HBVdb

Dataset for nucleotide sequence Genomes of genotype A

[Download (right click)] [Alignment] [Repertoires]

982 sequence(s)

>gnl|hbvnuc|AB453980_FT00000_P-A Feature FT:source AB453980_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH2). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
ttacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatcttctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AM184126_FT00000_P-A Feature FT:source AM184126_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N35). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctacaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaagccctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgcacaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctatacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gctacatcattggatgttggggatcattgccacaagatcatattgttcacaaaatcaaagattgttttcgaaaacttcct
gttaatagacctattgattggaaagtatgtcaacgcattgtgggtcttttgggctttgccgctccattcacacaatgtgg
ataccctgctttaatgcctctgtacgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcttttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcacgcggacgacccctctcggggtcgcttgggactctatcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgagatctcctagataccg
cctcagctctatatcgggaagcactagagtctcctgagcattgctctcctcaccatacagcactcaggcaagccattctc
tgctggggggagttaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaatatgggcctaaagatcaggcaactgttgtggtttcatatttcttgccttacttttggaagagaaa
cggtacttgagtatttggtctcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
gggaattttactgggctttattcttctactgttcctatctttaatcctgaatggcaaactccttcttttcccaagattca
tttacatgaggacattattaatagatgtcaacaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctaacagcaccaaatatttgccacttgacaaagggattaaaccttattatcctgatcag
gtagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatataagagagaaactac
acgtagtgcttcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggttaccaaaacctcgc
aaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgactaccgtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tccgcaggccatgcagtggaa
>gnl|hbvnuc|EU859918_FT00000_P-A Feature FT:source EU859918_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P17). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594395_FT00000_P-A Feature FT:source EU594395_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagagatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccctggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ477475_FT00000_P-A Feature FT:source GQ477475_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P29). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagctatatggatgatgtggtattgggggccaagtctgtgcaacatcgtgaagccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtcaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgaggaaat
atacatcatttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtgccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttaggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactgcaatccggcaagtcgttcta
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatcaagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtaattgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagaccactaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctatccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagagaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttccgttcccaaccctctgggattctttcccgatcatcagttggaccccgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccaggactcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaagccatgcagtggaa
>gnl|hbvnuc|JQ707372_FT00000_P-A Feature FT:source JQ707372_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C11). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacagcaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtgttcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacagacctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707385_FT00000_P-A Feature FT:source JQ707385_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C33). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707644_FT00000_P-A Feature FT:source JQ707644_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C22). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactatgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KF214659_FT00000_P-A Feature FT:source KF214659_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2009-2). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccaccgctttccaccaaactctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaactattgcctctcacatctcgtcaatcttctcgaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtttgttgcccgtttgtcctct
aattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggaaactctatgtttccct
cctgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
gttatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtgtgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgccgggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagacacag
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggtgaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttcttttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcaccaaatatttgcctttagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagagaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagcaaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707387_FT00000_P-A Feature FT:source JQ707387_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C36). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatccttacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactcccgcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ843218_FT00000_P-A Feature FT:source KJ843218_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag63). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagcgctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattaccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgttcccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaatccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KT749842_FT00000_P-A Feature FT:source KT749842_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL4e). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggcctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatctagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctgtctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggagggctggtattctatataagagagaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KP718090_FT00000_P-A Feature FT:source KP718090_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1348). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagcgctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggtacattaccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctytgcctaatc
atctyttgtacatgtcccmctgttcmagcctycaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctcttactgtgaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagarggaatccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagacaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KT749831_FT00000_P-A Feature FT:source KT749831_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL8). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaggctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacgacctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactcttgctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaataccaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttcaaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatttctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KY382410_FT00000_P-A Feature FT:source KY382410_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A2_wt). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatattgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
tacyaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttytcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgccgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcayaaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattccttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagcccgcaggctcagggcatattgaccacagtgtca
acaaytcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859929_FT00000_P-A Feature FT:source EU859929_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P43). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ692584_FT00000_P-A Feature FT:source FJ692584_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50090). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
gttatgtaattggaagttggggtacattgccacaggagcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacctcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactaaaattaa
ttatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccccgcattcggagc
caattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaagtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgccg
gtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KU605539_FT00000_P-A Feature FT:source KU605539_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM4643F3). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccacagagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgtctctcacatctcgtcaatctcctcgacgactggggaccctgtgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
tcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaaccacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattccctaaactttatgg
gctatgtaattggaagttggggtacattaccacaggaccatattgtacaaaaaatcaaatgctgttttagaaaacttcct
gtcaatagacctatcgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgggatctacttgatacag
catcagctctgtatcgggaagccttagaatctccggagcattgctcccctcaccatacagcactcaggcaagccattcta
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatttagtagtcaa
ttatgttaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttagtctctttcggagtgtggatacgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
gggaattttactgggctttattcctctactgtccctaattttaatcctcaatggcaaactccttcctttcctaaaattca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcccgctagattttatcctaacagcactaaatacttgcctctagacaaaggaattaaaccttattatcctgatcaa
gtagttaatcattacttccagaccagacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttccaaaccctctgggattccttcccgatcatcaactggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacattgcca
acagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JN182323_FT00000_P-A Feature FT:source JN182323_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cattcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgtcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccactgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggttcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaactgcct
gtcaatcgacctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggacatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagaccgtgtgtttaaagactgggaggagttgggggaggagactaggtta
aaggtctttgtattaggaggctgtaggcataaattggtnnnnnnnnnnnnnnnnnnnnnctttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctacttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaactaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctcctacggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcttttccgaaaatcca
tttacacgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattatttccagacccgacattatttgcatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggttaccaaaacctcgc
aagggcatggggacgaatctttctgtccccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccggggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagcca
tcctcaggcaatgcagtggaa
>gnl|hbvnuc|JQ707556_FT00000_P-A Feature FT:source JQ707556_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C35). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875257_FT00000_P-A Feature FT:source KC875257_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV14). Complete genome. [Hepadnaviridae] (length=3218 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagcacgggaccctgcaaaacctgcatgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
gttatgtaattggaagttggggtacattgccacaggatcatattgtacaaagaatcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgagggacgtcctttgtttacgtcccgtcagcg
ctgaatcccccggacgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccgtcaggtcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgaatctagctacctgggcgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccgccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttcttttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctaggttttatcctaacagaacaaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaacgccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggcacagggcatattggccacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtg
>gnl|hbvnuc|GQ477464_FT00000_P-A Feature FT:source GQ477464_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P8). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgctttccaccaagctctgcaaaatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcatctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctcaaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatacgtaattggtagttggggaacattgccacaggatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
gtaccctgcattaatgcccttatatgcatgtattcaagctaaacaggctttcactttctcgccaacttataaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcgggactgataattctgtcgtcctctctcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccttgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgcctcttgacttctttccttcagtccgagatctcctggacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctgggtggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatctcttgcattacttttggaagagaaa
ctgtacttgagtatttagtctctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcttttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacctacactaaatatttgcccttagacaaagggataaagccttattatccagatcat
gtagttaatcattacttccaaacccgacattatttacatactctttgggaggctggtattctatataagagagaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatcaagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatttctccacctctaagagacactca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707655_FT00000_P-A Feature FT:source JQ707655_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C41). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccgtctgatttctttccttccgtcagagagctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KP718085_FT00000_P-A Feature FT:source KP718085_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-12-1-26). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggctattccctgaatttcatgg
ggtatgtaattggaagttggggtacattgcctcaggatcatattatacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtgtgtcagaraattgtgggtcttttgggctttgcagctccatttacacaatgtgg
ttatcctgcattaatgcctttgtatgcatgcatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaractcatcgggactgataattctgtcgtcctctcgcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggamgamccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgatttctttccttccgtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcaccgcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaaccctgaatggcaaactccttcttttcctaaaattca
tttacatgaagatgttgctaacaggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctaggttctatcctaacagcactaaatatttgcctctagacaaggggattaaaccttattatcctgatcat
gtagttaatcattactttcaaaccagacattatttacatactctttggaaagctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggatcctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagaracagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859937_FT00000_P-A Feature FT:source EU859937_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C40). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctctgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctcgccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FM199981_FT00000_P-A Feature FT:source FM199981_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatatcgtcaatctcctcgaggactggggaccctgcttcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatrttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taaatacacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaacctcatcgggacrgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctscctaatc
atctcttgtacatgtcccactgttcaagcctcctagctgtgccttggrtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctctrtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgwctctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttgccttacttttggaagagaca
ctgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccrcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctatcttcaatcctgattggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaayaggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagtactaaatatttgcctctagacaaagggattaaaccttattatccagatcaa
gtagttaatcattacttccagacccgacattatttacatactctctggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacmtcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccgatcatcaattggaccctgcattcggagc
caattcaaacaatccagactgggacctcaaccccaccaaggaccactggccacaatccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctactttgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707363_FT00000_P-A Feature FT:source JQ707363_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C4). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatttggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctacacttcatgg
gttacgtaattggaagttggggaacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacctcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttccagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactttcgtttttgccttctgacttctttccttccgtcagagatctcctggacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggacccggcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccacgcagtggaa
>gnl|hbvnuc|FJ692607_FT00000_P-A Feature FT:source FJ692607_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50068). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcacagaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttytatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggatcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtacacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcttttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggtctctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagctactgtggagttactctcttttttgcctgctgacttctttccttccgtacgagatctcctagataccg
cctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccatacta
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatcccgcatccagggatctagtagtcaa
ttatgtcaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacctttggaagagaaa
ttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaggagaccgaggcaggtcccttagaagacgaactccctcgcctcgcag
acgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtgcctagctttaaccctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattga
ttatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaaccttattatcctgatcag
atagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatataagagggaaaccac
tcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggatatcaacacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccacatcaaggaccactggccacaagccaatcaggtgggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgactacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacccatctctccacctctcagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ477461_FT00000_P-A Feature FT:source GQ477461_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P3). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MF772351_FT00000_P-A Feature FT:source MF772351_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1141). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggctattccctaaatttcatgg
ggtatataattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtgtgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaatcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcgtttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatctgatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcaccgcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagatattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctaggttctatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaaccagacattatttacatactctttggaaggaggggattctatataagagagaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
acaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccattggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB697498_FT00000_P-A Feature FT:source AB697498_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No15). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgcttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgykcaccagcaccatgcaactttttcacctctgcctaatc
atctcktgtwcatgtccyactgttcaagcctccaagctgtgccttgggtggctttgggrcatggacattgacccktataa
agaatttggagctwctgtggagttactctcktttttgccttctgacttctttccktcygtymgagatctyctmgacaccg
cctcwgctctgtatcgrgargccttagagtctcckgarcattgytcacctcaccatacwgcactcaggcaagcyattcts
tgytggggkgarttgatgamtctrgcyacctgggtgggwartaatttggaagaycmagcatccagggayytagtagtcar
ytatgtyaatrytaayatgggywtaaaratcagrcaactattgtggtttcayatwtcttgycttacttttggaagagara
ctgtwcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594385_FT00000_P-A Feature FT:source EU594385_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagctatatggatgatatggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccattggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707313_FT00000_P-A Feature FT:source JQ707313_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C23). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttgggggacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcttttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatcttctggacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactggactttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcagaaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707560_FT00000_P-A Feature FT:source JQ707560_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C40). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcgcgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctaccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aagatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707585_FT00000_P-A Feature FT:source JQ707585_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C23). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaagggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggggtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcctttagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
tactaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgtttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttccccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MT114170_FT00000_P-A Feature FT:source MT114170_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 076). Complete genome. [Riboviria] (length=3221 residues).
ttccaccgctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctccagttcaggga
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttcgagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctca
aattccaggatccacaacaaccagcacggggccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctgaattttatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgtttcgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggatgtatcgtccccttctccgcctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccaccagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccattctcatgcaactttttcacctctgcctaatc
atctcttgttcatgtctcacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgaccattataa
agaatttggagctactgcggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatactg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatcaagtggtcaa
ttatgtcaatactaacatgggcttaaaaatcaggcaactattgtggtttcatatttcctgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtg
ggaaattttactggactttattcttctactgtccctatctttaatcctgaatggcaaaccccttcttttcctaaaattca
tttacatgaagaccttgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagagaaactac
acgtagcgcctcattctgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcac
aaaggcatggggacgaacctttctgtgcccaatcctctgggattctttcccgatcatcagttggacccagcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccaatggccacaggccaaccaggtaggagtgggagctt
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagtgcctcctcctgcttccaccaatcggcagtcaggacggcagcctactcccatatctccacctctaagagacagtca
tcctcaggccatacagtggaa
>gnl|hbvnuc|FN545830_FT00000_P-A Feature FT:source FN545830_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaactttccaccaagctctgcaagatcccagggtcaggggcctgtatttacctgctggtggctccaattcaggaa
cagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggaytcctaggacmcctgctcgtgttacaggcgggatttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcatggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatccacgaccaccagyacgggaccctgccgaacctgcacgactcctgctcaaggcaactctatgtttccct
cctgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccctcatcatgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctaacaaaaccaaaagatggggttattccctaaacttcatgg
gatacacaattggcagttggggatcactgccacaggctcatattgtccaaaaaatcaaacattgttttaggaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atacccggccttaatgcctttatatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tacgtgaacaatatatgaacctttaccccgttgcccggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaacmctcatcgggactgataattctgtcgtcctttcacggaaat
atacatcctttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggcctatatcgtccccttctccgtctgccgtatcgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactcttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgtccgagatctcctagatacag
cctcagccctgtttcgggaagcattggaatcacctgagcattgtacacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgtctcacttttggaagagata
ttgtactggagtatttggtatcttttggagtgtggattcgcactcctccagcctacagaccactaaatgcccctatctta
tcaacacttccggaaactgctgttgttagacgaagggaccgaggtcggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcatcaggtg
ggaaattttactgggctttattcttctactgtacctatctttaatcctgaatggcaaactccttcttttccaaagattca
tttacatgaggacattattaatagatgycaacaattygtgggccctctcaccgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcccctagacaaagggattaaaccttattatcctgaacat
gtagttaatcattactttcaggcccgacattatttgcatactctttggaaggctggtattctatataagagggaaactac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttcgttgccaaaacctcgc
aaaggcatggggacgaatctttctgttccaaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccaccaaggaccactggtcacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggcggtgttctggggtggagccctcaggctcagggcatattgacaacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccayccagtggma
>gnl|hbvnuc|JQ707592_FT00000_P-A Feature FT:source JQ707592_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C3). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaagggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggggtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcctttagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
tactaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacctcgtttccatggctgctgggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaatattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttccccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|Z35717_FT00000_P-A Feature FT:source Z35717_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate hb614). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gctacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttagccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcatttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaataataacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctacaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859924_FT00000_P-A Feature FT:source EU859924_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P16). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatttctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707334_FT00000_P-A Feature FT:source JQ707334_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C43). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgattcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttgggggacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaacgttagtattccttggactcacaaggtg
ggaaacttcactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KP718089_FT00000_P-A Feature FT:source KP718089_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1249). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagcgctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtarggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggtacattaccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaaraattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cytcagctctatatcgagaagccttagagtytcctgagcattgctcacctcaccatactgcactcaggcaagccattyty
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctcttactgtgaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaatccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagacaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FN545829_FT00000_P-A Feature FT:source FN545829_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaactttccaccaagctctgcaggatcccaaggtcaggggcctgtatttccctgctggtggctccaattcaggaa
cagtaaaccctgttccgaatactgcctctcacatctcgtcaatctccgcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgttcccct
catgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctaacaaaaccaaaagatggggttattccctaaacttcatgg
gatacataattggaagttggggatcactgccacaggctcatattgtacaaaaaatcaaacattgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atacccggccttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcaccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcrgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttcgcggaaat
atacatcctttccatggctgctaggctgtactgccaactggattcttcgmgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctctcggggccgcttgggcctctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttcacatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtytttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactyttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgcccgagatctcctagataccg
cctcagccctgtatcgggaaggattggaatcacctgagcattgtacacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctcgtagtcaa
ttatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcttgtctcacttttggaagagagg
ttgtacttgagtatttggtatcttttggagtgtggattcgcactcctccagcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagggaccgagctcggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtacctatctttaatcctgaatggcaaactccttcttttccaaagattca
tttacatgaggacattattaatagatgtcaacaattcgtgggccctctcaccgtaaatgaaaagagaagattgaaattaa
ttatgcccgctagattttatcctaacagcaccaaatatttgcccctagacaaagggattaaaccttattatcctgaacat
gtagttaatcattactttcaggcccaacattatttgcatactctttggaaggctggtattctatataagagggaaactac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggttgccaaaacctcgc
aaaggcatggggacgaatctttcggttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccaacaaggaccactggtcacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggcggtgttctggggtggagccctcaggctcagggcatattgacaacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtct
tcctcaggccatacagtggaa
>gnl|hbvnuc|KT366466_FT00000_P-A Feature FT:source KT366466_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C-EICI.7). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatattgcccgtttgtcctct
aattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatatttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtctctttataccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
atcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttatatgcatgtatacaagcgaaacaggcctttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttgggactatatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagacacag
cctcagctctatttcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattactgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaattgctgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctatctttaatccagaatggcaaaccccttcttttcctaaaattca
tttacatgaagacattgctaaaaggtgtcagcaatttgtaggccctctcacagtaaatgaaaaaagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caatacaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagtacctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MH464813_FT00000_P-A Feature FT:source MH464813_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA91). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcacctctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttaggaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttttcgccaacttacaaggcctttc
taaatcaacagtacatgaacctttaccccgttgcccggcaacggtctggtctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcctgttttgctcgcagccggtctggagcaaaactcatcggaactgacaattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtatcgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatcctgcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcatatttcttgccttacctttggaagagaaa
ctgtccttgagtatttggtctcttttggagtgtggattcgcacacctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctctactcttctactgtccctgtctttaatcctgaatggcaaactccttcctttcctaaaattca
tttacaggaggacattattaataggtgtcagcaatttgtaggccctctaactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattacttccagaccagacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcagccaagcctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctacagtgcca
gcagttcctcccactgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU185789_FT00000_P-A Feature FT:source EU185789_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU8). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactgkggaccctgtgacgaacatggag
aacatyayatcaggactcctaggacccctgctygtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagaatctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattgggtcttctggattatcaaggtattttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaarttgcacctgtaywscsrtcccatcgtcctgggcttkcgcaaaataccta
tgggagtggggctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtmcctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtgcaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagata
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcamcaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaw
ttmtgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgygggtcaccatawtcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggtccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707544_FT00000_P-A Feature FT:source JQ707544_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C23). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ854688_FT00000_P-A Feature FT:source KJ854688_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1379-SE-BRA). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
gttatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgcgg
ttaccctgcattaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacctcatcgggactgataattccgtcgtcctttctcggaaat
atacatcctttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctgtatcgggaagccttagagtctcctgaacattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaacactaacatgggcctaaagatcagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactgaarttra
ttatgcctgcgaggttttrtcctaacaggactaartatttggctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaatcaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
ttagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB697508_FT00000_P-A Feature FT:source AB697508_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No31). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatcttctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ020003_FT00000_P-A Feature FT:source DQ020003_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 5780). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggctattccctaaattttatgg
ggtatataattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcacggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacctcatttccatggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcacggggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctatgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcaccgcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgtgaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagaatgaaattaa
ttatgcctgctaggttctatcctaacagcactaaatatttgcctctagataaagggattaaaccttactatcctgatcat
gtagttaatcattactttcaaaccagacattatttacatactctttggaaggctggaattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcagcaaaacctcgc
aaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707543_FT00000_P-A Feature FT:source JQ707543_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C22). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactatgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KT151612_FT00000_P-A Feature FT:source KT151612_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 500). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtggcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcytgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtcctgggggccaagtctgtacaacaccttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattagacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgccccatttacacaatgtgg
ttaccctgcyttaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtcaacagtatgtgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgrggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcacctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaaatggtctgcgcaccatcctcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactagcgagttactctcttttttgccttctgacttctttccttccgtycgggatctactagatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtttctttcggagtgtggatccgcactcctccaccctatagaccagcaaatgcccctatctta
tcaacacttccggaaactactgttattagaggaagaggccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactggactttattcttctactgttcctatctttaatcctgactggcaaactccttcytttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcag
gtagttaatcattactttaaaacccgacattatttacatactctttggaaggctgggattctatataagagggaatctac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccgtcaaggaccattggccammagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcaggcaggacgacagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KT151614_FT00000_P-A Feature FT:source KT151614_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 969). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtggcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcytgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
ggtatgtaattggatgttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgcygctccttttacacaatgtgg
ttatcctgcattaatgcctttatatgcatgtatacaagcgaaacaggcytttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcgtttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgrrgccgcttgggactgtatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactcycagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaargactgggaggagytgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactkttcaagcctccaagctgtgccttggrtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagacacag
cctcagctctatatcgggaagccttagagtctcctgagcattgctctcctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatccagaatggcaaaccccttcytttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaacccgctgggattctttcccgatcatcagttggacccagcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccammagccaaccaggtaggagtgggagcat
tcgggccagggttcacyccyccacacggmggtgttttggggkggagccctcaggctcagggcatattggccacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggacgacagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggnn
>gnl|hbvnuc|MK512473_FT00000_P-A Feature FT:source MK512473_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-48). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccagcaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcttcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taaatacacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctaccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctcggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttcagtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctaactttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattttatcctaacagtactaaatatttgcctctagacaaagggattaaaccttattatccagatcaa
gtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattttatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccaccaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctactttgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ161813_FT00000_P-A Feature FT:source GQ161813_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GU1021). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagcacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcatgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggatcattgccacaggatcatattgtacaaaaaatcaaaaattgttttagaaaacttcct
attaataggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggctttgcagctccctttacacaatgtgg
ataccctgccttaatgcctttgtatgcgtgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatgtgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaactcattgggactgataattctgtcgtcctctctcggaaat
atacctcctttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagcggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactcttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcaccacacwgcactmaggcaagccattctt
tgytggggggaattaatgactctagctacctgggtgggcaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctgccttacttttggaagagaaa
ctgtacttgagtatttggtctctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtg
ggaaattttactgggctttattcctctactgtacctatctttaatcctgaatggcaaactcctacttttcccaagattca
tttacatgaggacattgttaataggtgtcaacaatttgtgggtcctctcacagtaaatgaaaaaagaagattaaaattga
ttatgcctgctagattctatcctaacagtacgaaatatttgcccctagacaaaggaattaaaccttattatcctgatcat
gtagttaatcattacttccagacccgacattatttacatactctttggaaggctggtattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggttaccaaaacctcgc
aaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caacacaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgactactgtgcca
gcagttcctcctcctgctgccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707547_FT00000_P-A Feature FT:source JQ707547_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C27). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgttgtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctgt
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|LT992441_FT00000_P-A Feature FT:source LT992441_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DA195). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaaccttccaacaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaagccctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgttccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttattggttctgctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacgaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaaccttcggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggactttcccccac
tgtttggttttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccactat
taccaattttcttttgtctttgggtatacatttaaacaccaacaaaacaaagagatggggttatgccctaaacttcatgg
ggtatgtaattgggagttggggaacattacctcaggatcatattgtacacaaaatcaaacaatgttttcgaaagcttcct
gttaacaggcctattgattggaaagtatgtcagagaattgtggggcttttgggctttgccgctccattcacacaatgtgg
ataccctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagcaaacaatatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggactgataattctgtcgtcctctctcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggattcttcgcgggacatcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggtttctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcacttcacctntgc
acgttgcatggagaccaccgtgaacgcccatcaaatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgagatctactagataccg
cctcagctctctatcgggaagccttagagtctcctgagcactgttcacctcaccatacagcactcaggcaagcaattctt
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatctcttgccttacttttggaagagaaa
ctgtgcttgagtacttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactcataaggtgggaaac
tttaccgggctttattcttctactgtacctatctttaatcctgagtggcaaactccttcttttcctaagattcatttaca
cgaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgagaaaagaagattgaaattaattatgc
ctgctaggttctaccctaactttactaagtatttgcccctggacaaagggataaaaccctattacccagaacatgtagtt
aatcattacttccagactagacattatttgcatactctttggaaggctggtattctatataagagggaaactacacgtag
tgcctcattttatgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcaaaacctcgcaaaggc
atggggacgaatctttctgttcccaaccctctgggattccttcccgatcatcagttggaccctgcattcggagccaacac
aaacaatccagattgggacttcaaccccatcaaggaccactggccagaagccaaccaggtaggagtgggagcattcgggc
cagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattgactacagtgccagcagtt
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB076679_FT00000_P-A Feature FT:source AB076679_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala35). Complete genome. [Hepadnaviridae] (length=3221 residues).
tttcacagctttccaacaagccctacaagatcccagagtcaggggcatatatcttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggttccacccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgcttgatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
cctgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgtaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaacttcatgg
gatacgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttaggaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcgaaactcattgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtgctgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactattcaagcctccaagctgtgccttggctggctttggggcatggacattgacccttataa
agaatttggagctagtgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctctgtatcgggaggccttagagtctccggagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctgggtggaattaacgactctagctacctgggtgggtaataatttggaagatcatgcatccagggacctagtagtcaa
ttatgtaaatgataatatgggactaaagctcagacaactattgtggtttcatatttcttgccttacttttggaaaacaaa
ctgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatcgaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagagaccgaggcgggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttgttgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcctttcctaagatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattttatcctaaccgcactaaatatttgcctctagacaaagggattaaaccttattattctgatcaa
gtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggttaccaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagactgggacttcaaccccatcaaggaccgctggccacaagccaaccaggtaggagtgggagcgt
tcggcccagggttcactcccccacacggaggtgttttggggtggaaccctcaggctcagggcatattgactacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcagggaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccgtgcagtggaa
>gnl|hbvnuc|FN545836_FT00000_P-A Feature FT:source FN545836_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctacaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttcwggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatccacaactaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggatcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaaactagacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatggacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttcacggaaat
atacatcatttccatggctgctaggctgtactgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtyttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaarctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgtccgagacctcctagataccg
cctcagctctatatcgggaagcactagagtctcctgagcattgctcacctcatcatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtacttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtgcctaactttaatcctgaatggcagactccttcttttcctaagattca
tttacatgaggacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattga
ttatgcctgctagattctatcctaacagcaccaaatatttgcccctacacaaaggaattaaaccttattatcctgatcaa
atagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatataagagggaaaccac
gcgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggatagcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgactacagtgcca
gcagttcctcctcctgcctccgccaatcggcagtcaggaaggcagcctacacccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ023661_FT00000_P-A Feature FT:source JQ023661_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1158). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgtctctcacatctcgtcaatctcctcgaggactggggaccctgccccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtgtttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgggtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctaacccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactcccttaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttagaaaacttcct
atcaatcggcctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcgaaactcattgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtgctgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctgtatcgggaagacttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaaggcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctacagtccctatctttaatcctgaatgggaaactccctcttttcctaaaattca
tctacatgaagacattgctaataggtgtcagcaatttgtaggccctctccctgtaaatgaaaagagaagactgaaattaa
tcaagcccgctaggtttttccctaacagcactaaatatttgcctttagacaaaggaattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctttttaagagggaaactac
ccgtagcgcctcattttgcgggtcaccttattcctgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcatgctcagggcatattggccacggtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaaagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ692566_FT00000_P-A Feature FT:source FJ692566_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48090). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccacatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactcccttaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacaatgttttagaaaacttcct
atcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtcaacagtatatgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaamactcatcgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttcgcgaggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgtccgggatctactagatacag
ccgcagctctgtatcgggaatccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccaccctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccctcttttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctaggttttaccctaacagcactaaatatttgcctttagacaaaggaattaaaccttattatcctgatcag
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagagaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattccttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactccaccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacggtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707562_FT00000_P-A Feature FT:source JQ707562_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C42). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcgcgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JX154579_FT00000_P-A Feature FT:source JX154579_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBVFLS36). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaactttccaccaagctctgcaagatcccagagtcaggggcctgaattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgtcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaagtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gctatgtaattggaagttggggtacattgccacaggatcatatcatacaaaaaatcaaacactgttttagaaaacttccc
gttaatcgacctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttttcgccaacttacaaggcctttc
taagcaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcgtttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcacggggccgcttgggcctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacctttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagctattgtc
tgctggggggaattaatgactctaggtacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaatatgggcctaaagatcagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcggaaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattaaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattatttccaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaaccac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
ttggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU054331_FT00000_C-A Feature FT:source EU054331_FT00000_C-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctacaagatcccagagtcaggggcctgtattttcctgcggggtgctccagttcaggaa
cagtaagccctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgcacaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcggtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gctacataattggatgttggggatcattgccacaagatcatattgttcaaaaactcaaagattgttttcgaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgcattgtgggtcttttgggctttgccgctccatttacacaatgtgg
gtaccctgctttaatgcctctgtacgcatgtatacaagccaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatctttcccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcacgcggacgacccctctcggggccctttggtcatttctcgtccccttctctgtctaacattccgaacgaccac
ggagcgcacctctcattccactgcctacccgtctgtgccttctcatctgacggaccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgaccatcagatgctgcgcaagttgttacataaaagagctgttggactcccagcaa
tatcaacagccgaccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtattaagaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atttcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgagatctcctcgataccg
cctcagctctatatcgggaagcactagagtctcctgagcattgctctcctcaccatacagcactcaggcaagccattctc
tgctggggggagttaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaatatgggcctaaagatcaggcaactgttgtggtttcatatttcttgccttacttttggaagagaaa
ctgtacttgagtatttggtctcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
gggaattttactgggctttattcttctactgtacctatctttaatcctgaatggcaaactccttcttttcccaagattca
tttacatgaggacattattaatagatgtcaacaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctttcctaacagcactaaatatttgccacttgacaaagggattaaaccttattatcctgatcat
gtagttaatcattacttccaggcccgacattatttacatactctttggaaggccggtattctatataagagggaaactac
aagtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggttaccaaaacctcgc
aaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaagctcagggcatattgactaccgtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ692611_FT00000_P-A Feature FT:source FJ692611_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50127). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccacagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgataagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctgaacttcatgg
gatatgtgattggaagttggggatcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggcttttactttctcgccaacttacaaggcctttc
tacgtacacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccggcccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacttataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttccgtccgagatctcctagataccg
cctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagcttcctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagaccaa
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaactccctcgcctcgcag
acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaggacattatcaatagatgtcaacaatttgtaggccctctcactgtaaatgaaaagagaagattgaagttga
ttatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaaccttattatcctgatcag
atagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatataagagagaaaccac
tcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggtcggmtatcaacacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccacatcaaggacccctggccacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgactacagtgcca
gcagttccccctcctgcctccaccaatcggcagtcaggaaggcagcctacacccatctctccacctctaagagacagtca
tcctcaggcaayacagtggaa
>gnl|hbvnuc|KJ854701_FT00000_P-A Feature FT:source KJ854701_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 349-SE-BRA). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttcccaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgtgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctgcaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggctattccctaaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtgtgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttatcctgcattaatgcctttgtatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtaaccagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaacactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtatttaaagactgggaggagttaggggaggagactaggtta
atgatctatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgatttctttcctaccgcccgggatctacttgatacag
cctcagctctgtatcgggaagcattagagtctcctgagcattgctcaccgcaccatacagcactcaggcaagccatacta
tgctggggggatatactgactctaggtacctgggtgggtaataatttggaagatcaaacatccagggatctagtagtcaa
ttatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaar
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctcaagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctacggtccctatctttaaccctgaatggcaaactccttcttttcctaaaattca
tttacatgaagatgttgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagragactgaagktga
ttatgcctgcgaggttctrtcckaacaggactaaatatttggctctggacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaaccagacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcatttttcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcgaaacctcgc
aaaggcatggggacgaacctttcggttcccaaccctctgggattctttcccgatcatcagttggatcccgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FM199978_FT00000_P-A Feature FT:source FM199978_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcttcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccmattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattaccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taaatacacagtatatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaacctcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtccccttctccgtctaccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcggatcctgcccaaggtcttacataagaggactcttnnnnnnnnnnnnn
nnnnnnnnnccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtcacctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttagaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttgccttacttttgggagagaaa
ctgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagtactaaatatttgcctctagacaaagggattaaaccttattatccagatcaa
gtagttaatcattacttccagacccgacattatttacatactctctggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccaccaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctactttgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707340_FT00000_P-A Feature FT:source JQ707340_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C5). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcataatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcatct
aattccaggattaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatatagtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttgggggacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgtccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcacttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KT749839_FT00000_P-A Feature FT:source KT749839_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL5d). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggcctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatctagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaacaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctgtctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggagggctggtattctatataagagagaaaccac
acgtagcgcatcattttgcgggtcaccatattctggggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatgcagattgggacttcaaccccatcatggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859930_FT00000_P-A Feature FT:source EU859930_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C126). Complete genome. [Hepadnaviridae] (length=3227 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccacgcccatcagatcctgcccaaggtcttacataagaggactcttggacttc
cagcaatgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagatt
aggttaaaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgc
ctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccc
ttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctag
acaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcc
attctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagt
agtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaa
gagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccct
atcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcc
tcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcat
aaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaa
gattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattga
aattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatcca
gatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagaggga
aaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaa
cctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcatt
cggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgg
gagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccaca
gtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagaga
cagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FM199976_FT00000_P-A Feature FT:source FM199976_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcttcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagacttgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taaaggcgcaatatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagabcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aagatttatgtattaggaggctgtaggcataaattggtctgcgcaccatcmtcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcycactgttcaagcctccaagctgtgccttggatggctttgrggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagttcgggatctacttgacacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccrttctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagattagacaamtattgtggtttcatatttcttgccttacttttggaagagaga
ctgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggyaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcagactccttcctttcctaaaatcca
tttacatgaggacattattaatagatgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagtactaaatatttgcctctagacaaagggattaaaccttattatccagatcaa
gtagttaatcattacttccagacccgacattatttacatactctctggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctatctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccaccaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgtcttggggtggagccctcaggctcagggcatattggctactttgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaagagacagtca
tcctcaggccrtgcagtggaa
>gnl|hbvnuc|JQ707406_FT00000_P-A Feature FT:source JQ707406_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C19). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccttgctcttcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AF090840_FT00000_P-A Feature FT:source AF090840_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggccttcc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtggggcctctcactgtaaatgaaaagggaagattgagattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagaccag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttcggttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctttccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707602_FT00000_P-A Feature FT:source JQ707602_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C42). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatatcgtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
gactaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
attaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagacattctc
tgctgggggaaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttccccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KP168430_FT00000_P-A Feature FT:source KP168430_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate NRB10). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatrccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagaggtgggggtattccctgaatttcatgg
ggtatgtaattggaagttggggtactttaccacaggatcatattgtacaaaaactcaaacaatgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataactctgtcgtcctgtctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcgcgcggccgcttgggaatctatcgtccccttctccgtctgccgttccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcccaccaaatcctgcccaaggtcttacacaagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactgttgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttagtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttccaaaaattca
tttacatgaagacattattaataggtgtcagcaattcgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttttcctaacagcactaaatatttgcctctagacaaaggaattaaaccttattatcctaatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatactcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattgrctacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AY934764_FT00000_P-A Feature FT:source AY934764_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9210699). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
tagtaaaccctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagcacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcatgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtatggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggatcattgccacaggatcatattgtacaaaaaatcaaaaattgttttagaaaacttcct
attaataggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggctttgcagctccctttacacaatgtgg
ataccctgccttaatgcctttgtatgcgtgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatgtgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actgggtggggcttggccattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaactcattgggactgataattctgtcgtcctctctcggaaat
atacctcctttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagcggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactcttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgagatctcctagataccg
cctcagctctgtaccgggaagcattagagtctcctgagcattgctcacctcaccacacagcactaaggcaagccattctt
tgttggggggaattaatgactctagctacctgggtgggcaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctgccttacttttggaagagaaa
ctgtacttgagtatttggtctctttcggagtgtggattcgcactcctccagcttatcgaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtg
ggaaattttactgggctttattcctctactgtacccatctttaatcctgaatggcaaactcctacttttcccaagattca
tttacatgaggacattgttaataggtgtcaacaatttgtgggtcctctcacagtaaatgaaaaaagaagattaaaattga
ttatgcctgctagattctatcctaacagtacgaaatatttgcccctagacaaaggaattaaaccttattatcctgatcat
gtagttaatcattacttccagacccgacattatttacatactctttggaaggctggtattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggttaccaaaacctcgc
aaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caacacaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctcctcacggaggtgttctggggtggagccctcaggctcagggcatatcgactactgtgcca
gcagttcctcctcctgcctgcaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ904434_FT00000_P-A Feature FT:source FJ904434_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate B21). Complete genome. [Hepadnaviridae] (length=3194 residues).
ttccactgccatccaccaacatcagtttcatgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcct
ctcacatctcgtcaatctccgcgaggactggggaccctgtgaagaacatggagaacatcacatcaggattcctaggaccc
ctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttc
tctcaattttctaggggagccacccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcct
gtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatatccctcttcatcctgctgctatgcctc
atcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtac
gggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatg
gaaactgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctct
tggctcagtttactagtgccmtttgttcartggttcgtagggctttcccccactgtttggctttcagctatatggatgat
gtggtattgggggccaaatctgtacaacatcgtgagtccctttttaccgctgttaccaattttcttttgtctttgggtat
acatttaaaccccaacaaaacaaaaagatggggttactccctaaacttcatgggatacgtaattggaagttggggaactt
tgccacaggatcatattgtacaaaagcttaaacaatgttttagaaaactacctgttaacaggcctattgattggaaagta
tgtcagagaattgtgggtcttttgggcttcgctgctccctttacacagtgtgggtaccctgccttaatgcccttgtatgc
atctatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttacc
ccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggctataggccat
cagcgcatgcgcggaacctttgtgtctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccg
gtctggagcgaaactcatcgggactgataactctgtcgtcctctctcggaaatatacatcgtttccatggctgctaggct
gtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcgg
ggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctc
cccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtgaacgc
ccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccgaccttgaggcttact
tcaaagactgtgtatttaaggactgggaggagctgggggaggagactaggttaatgatctttgtattaggaggctgtagg
cataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatcatctcttgtacatgtcccactgttcaa
gcctccaagctgtgccttgggtggctttggggcatggacattgacccttataaagaatttggagctactgtggagttact
ctcgtttttgcctcgtgacttctttccttcagtccgggatctcctagataccgcctcagctctgtatcgggaagccttag
agtcacctgagcattgctcacctcaccataccgcaattcggcaaatcattctctgctggggggatgtaatgactctagct
acctgggtgggtactaatttgsaagatccagcatccagggatctagtagtcaattatgttaatactaatatgggcctaaa
gatcaggcaactattgtggtttcatatctcttgccttacttttggaagagaaactgtaattgagtatttggtctctttcg
gggtgtggattcgcactcctccaccctatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgtt
agacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcag
aagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaactttactgggctttattcctct
acagtacctatctttaatcctgaatggcaaactccttcttttcctaagattcatttacaagaggacattattaataggtg
tcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaattatgcctgctagattctatcctacct
acactaaatacttgccattagacaaagggatcaaaccctattatccagatcaggtagttaatcattacttccaaaccaga
cattatttacatactctgtggaaggctggtattctatataagagagaaaccacacgtagcgcatcattttgcgggtcacc
atattcttgggaacaagatctacagcatgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatctgtt
cccaaccctctgggattctttcccgatcatcagttggaccctgcattyggagccaactcaaacaatccagattgggactt
caaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcattcggcccagggttcacccctccacacg
gcggtgttttggggtggagccctcaggctcagggcatattgacaacagtgtcaacagttcctcctcctgcctccaccaat
cggcagtcaggaaggcagcctactcccatttctcctcmtctaagagacagtcatcctcaggtcatgcagwggaa
>gnl|hbvnuc|KC875254_FT00000_P-A Feature FT:source KC875254_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV12). Complete genome. [Hepadnaviridae] (length=3218 residues).
ttccacagcattccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggacgctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcccgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaatagcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagccatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctatgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
gttatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattgatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggccttcc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgctcgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgactgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaagctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcctactttttaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttcttttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctaggttttatcctaacagaacaaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcacatctctccacctctaagagccagtca
tcctcaggccatgcagtg
>gnl|hbvnuc|AJ309369_FT00000_P-A Feature FT:source AJ309369_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient X104). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagcactgcaggatcccagagtcaggggtccgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctaggctcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccggtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagagtaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgccaaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgttgagttactctcgtttttgccttctgacttctttccttccgtcagagatcttctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcactgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggatgatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggcgggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtgggagtgggggcat
tcgggccagggctcacccctccacacggcggtatcttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctccgagacagtca
tcctcaggccacgcagtggaa
>gnl|hbvnuc|JQ707648_FT00000_P-A Feature FT:source JQ707648_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C28). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactatgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MK512456_FT00000_P-A Feature FT:source MK512456_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw3531). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcttcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccagggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttaggaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taaaaacacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggctataggccatcagcgcatgcgtggaacctttgtggctgctatgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtcggtgccttctcacctgccggtccgtgtgcacttcgagttacctctgc
acgttgcatggagaccaccgtgaacgcccatcagagcttgcccaaggtcttacataagaggactcttggactcccagcaa
tggcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatactcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagcccgggatctacttgagacag
cctcagctctgtttcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttgcattactttcggaagagaag
ttgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagtactaaatatttgcctctagacaaagggattaaaccttattatccagatcaa
gtagttaatcattacttccagacccgacattatttacataccctctggaaggctgggattgtatgtaagagggaaactac
acgtagcgcctcatttttcgggtcaccatattcttgggaacaagaattacatcatgggaggttgtacatcaaaacttcgc
aaaggcaaggggaagaatgtatttgttcccaaccctatgggattctttcccgatcttcagttggaccaggcattcggagc
caattcaaacaatccagactgggacttcaaccccaacaaggaccattggccacaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattgggtactttgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccaggcagtggaa
>gnl|hbvnuc|DQ298165_FT00000_P-A Feature FT:source DQ298165_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggactcctaggacccctactcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctaggggaagcacccgtgtgtcttggccaaaattcgcagtccc
caacccgcaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
cctgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatttggtattgggggccaagtctgtacagcatcgtgtgtccctttacaccgctgt
tacaaattttctgttgtctctgggtattcatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggcagttggggaacattaccacaggatcatattgtacaaaagatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgctgcgccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcaagtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tacgtcaccagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccctcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggaactgggggaggagaataggtta
atgatttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacacttataa
agaatttggagctactgtggagttgctctcttttttgcctggtgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattgtc
tgctggggagaattgatgaatctagctacctgggtgggtaataatttgcaagatccagcatccagggatctcgtagtcaa
ttatgttaatactaacatgggtataaagatcaggcaactattgaggtttcatatatcttgcattacttttggaagagagg
ttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgggaccgaggctggtcccatagaagaagaactccctcgcctcgcag
acgcagatcccaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttagtattccgtggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaacattca
tttacaagaggacattattgatcggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaatccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatccaaacctcgc
aaaggcatggggacgaatctttcagttcccaacccgctgggattctttcccgatcatcagttgggccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcaccccaccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcagggaggcagcccactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FN545840_FT00000_P-A Feature FT:source FN545840_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3209 residues).
ttccacaactttccaacaagctctgcaagatcccagggtcaggggtgctggtggctccaattcaggaacagtaaaccctg
ttccgaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatca
ggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctaga
ctcgtggtggacttctctcagttttctagggggcccacccgtgtgtcgtggccaaaattcgcagtccccaacctccaatc
actcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatc
ctgctgctatgcctcatcttcttattggtgctgctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatc
cacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgta
caaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcc
tcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccactgtttggctttc
agttatatggatgatgtggtattgggggccaagtctgtacagcaccttgaatccctttttactgctgttaccaattttct
tttgtctttgggcatacatttaaaccctaacaaaaccaaaaggtggggttattccctaaacttcatgggatacataattg
gaagttggggatcactgccacaggatcatattgtacaaaaaatcaaacattgttttagaaaacttcctgttaacaggcct
attgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtggatacccggcctt
aatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttctaagtaaacagt
atatgaacctttaccctgttgcccggcaacggtctggtctgtgccaagtgtttgctgacgcaacccccactggttggggc
ttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttg
ttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttcgcggaaatatacatcctttc
catggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcg
gacgacccctctcggggccgcttgggcctctatcgtccccttctccgtctgccgtaccgaccgaccacggggcgcacctc
tctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatgga
gaccaccgtgaacgcccaccagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccg
accttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatttttgta
ttaggaggctgtaggcataaattggtctgcgcaccatcttcatgcaactttttcacctctgcctaatcatctcttgtaca
tgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataaagagtttggagc
tactgtggagttactctcttttttgccttctgacttctttccttccgtccgagatctcctagataccgcctcagccctgt
atcgggaagcattggaatcacctgagcattgtacacctcaccatacagcactcaggcaagccattctctgctgggtggaa
ttaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaattatgttaatac
taacatgggcctaaagatcaggcaactattgtggtttcatatttcttgtctcacttttggaagagaaactgtgcttgagt
atttggtatcttttggagtgtggattcgcactcctccaccctacagaccaccaaatgcccctatcttatcaacacttccg
gaaactactgttgttagacgaagggaccgaggtcggtcccctagaagaagaactccctcgcctcgcagacgaagatctca
atcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaattttact
gggctttattcttctactgtacctatctttaatcctaaatggcaaactccttcttttccaaagattcatttacatgagga
cattattaatagatgtcaacaattcgtgggccctctcaccgcaaatgaaaagagaagattgaaattaattatgcctgcta
gattttatcctaacagcaccaaatatttgcccctagacaaagggattaaaccttattatcctgaacatgtagttaatcat
tactttcaggcccaacattatttgcatactctttggaaggctggtattctatataagagggaaactacacgtagcgcatc
attttgcgggtcaccatattcttgggaacaagakctacatcatgggaggttggttgccaaaacctcgcaaaggcatgggg
acgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagccaactcaaacaa
tccagattgggacttcaatcccaccaaggaccactggtcacaagccaatcaggtaggagtgggagcatttgggccagggt
tcacccctccacacggcggtgttctggggtggagccctcaggctcagggcatattgacaacagtgccagcagttcctcct
cctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctcaggccat
gcagtggaa
>gnl|hbvnuc|JQ707611_FT00000_P-A Feature FT:source JQ707611_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C11). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagacagtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AY934767_FT00000_P-A Feature FT:source AY934767_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 27178). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
tactcaaccctgttcccaatattgcctcgcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaattttatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ataccctgcattaatgcctttatatgcgtgtatacaagcgaaacgggcttttactttctcgccaacttacaaggcctttc
tgaggaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggcctctatcgtccccttctccgtctgccgtaccatccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgatttctttccttccgtccgggatctactagatacag
cttcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccggcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccgtggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacattactactaggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaaggaattaaaccttattatcctgatcag
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggcggggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ692562_FT00000_P-A Feature FT:source FJ692562_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48044). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaaaaa
tactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggycacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctkgatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgaatccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
gttatgtaattggatgttggggtgcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcaaagaattgtgggtctcttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacctcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggttgtactgccaattggattcttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgacaac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccaycagwtcctgcccaaggtcttatataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactattcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttccgtccgggatctactagatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattcta
tgctggggggaattaatgaccctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtyaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagaccaa
ctgtccttgagtatttggtctctttcggggtgtggattcgcactcctccaccctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactggactttattcttctactgtccctgtctttaatcctgaatggcaaactccgtcttttcctaaaattca
tttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactaaaattaa
ttatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaaggaattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctgtggaaggctgggatcctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgccg
gtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatacagtggaa
>gnl|hbvnuc|KF922427_FT00000_P-A Feature FT:source KF922427_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4312v2). Complete genome. [Riboviria] (length=3221 residues).
ttccacaactttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttatatgcatgtatacaagcgaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacctcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggcaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactgttgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtcttccttggactcataaggtg
ggaaattgtactgggctttattcttctactgtccccatctttaatcctgaatggcaaactccctcttttcctaaaattca
tttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactaaaattaa
ttatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaagggattaaaccttattatcctgatcac
gtagttaatcattactttcagacccgacattatttacatactctttggaaggctgggatcctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccgtcaaagaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AF537372_FT00000_P-A Feature FT:source AF537372_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgagaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aatgccaggatcaacgacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctacgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaactaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagactaggtta
atgatttttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agagtttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
tgctggggggaattgatgactctagctacttgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactgctgttgttagatgtcggggccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcttctacagtacctatcttcaatccggaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacaccaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatccaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaacccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaaatcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagggacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU086721_FT00000_P-A Feature FT:source EU086721_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HRO/w4601-2002). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaatcgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KT749836_FT00000_P-A Feature FT:source KT749836_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL12). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttggggaacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KF922407_FT00000_P-A Feature FT:source KF922407_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3791v2). Complete genome. [Riboviria] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
tactcaaccctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacgggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatctacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttaggaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taaatcaacagtatatgaacctttaccccgttgcccggcaacggtctggtctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggctataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcggaactgacaattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatcctgcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcatatttcttgccttacttttggaagggaaa
ctgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactggactttactcttctactgtccctgtctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgagggcattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaatttaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattacttccagacccggcattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcagccaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccccgcattcggagc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctacagtgcca
gcagttcctcccactgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KT366467_FT00000_P-A Feature FT:source KT366467_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C-EICI.9). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcaccgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattctctaggggaatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgcccgtttgttctct
aattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactgctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggggtgggcctcagcccgtttctcttggctcaatttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
gttatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
actagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctccacaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcatcatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatcaagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgttcttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acacagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccacatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MH464810_FT00000_P-A Feature FT:source MH464810_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA88). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcacctctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatctcgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacagttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttaggaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttttcgccaacttacaaggcctttc
taaatcaacagtacatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggytggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtatcgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcwccatcatcakgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatcctgcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaaaatcagacagctattgtggtttcatatttcttgccttacctttggaagagaaa
ctgtccttgagtatttggtctcttttggagtgtggattcgcacacctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctctactcttctactgtccctgtctttaatcctgaatggcaaactccttcctttcctaaaattca
tttacaggaggacattattaataggtgtcagcaatttgtaggccctctaactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattacttccagaccagacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcagccaagcctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggtrggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcgtactggctacagtgcca
ccagttcttcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AY233289_FT00000_P-A Feature FT:source AY233289_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 833). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
tactcaaccctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctactgctatgcctcatcttcttattggttcttctggattaccagggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctgaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttaggaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
tgagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcggaactgacaattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtggggaataatttggaagatcctgcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttactcttctactgtccctgtgtttaatcctgaatggcgaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcagccaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagtcctcaggctcagggcatattggctacagtgcca
gcagttcctcccactgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707670_FT00000_P-A Feature FT:source JQ707670_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_29). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctacacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgattggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaagtatttgcccttagataaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MG877725_FT00000_P-A Feature FT:source MG877725_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate I_t3). Complete genome. [Riboviria] (length=3221 residues).
