgaccaccgtga
>gnl|hbvcds|FN545840_P_P-A Feature FT:CDS FN545840_P_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=2526 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggtcggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcataaggtgggaaattttactgggctttattcttctactgtacctatctttaatcctaaatggcaaactccttct
tttccaaagattcatttacatgaggacattattaatagatgtcaacaattcgtgggccctctcaccgcaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctaacagcaccaaatatttgcccctagacaaagggattaaacctt
attatcctgaacatgtagttaatcattactttcaggcccaacattatttgcatactctttggaaggctggtattctatat
aagagggaaactacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagakctacatcatgggaggttggt
tgccaaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaatcccaccaaggaccactggtcacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggcggtgttctggggtggagccctcaggctcagggcatat
tgacaacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaacaagctctgcaagatcccagggtcagggg
tgctggtggctccaattcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgaggactg
gggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttg
ttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggcccacccgtgtg
tcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctgga
tgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggtgctgctggattgtcaa
ggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgc
tcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcat
cctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcag
tggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcac
cttgaatccctttttactgctgttaccaattttcttttgtctttgggcatacatttaaaccctaacaaaaccaaaaggtg
gggttattccctaaacttcatgggatacataattggaagttggggatcactgccacaggatcatattgtacaaaaaatca
aacattgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggcttt
gctgctccatttacacaatgtggatacccggccttaatgcctttatatgcatgtatacaagctaaacaggcttttacttt
ctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccctgttgcccggcaacggtctggtctgtgcc
aagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcct
ctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataa
ttctgtcgtcctttcgcggaaatatacatcctttccatggctgctaggctgtactgccaactggattcttcgcgggacgt
cctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggcctctatcgtccccttctc
cgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccg
tgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|GQ161813_P_P-A Feature FT:CDS GQ161813_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GU1021). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggacacataaggtgggaaattttactgggctttattcctctactgtacctatctttaatcctgaatggcaaactcctact
tttcccaagattcatttacatgaggacattgttaataggtgtcaacaatttgtgggtcctctcacagtaaatgaaaaaag
aagattaaaattgattatgcctgctagattctatcctaacagtacgaaatatttgcccctagacaaaggaattaaacctt
attatcctgatcatgtagttaatcattacttccagacccgacattatttacatactctttggaaggctggtattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggt
taccaaaacctcgcaaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaacacaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatat
tgactactgtgccagcagttcctcctcctgctgccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaactccacagctttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattc
ccatcccatcatcatgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggatcattgccacaggatcatattg
tacaaaaaatcaaaaattgttttagaaaacttcctattaataggcctattgattggaaagtatgtcaaagaattgtgggt
ctgttgggctttgcagctccctttacacaatgtggataccctgccttaatgcctttgtatgcgtgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatgtgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccattggccatcagcgcatgcgcggaacc
tttgtggctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaactcat
tgggactgataattctgtcgtcctctctcggaaatatacctcctttccatggctgctaggctgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
cctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|GQ184323_P_P-A Feature FT:CDS GQ184323_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1121). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgccattagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattacactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggactttcttccattgtctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactcccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcgggcccgcctgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|GQ184324_P_P-A Feature FT:CDS GQ184324_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1122). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgccattagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctccgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccacgcagtggaattacactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctttttggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgacttctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcctgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|GQ331046_P_P-A Feature FT:CDS GQ331046_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-188). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattctactactgtacctacctttaatcctgattggcaaactccttct
tttcctaagattcatttacatgaggacattattaatagatgtcaacaatttgtaggccctcttactgtaaatgaaaaaag
aagattgaagttaattatgcctgctaggttctatcctaccagcactaaatatttgcccctagacaaaggaattaaacctt
attatccaaatcaggtagttaatcattacttccaggctcaacattatttacatactctttggaaggctggtattctatat
aagagggaatctacacgtagcgcctcattctgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaactcctcgcaaaggcatggggacaaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccaaaagccaaccaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcaggctcagggtctat
tgaccacgctgccaaaggttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccgtgcagtgggagtccacaaccttccaccaagctctgcaagatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgttcagaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaaaaatcctcacaataccgcagagtctcgactcgtggtggacttctctcaattttctaggggg
accacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatctgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggtactt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggaaccacaacaaccagtacgggaccctgcagaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtactgggggccaag
tctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatctaaaccctaacaa
aacaaagagatggggttactccctaaatttcatgggatatgtaattggaagttggggaactttaccacaggatcatattg
tacaaaaaatcaaacaatgttttagaaaacttcccgttaacaggcctattgattggaaggtatgtcaacgaattgtgggt
cttttgggctttgccgctccttttacacaatgtggataccctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttttcgccaacttacaaggcctttctaagtcaacaatatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggcgattggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcttttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|GQ331047_P_P-A Feature FT:CDS GQ331047_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-56). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcaaaagatctcaatctcgggaatcccaatgttagtatccctt
ggactcataaggtgggaaattttactgggctttattctactactgtacctacctttaatcctgattggcaaactccttct
tttcctaagattcatttacatgaggacattattaataggtgtcaacattttgtgggccctcttactgtaaatgaaaaaag
aagattgaaattaattatgcctgctaggttctatcctaccagcactaaatatttgcccctagacaaagggattaaaccct
attatccagatcaggtagttaatcattacttccagactcgacattatttacatactctttggaaggctggtattctatat
aagagggaaactacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaacacctcgcataggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcaggctcagggcatat
tgaccacagtgccaaaggttcctcctcctgcctcgaccaatcggcagtcaggaaggcagccgactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccacaaccttccaccaagctctgcaagatcccagagtcagggg
cctgtattttcctgctggtggctccagttcaggaacagtaaaccctgttcagaatattgcctctcacatctcgtcaatct
cctcgaggactggggaccctgtaccgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctcgactcgtggtggacttctctcaattttctaggggg
atcacccgcgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggtactt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggaaccacaacaaccagtacgggaccctgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaag
tctgtacaacatcttgagtccctttataccgctattaccaattttcttttgtctttgggtatacatctaaaccctaacaa
aacaaagagatggggttactccctaaacttcatgggatatgtaattggaagttggggaacattaccacaggatcatattg
cacaaaaacttaaacactgttttagaaaacttcctgttaataggcctattgattggaaggtatgtcaacgaattgtgggt
cttttgggctttgccgctccttttacacaatgtggataccctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgatgcaacccccactggctggggcttggccattggccatcagcgcatgcgcggaacc
tttgcggctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagcaggtctggagcaaaactcat
cgggactgataattctgtcgtcctttctcggaaatatacatcttttccatggctgctaggttgtactgccaactggattc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggtcgcttgggactctat
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|GQ414522_P_P-A Feature FT:CDS GQ414522_P_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcatctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagcaaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgcccggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggcaataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagcttat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|GQ477461_P_P-A Feature FT:CDS GQ477461_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P3). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|GQ477462_P_P-A Feature FT:CDS GQ477462_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P4). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgttagtattcctt
ggactcacaaggtgggaaactttactgggctttattcatctacagtacctatctttaatcctgaatggcaaactccttca
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaggag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaagccagacattatttagagactctttggaaggctggtattctatat
aagagggaatccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggcattttggggtggagccctcaggctcagggcatat
tgacaacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
gtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgcttgatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggttttgggggccaag
tctgtacaacatcgtgaagccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctgacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattaccacaggatcatatag
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggg
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaagca
ggctttcactttctcgccaacttacaaggcctttctaagtaatcagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagatcat
cggaactgacaattctgtcgtcctttcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|GQ477463_P_P-A Feature FT:CDS GQ477463_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P5). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaactcttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctaaagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggatattattaataggtgtgaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaactaattatgcctgctagattctatcctaaccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttcaaagccagacagtatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccaggactcacccctccacacggcggtatattggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggcaatgcagtggaactccactgccttccaccaagctctgcaagatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggga
agcacccgtgtgtcttggccaaaattcgcagtccccaacctgcaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatatccctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactggtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttacatggatgatgtggtattgggggccaag
tctgtacaacatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggcagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctragtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgctttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactttat
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|GQ477464_P_P-A Feature FT:CDS GQ477464_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P8). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattcctt
ggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttct
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattttatcctacctacactaaatatttgcccttagacaaagggataaagcctt
attatccagatcatgtagttaatcattacttccaaacccgacattatttacatactctttgggaggctggtattctatat
aagagagaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatcaagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatttctccacct
ctaagagacactcatcctcaggccatgcagtggaattccactgctttccaccaagctctgcaaaatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcatctcacatatcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctcaaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggatacgtaattggtagttggggaacattgccacaggatcatattg
tacaaaaaatcaaaaactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgccgctccatttacacaatgtgggtaccctgcattaatgcccttatatgcatgtattcaagctaaaca
ggctttcactttctcgccaacttataaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctattggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cgggactgataattctgtcgtcctctctcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|GQ477465_P_P-A Feature FT:CDS GQ477465_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P10). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgtttgtagacgacgggtccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggtaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggcaatgcagtggaattccactgccttccaccaagctctgcaggatcccaaagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggcattcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtcaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
tggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctat
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|GQ477466_P_P-A Feature FT:CDS GQ477466_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P12). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgcaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctctggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccccccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttctcgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattaccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaagca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctttcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggatctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|GQ477467_P_P-A Feature FT:CDS GQ477467_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P14). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctacgagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggctttcactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|GQ477468_P_P-A Feature FT:CDS GQ477468_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P16). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctaaccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggg
atctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcagaacctg
cacgactcctgctcaaagcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttgaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|GQ477469_P_P-A Feature FT:CDS GQ477469_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P19). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaatccttccggaaactactgttattagacgacgggaccgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctaactttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgcaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctctggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagccacagcatgggaggttggt
catccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccccccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggcaatgcagtggaattccactgccttccaccaagctctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggg
aatacccgtgtgtcatggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctcaaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaaa
tctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaaaccctaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattaccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaagca
ggctttcactttctcgccaacttacaaggcctttctccgtcaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaagctcat
cggaactgacaattctgtcgtcctttcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctat
cgtccccttctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|GQ477470_P_P-A Feature FT:CDS GQ477470_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P20). Non-functional genomic sequence. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacatcattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggatttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttagggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatacagtggaattccactgccttccaccaagctctgcaggatcccaaagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttcgagggga
agcacccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgagtccctttataccgctgtaaccaattttcttttgtctctgggtatacatytaaaccccaacaa
aacaaaaagatggggttattccctaaacttcatgggttacataattggaagttggggaacattgccacaggatcatattg
tacaaaagatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggt
cttttgggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaaca
ggcttttactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggc
ctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacc
tttgtggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcat
cggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatcc
ttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctct
cgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctca
tctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|GQ477472_P_P-A Feature FT:CDS GQ477472_P_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P24). Complete genome. [Hepadnaviridae] (length=2538 residues).
atgcccctatcttatcaatacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctt
ggactcataaggtgggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcc
tttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaagag
aagattgaaattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaacctt
attatccagatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatat
aagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggt
catcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggac
cctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggt
aggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatat
tgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacct
ctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagatctgcaggatcccagagtcagggg
tctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcgtcaatct
ccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcg
gggtttttcttgttaacaagaatcctcacaataccgaagagtctagactcgtggtggacttctctcaattttctaggggg
atcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctg
gttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttctt
ctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctg
cacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattc
ccatcccatcgtcatgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtg
ccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaag
tctgtacagcatcgtgag