ttccacaaatttccaccaaactctgcaagatcccagagtcaggggactgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatcwcgtcaatctcctcgaggactggggaccctgcgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaayttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaartctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaatttcatgg
gttatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
rtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgcccggcaacggcctggtttgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcaccattcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacatygacccttataa
agaatttggagctacygtggagttactctcgtttttgcctyctgacttctwtccttccgtccgggatctactagacacag
cctcagctttgtatcgggaagccttagagtctcctgagcattgctcakctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatytcttgccttacttttggaagagaca
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactgctgttgttagacaacgacaccgaggcaggtcccctagaggaagaactccctcgcctcgcag
acgaagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactggtctttattcttctactgtccctatctttaatcctgattggcaaactccctcttttccaaaaattca
tytacatgaagacattgctaataggtgtcagcaatttgtaggccctcttactgtaaatgaaaagagaaaactgaaattaa
ttatgcctgctagattttatcctaacagtactaaatatctgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaaycattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattcttccccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttgggrtggagccctcaggctcagggcatattgrccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcaatggaa
>gnl|hbvnuc|AB116086_FT00000_P-A Feature FT:source AB116086_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-IND18). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaactttccaccaagctctgcaagatcccagagtcaggagcctgtatcttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggcgaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggagcatattatacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggctttcactttctcgccaacttacaaggcctttc
taagtcaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggtcgcttgggactctatcgtcccctgctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatattcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgcggacttactctcgtttttgccttctgacttctttccttccgtccaggatctactagatacag
cctcagctctgtatcgggaagccttagagtctcctgtgcattgctcacctcaccatacagcactaaggcaagccattctc
tgctggggggaattaaggactctaggtacctgggtgggtaataatttggacgatcaagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagata
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagacctccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacatttctaataggtgtcagctatttgtaggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacacgacattatttacatactctttggaaggctgggatcctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcaattggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccgtgaagtggaa
>gnl|hbvnuc|AJ627227_FT00000_P-A Feature FT:source AJ627227_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 21077). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccaaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcataatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaycaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggwccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagytatatggatgatgtggtmttggggaccagatctgtacagcatcgtgaggccctttwtaccgctgt
taccaattttcttttgtctctgggtatacatataaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgctgcyccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tgagtcaacagtacakgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggractgacaattctgtcgtcctttcgcggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcgrcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctctcgtccccttctccgtctgccgttccagccgtccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagactaggttg
aagstctttgtattgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctartc
atctcttgtacatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacctttataa
agaatttggagctagtgtggagttactctcgtttttgcctkctgacttctatccttccgtcagagatctcctagacaccg
ccwcagctctrtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcaatcaggcaagccattgtc
tgctggggwgaattgacgaatctaggtacttgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
tcatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagaaaca
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttrttagacgamgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaatagrtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatctacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcctcattctgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctgtckgtycccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaacccagattgggacttcaatcccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggcattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagcca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ184323_FT00000_P-A Feature FT:source GQ184323_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1121). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttacactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggactttcttccattgtctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactcccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcgggcccgcctgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgccattagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ414522_FT00000_P-A Feature FT:source GQ414522_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagcaaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcaataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagcttatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtaccgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcatctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KF214665_FT00000_P-A Feature FT:source KF214665_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2008-3). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccccagctttccaccaagctctgcaagatcccagagtcaggggcctgtatgttcctgctggtggctccagttcaaaaa
cactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactccctaaattttatgg
gttatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgctttagaaaacttcct
gtcaatcgacctattgattggaaagtctgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
gtaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaatctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgaggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgctcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttcttttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaagaagactaaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatgttggcagcagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ854710_FT00000_P-A Feature FT:source KJ854710_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 274-SE-BRA). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtaggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagaggagatggaagttga
ttatgcctgcgagattctgtcckrcccacactaaatatttgsccttrgacaraggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB453988_FT00000_P-A Feature FT:source AB453988_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH10). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaactttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgtaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagctatatggatgatgtggtactgggggcaaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttatctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctgaatttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgtttcagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcaaaacaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcgcggggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccgttctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactccaccaccctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagacgactgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagataaagggattaaaccttattatcctgatcag
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgtgttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707378_FT00000_P-A Feature FT:source JQ707378_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C22). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattctctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttgtcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttatgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707550_FT00000_P-A Feature FT:source JQ707550_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C3). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgctcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggatcgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594392_FT00000_P-A Feature FT:source EU594392_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtgggacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggacctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KP718087_FT00000_P-A Feature FT:source KP718087_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1897). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgrcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaatcgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcccttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttt
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgmttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagataccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcagrcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaagacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatccttcccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggacccggcattcrgagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtatcttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KP718088_FT00000_P-A Feature FT:source KP718088_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1162). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagcgctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggtacattaccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctcttactgtgaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaatccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagacaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594390_FT00000_P-A Feature FT:source EU594390_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtgggacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggacctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707352_FT00000_P-A Feature FT:source JQ707352_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C20). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctacacttcatgg
gttacgtaattggaagttggggaacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagccactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctggacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacgagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtaattaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggacccggcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccacgcagtggaa
>gnl|hbvnuc|JQ707376_FT00000_P-A Feature FT:source JQ707376_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C2). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707624_FT00000_P-A Feature FT:source JQ707624_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C3). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KF922420_FT00000_P-A Feature FT:source KF922420_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v7). Complete genome. [Riboviria] (length=3221 residues).
ttccacagcttgccatcaagctctgaaagatcccagagtcaggggcctgtatttccctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgacgactggggaccctgtgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtttctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggaacaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattccctaaactttatgg
gctatgtaattggaagttggggtacgttgccacaggatcatattgtacaaaaaatcaaatgctgttttagaaaacttcct
gtcaatagacctatcgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
tgagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctagggtgtactgccaactggattcttcgcggaacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccctcgaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagtcgggggaggagatgaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagtacgggatctacttgatacag
catcagctctgtatcgggaagccttagaatctccggagcattgctcccctcaccatacagcactcaggcaagccattcta
tgctggggggatgtaatgaatctagctacttgggtgggtactaatttggaagacccagcatccagggatcaagtagttaa
ttatgttaatattaacatgggcataaagattagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttagtttctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcatcacttccggaaactactgttgttagacgacgaggccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctaattttaatcctgaatggcaaactccttcctttcctaacattca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgcaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattttatcctaacagcactaaatacttgcctctggacaaagggattaaaccttattatcctgaccaa
gtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatccaaacctcgc
aaaggcatggggacgaatctttctgttccaaaccctctgggattccttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttctggggtggagccctcaggctcagggcatattggctacattgcca
gcaattcctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatacagtggaa
>gnl|hbvnuc|Z72478_FT00000_P-A Feature FT:source Z72478_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A317). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggaccccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttattgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttatagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggttggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaggctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgagtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgtattgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcattaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707388_FT00000_P-A Feature FT:source JQ707388_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C37). Complete genome. [Hepadnaviridae] (length=3221 residues).
cgccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctactagtcaa
ttatgttaatggtgacatgggtttaaaaattaggcaactagggaggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ843184_FT00000_P-A Feature FT:source KJ843184_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag23). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgcttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagactgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgccgcttgtttcgctcgcagccggtctggagcgaagctcatcggaactgacaattctgtcgtcctctctcggaaat
atacctcctttccatggctgctcggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactgtctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaaatcctgcccacggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtangnataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcncactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaggagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaatccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggaagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MH464808_FT00000_P-A Feature FT:source MH464808_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA86). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccacagctttccmccaamctcwgcaagatmccmgastcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcatctcacatmtcgtcaatctcctcgaggactggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaycacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccarggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggrgtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaartctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagaaatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtactttgccacaggatcatattattcaaaaaatcaaaagctgttttagaaaacttcct
gtcaaccgacctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcgttaatgcctttatatgcatgtatacaagcaaaacaggcgtttactttctcgccaacttacaaggcctttc
taagtaaacaatatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcacggggccgcttrggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcccmtcagatcctgcccaaggtcttayataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgrtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcmtcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggmtggctttggggcatggacattgacccttataa
gaaatttggagctwctgtggagttactctcatttttgccttctgacttctttccttcagtccgggatctacttgatacag
cttcagctctgtatcgggaagctttagagtctccggagcattgctcccctcaccatacagcamtcaggcaagccattctc
tgctggggggaaktaatgwctctagccwcctgggtgggtaataatttgsaagatccarcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttcckgaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaayctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcgtttcctaaaattca
tttacatgaggacattattaataggtgtcaacaatttgtaggccctctcactgtaaatgaaaagagaagattaaaattaa
ttatgcctgctagattttatcctaacggcactaaatatttacctctagacaaagggattaagccttattatcctgatcaa
gtagttaatcattactttcagaccagacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgtgggtcaccatattcttgggaacaagagatacagcatgggaggttggtcagcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccaggattcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctacagtgcca
acagttcctcctcctgcctccaccaatcggcagtcaggaaggmagcctactcccatctctccacctstaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859952_FT00000_P-A Feature FT:source EU859952_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C56). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaaccttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttcagaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgtaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctcgactcgtggtggacttctctcaattttctagggggatcacccgcgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggaaccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctat
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaagagatggggttactccctaaacttcatgg
gatatgtaattggaagttggggaacattaccacaggatcatattgcacaaaaacttaaacactgttttagaaaacttcct
gttaataggcctattgattggaaggtatgtcaacgaattgtgggtcttttgggctttgccgctccttttacacaatgtgg
ataccctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccattggccatcagcgcatgcgcggaacctttgcggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcttttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggtcgcttgggactctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactctcatcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtgtgtttaaggactgggaggagtcgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccctataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctccttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgtcttacttttggaagagaaa
ctgtgcttgagtatttggtttctttcggagtgtggattcgcactcctcctgcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagggaccgaggtaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtg
ggaaattttactgggctttattctactactgtacctacctttaatcctgattggcaaactccttcttttcctaagattca
tttacatgaggacattattaataggtgtcaacattttgtgggccctcttactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctaggttctatcctaccagcactaaatatttgcccctagacaaagggattaaaccctattatccagatcag
gtagttaatcattacttccagactcgacattatttacatactctttggaaggctggtattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaacacctcgc
ataggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttttggggtggagccctcaggctcagggcatattgaccacagtgcca
aaggttcctcctcctgcctcgaccaatcggcagtcaggaaggcagccgactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707658_FT00000_P-A Feature FT:source JQ707658_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_13). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgattggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaagtatttgcccttagataaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcacaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MH464809_FT00000_P-A Feature FT:source MH464809_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA87). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatyttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcatctcacatctcgtcaatctcctcgaggactggggaccctgcgctgaacagggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagrgggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttgtggattaccagggtatgttgcccgtttgtcctct
aattgcaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggcccagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaatgctgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcaaaacaggcttttattttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggytggggcttggctatcggccatcrgcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgttccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcta
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtytwtgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtctcactgttcaagcctccaagctgtgccttgggtggctttgaggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cttcagctttgtatcgggaatccttagagtctccggagcattgctcccctcaccatacagcactcaggcaagccattctc
tgctgggkggaattaatgamtctagcyacctgggtgggtartaatttgsaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagwttagacaaatattgtggtttcatatttcttgtctyacttttggaagagaaa
cggtccttgagtatttggtctctttcggrgtgtggattcgcactcctccaccctatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagatgccgagctcgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctaactgtaaatgaaaagagaagattaaaattaa
ttatgcctgctagattttatcctaacagcaccaaatatctgcctttagacaaagggattaagccttattatcctgatcaa
gtagttaatcattacttccagaccagacattatttacatactctttggaaggctggaattctatatmagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggccagcaaaacctcgc
aatggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtmggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcgtactggctacagtgcca
ccagttcttcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AY233285_FT00000_P-A Feature FT:source AY233285_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 795). Complete genome. [Hepadnaviridae] (length=3221 residues).
tcccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggac
cactcaaccctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccccgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttaggaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taaatcaacagtatatgaacctttaccccgttgcccggcaacggtctggtctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggctataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcggaactgacaattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctcagtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtggggaataatttggaagatcctgcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggacccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttactcttctactgtccctgtgtttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcagccaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagtcctcaggctcagggcatattggctacagtgcca
gcagttcctcccactgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707532_FT00000_P-A Feature FT:source JQ707532_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C10). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaaaaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttatctctgggtatacatttaaaccctaacaaaaccaaaagatggggttattccctcaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggaatctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactatgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MF925400_FT00000_P-A Feature FT:source MF925400_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BD-HBV46). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaa
ctctcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggctattccctgaatttcatgg
gatatgtaattggaagttggggttcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaattgcct
gtcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccattcacacaatgtgg
gtaccctgccttaatgcctttgtatgcatgtatacaagccaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggacatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggatctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgggatctactagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaatatgggcctaaagatcaggcaattattgtggtttcacatatcttgccttacttttggaagagaaa
ctgtcattgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagatgtcgaaaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtattccttggacacataaggtg
ggaaattttacggggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaagattca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaacgaagattgaaattaa
ttatgcctgctagattttatcctaatagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcag
gtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859939_FT00000_P-A Feature FT:source EU859939_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C130). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctacaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccacgtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacattattggaagttggggaacattaccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttggggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtgaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaagccatgcagtggaa
>gnl|hbvnuc|GU563545_FT00000_P-A Feature FT:source GU563545_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-5). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcttcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taaatacacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggactggagcaaaactaatcgggactgataattctgtcgtcctttctcggaagt
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgtaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcagtccgggatctatgtgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgtcaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagtactaaatatttgcctctagacaaagggattaaaccttattatccagatcaa
gtagttaatcattacttccagacccgacattatttacatactctctggaaggctgggattctatataaaagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccaccaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctactttgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707373_FT00000_P-A Feature FT:source JQ707373_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C14). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcatggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707607_FT00000_P-A Feature FT:source JQ707607_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C8). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatatcgtattgggggccaagtctgtacagcatcgtgaggccctttatacccctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707674_FT00000_P-A Feature FT:source JQ707674_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_38). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggaatgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgattggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaagtatttgcccttagataaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|LC311242_FT00000_P-A Feature FT:source LC311242_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate p90). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatcttctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgttcacctaaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB246338_FT00000_P-A Feature FT:source AB246338_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggcctatctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707579_FT00000_P-A Feature FT:source JQ707579_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C17). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatatcgtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
tactaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacctcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttccccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcacattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707605_FT00000_P-A Feature FT:source JQ707605_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C45). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggtctggggaccctgtgacgaacatggag
aacatcacatcaggaggcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatatcgtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagacattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaacgatcaggcgactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaacaac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707603_FT00000_P-A Feature FT:source JQ707603_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C43). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaagggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacacgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtatacccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatattgatgatatcgtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggcactgacaattctgtcgtcctctcgcggacat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtactcgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttccccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KF922414_FT00000_P-A Feature FT:source KF922414_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v1). Complete genome. [Riboviria] (length=3221 residues).
ttccacagcttgccatcaagctctgaaagatcccagagtcaggggcctgtatttccctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgacgactggggaccctgtgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtatctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggaacaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattccctaaactttatgg
gctatgtaattggaagttggggtacgttgccacaggatcatattgtacaaaaaatcaaatgctgttttagaaaacttcct
gtcaatagacctatcgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
tgagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctagggtgtactgccaactggattcttcgcggaacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccctcgaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagtcgggggaggagatgaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagtacgggatttacttgatacag
catcagctctgtatcgggaagccttagaatctccggagcattgctcccctcaccatacagcactcaggcaagccattcta
tgctggggggatgtaatgaatctagctacttgggtgggtactaatttggaagacccagcatccagggatcaagtagttaa
ttatgttaatattaacatgggcataaagattagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttagtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcatcacttccggaaactactgttgttagacgacgaggccgagacaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctaattttaatcctgaatggcaaactccttcctttcctaaaattca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgcaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattttatcctaacagcactaaatacttgcctctagacaaagggattaaaccttattatcctgaccaa
gtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttccaaaccctctgggattccttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttctggggtggagccctcaggctcagggcatattggctacattgcca
gcaattcctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatacagtggaa
>gnl|hbvnuc|KJ843183_FT00000_P-A Feature FT:source KJ843183_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag22). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
atcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgcgccctttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagacacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtggtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcacaaggkg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccctcttttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctcttactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctaggttttatcctaacagtactaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaatccac
acgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB937792_FT00000_P-A Feature FT:source AB937792_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1205). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ692612_FT00000_P-A Feature FT:source FJ692612_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50132). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagcgctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcacagaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatwccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctctgggyatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggatcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggcttttactttctcgccaacttacaaggcctttc
tragtacacagtatatgaacctttaycccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcmggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggtctctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
awgrtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccmttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgtccgagatctcctagataccg
cctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactmacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccascctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaactccctcgcctcgcag
acgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaayctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattga
ttatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaaccttattatcctgatcag
atagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatataagagggaaaccac
tcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggatatcaacacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccacatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgactacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ692613_FT00000_P-A Feature FT:source FJ692613_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50156). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaarccctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatattaccct
catgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcgtgaggccctttatgccgctgt
taccaattttcttttgtctctgggcatacatttaaacccgaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggatcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggcttttactttctcgccaacttacaaggcctttc
taagtacacagtacatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacctcctttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggtctctatcgtccgcttctccgtctgccgtaccaaccgtccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcttgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccatccgagatctcctagataccg
cctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcaccatacagcaatcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataacttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgagatcgaggcaggtcccctagaagacgaactccctcgcctcgcag
acgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaggacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaaytga
ttatgcctgctagattttatcctaacagcaccaaatatttgccattagacaaagggattaaaccttattatcctgatcag
atagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatataagagggaaaccac
tcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggatatcaacacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggacccggcattcggagc
caactcaaacaatccagattgggacttcaaccacatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgactacagtgcca
gcaattcctcctcctgcctccaccaatcggcagtcaggaagacagcctacacccatctctccacctctaagggacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707574_FT00000_P-A Feature FT:source JQ707574_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C10). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatatcgtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
gactaattttcttttgtctctgggtatacatttaaaccctaccaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcagcaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttccccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcacattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707653_FT00000_P-A Feature FT:source JQ707653_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C38). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaagcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KP274927_FT00000_P-A Feature FT:source KP274927_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS-3). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagctcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatctagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagagaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707669_FT00000_P-A Feature FT:source JQ707669_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_28). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctacacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtaggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgattggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaagtatttgcccttagataaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KF922433_FT00000_P-A Feature FT:source KF922433_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3658v1). Complete genome. [Riboviria] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcgtcctgctggtggctccagttcaggaa
cacacaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaagactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaacgagtacgggaccctgcaaaacctgcacgactcctgctcagaacaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttccctcac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgtttcagaaaacttcct
gtcaatcgtcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
tgagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacttcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
aagatttatgtattaggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggatctactgtggagttactctcatttttgccttctgacttctttccttcagtacgggatctacttgatacag
cttcagctctgtatcgggaagccttagaatctccggagcattgctcccctcaccatacagcactcaggcaagccatttta
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgtcaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttagtctctttcggagtgtggatacgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctaattttaatcctgaatggcaaactccttcctttcctaaaattca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcccttagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatnnnnnnnnnnnnnnnnnnnnntcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattccttcccgatcatcagctggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagcccatcaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacattgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MF772345_FT00000_P-A Feature FT:source MF772345_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1959). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagcgctgcaagatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcatcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgcttgatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagcacgggaccatgcaagacctgcacaactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaaccaaaagatggggttattccctaaacttcatgg
gatacgtaattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaagattgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
gtaccctgcattaatgcccttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtcaacaatacatgaacctttaccccgttgctaggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaggctcatcgggactgataattctgtcgtcctctctcggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactattcaagcctcctagctgtgccttaggtggctttgggacatggacattgacccttataa
agaatttggagctactgtggacttactctcgtttttgccttctgacttctttccttcaatccgggatctcctagacactg
cctcagctctgtatcgggaagccttagagtctccggagcattgctcacatcaccatactgcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcgtccagggatctagtggtcaa
ttatgtcaatactaacatgggcctaaagctcaggcaaatactgtggtttcatatctcttgccttactttcggaagagaaa
ctgtacttgagtatttggtcgatttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaacttgtgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaagatattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaagggattaaaccttattatccagatcat
gtagttaatcattacttccaaacccgacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttacgggtcacagtattcttgggaacaagagctacagcatgggaggttggtcctcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatcaagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggaggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acagttcctcctcctgcctcgaccaatcggcagtcaggaaggcagcctactcccatttctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ298164_FT00000_P-A Feature FT:source DQ298164_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgaggaacatggag
aacatcacatcaggactcctaggacccctactcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctaggggaagcacccgtgtgtcttggccaaaattcgcagtccc
caacctgcaatcactcaccaacctcctgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
cctgttgctgtacgaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatttggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
tacaaattttctgttgtctctgggtattcatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggcagttggggaacattaccacaggatcatattgtacaaaagatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgccaaagaattgtgggtcttttgggctttgctgcgccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcaagtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tacgtcaccagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccctcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattccgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggaactgggggaggagaataggtta
atgatttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacgttgacacttataa
agaatttggcgctactgtggagttgctctcttttttgcctggtgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattgtc
tgctggggagaattgatgaatctagctacctgggtgggtaataatttgcaagatccagcatccagggatctcgtagtcaa
ttatgttaatactaacatgggtataaagatcaggcaactattgtggtttcatatatcttgcattacttttggaagagagg
ttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttagtattccgtggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaacattca
tttacaagaggacattattgatcggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaatccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatccaaacctcgc
aaaggcatggggacgaatctttcagttcccaacccgctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaagaaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcaccccaccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcagggaggcagcccactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ477484_FT00000_P-A Feature FT:source GQ477484_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P54). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcaccagtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatttttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggaattactctcgtttttgccttctgacttctttccttccgtcagagatcttctagacaccg
cctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggatgtgatgtctctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacagcaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggacggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaagaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707576_FT00000_P-A Feature FT:source JQ707576_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C14). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaagggtctgaattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggggtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcctttagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
tactaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatgaacattgacccttataa
agaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactcacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttccccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgtttccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AF537371_FT00000_P-A Feature FT:source AF537371_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacggaaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcaccgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacgaaaagatggggttattccctaaacttcatgg
gttatataattggaagttggggaacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtcaacagtacaggaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacgcttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgttagtattccctggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgccggctagattctatcctacccacactaagtatttgcccttagataaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatacagtggaa
>gnl|hbvnuc|JQ707356_FT00000_P-A Feature FT:source JQ707356_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C28). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatttggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctacacttcatgg
gttacgtaattggaagttggggaacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacctcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactttcgtttttgccttctgacttctttccttccgtcagagatctcctggacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgagtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggacccggcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccacgcagtggaa
>gnl|hbvnuc|JQ707580_FT00000_P-A Feature FT:source JQ707580_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C18). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaagggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatattgatgatatcgtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttctttggtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggggctactgcggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttccccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgtttccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagaat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859916_FT00000_P-A Feature FT:source EU859916_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P03). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707627_FT00000_P-A Feature FT:source JQ707627_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C32). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KP718098_FT00000_P-A Feature FT:source KP718098_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3106_HIV). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagcgctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggtacattaccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctcttactgtgaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaatccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagacaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AJ627228_FT00000_P-A Feature FT:source AJ627228_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 34408). Complete genome. [Hepadnaviridae] (length=3209 residues).
ttccactgccrcccaccaagctctgcaggatcccaaagtcgatcctgctggtggctccagttcaggaacagtaaaccctg
ctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatca
ggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctaga
ctcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatc
actcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatc
ctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatc
aacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgta
caaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcc
tcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttc
agctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttct
tttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgggttacataattg
gaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcctgttaacaggcct
attgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtggatatcctgcctt
aatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttctaagtaaacagt
acatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaacccccactggctggggc
ttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagccgcttg
ttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaatatacatcgtttc
catggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcg
gacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccacggggcgcacctc
tctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgttgcatgga
gaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccg
accttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagactaggttaatgatctttgta
ttaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctagtcatctcttgtaca
tgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataaagaatttggagc
tactgtggagttactctcgtttttgcctcatgacttctttccttccgtcagagatctcctagacaccgcctcagctctgt
atcgagaagccttggagtctcctgagcattgctcacctcatcatactgcaatcaggcaatgcgttctctgctggggggaa
ttaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaattatgttaatac
taacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagagactgtacttgatt
atttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatcttatcaattcttccg
gaaactactgttgttagacgacgagaccgaggtaggtcccctagaagaagaactccctcgcctcgcagacgcagatctca
atcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaactttact
gggctttattcctctacagtacctatctttaaccctgaatggcaaactccttcctttcctaagattcatttacaagagga
cattattaataggtgtcaacaatttgtgggccctctaactgtaaatgaaaagagaagattgaaattaattatgcctgcta
gattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcaggtagttaatcat
tacttccagaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccacacgtagcgcatc
attttgcgggtcaccatattcttgggaacaagagctaccgcatgggaggttggtcatcaaaacctcgcaaaggcatgggg
acgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagccaactcaaacaa
tcccgattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcattcgggccagggc
tcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtcaacaattcctcct
cctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctcaggccgt
gcagtggaa
>gnl|hbvnuc|FJ692579_FT00000_P-A Feature FT:source FJ692579_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50084). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
gttatgtaattggaagttggggtacattgccacaggagcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacctcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactaaaattaa
ttatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccccgcattcggagc
caattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaagtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgccg
gtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ692582_FT00000_P-A Feature FT:source FJ692582_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50088). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
gttatgtaattggaagttggggtacattgccacaggagcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacctcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactaaaattaa
ttatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccccgcattcggagc
caattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaagtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgccg
gtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707339_FT00000_P-A Feature FT:source JQ707339_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C48). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgagtcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggcctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttgggggacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgttgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagggtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgtcaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactggactttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctcagagacagtca
tcctcaggccgtgcagtggaa
>gnl|hbvnuc|JQ707412_FT00000_P-A Feature FT:source JQ707412_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C32). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KR905429_FT00000_P-A Feature FT:source KR905429_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICI-35). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagacttgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggaacatcaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttggggtttcgcaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactccctaaattttatgg
gttatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
gtaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtccttcgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctatatcgggaagccttagagtctcctgagcattgcacaccgcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactgctgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttcttttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctctaactgcaaatgaaaaaagaagactaaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttcggttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB697512_FT00000_P-A Feature FT:source AB697512_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No37). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgtctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatcttctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859943_FT00000_P-A Feature FT:source EU859943_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C109). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtcacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccaacagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859947_FT00000_P-A Feature FT:source EU859947_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C85). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggagcattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707329_FT00000_P-A Feature FT:source JQ707329_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C39). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcatct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgattcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttgggggacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgttaggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagatcataggaactgacaattctgtcgtcctctcgcggaaat
atacctcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttgtcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaaaacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MG877723_FT00000_P-A Feature FT:source MG877723_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate I_t1). Complete genome. [Riboviria] (length=3221 residues).
ttccacaaatttccaccaaactctgcaagatcccagagtcaggggactgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaayttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaartctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaatttcatgg
gttatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
rtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgcccggcaacggcctggtttgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcggractgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcaccattcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacatygacccttataa
agaatttggagctacygtggagttactctcgtttttgcctyctgacttctwtccttccgtccgggatctactagacacag
cctcagctttgtatcgggaagccttagagtctcctgagcattgctcatctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatytcttgccttacttttggaagagaca
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactgctgttgttagacaacgacaccgaggcaggtcccctagaggaagaactccctcgcctcgcag
acgaagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactggkctttattcttctactgtccctatctttaatcctgattggcaaactccctcttttccaaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctcttactgtaaatgaaaagagaaaactgaaattaa
ttatgcctgctagattttatcctaacagtactaaatatctgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaaycattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattcttccccgatcatcagttggaccctgcattcggagc
caaytcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattgrccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcakgccatgcaatggaa
>gnl|hbvnuc|X02763_FT00000_C-A Feature FT:source X02763_FT00000_C-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaaactctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gctacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcacaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatctagggatcttgtagtaaa
ttatgttaatactaacgtgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctccatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccgtcaaggacgactggccagcagccaaccaagtaggagtgggagcat
tcgggccaaggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB116083_FT00000_P-A Feature FT:source AB116083_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN36). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagccctgcaagatcccagagtcaggggcctgtatattcctgctggtggctccagttcaggaa
ctctcaaccctgttcccaatattgcctctcacatatcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgagtcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
gttatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcagagaattgcgggtcttttgggttttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggaccgataattctgtcgtcctctctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcgcgaggccgcttgggactgtatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcccaccaaatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagaccgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccacttttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agaatttggagctactgttgagttactctcatttttgccttctgacttctttccttccgtccgggatctactagacacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccaccctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttcttttccaaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctctagacaaagggattaaaccttattatcctgatcag
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattttatataagagggaaacttc
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttgaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccaggactcactcccccacacggaggtgtcttggggtggagccctcaggctcagggcatattgaccacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AJ012207_FT00000_P-A Feature FT:source AJ012207_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctacaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcaagg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttgccttacttttggaagagaaa
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KP718091_FT00000_P-A Feature FT:source KP718091_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1771). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagcgctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggtacattaccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctytgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cytcagctctatatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctcttactgtgaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagarggaatccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagacaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ477462_FT00000_P-A Feature FT:source GQ477462_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P4). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgcttgatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggttttgggggccaagtctgtacaacatcgtgaagccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctgacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattaccacaggatcatatagtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtggggcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
taagtaatcagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagatcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggarctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccctgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgcctcatgacttctatccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagaatctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgacgagtctaggcacctgggtgggtaataatttggacgatcaagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcttaaagctcaggcaactattgtggtttcacatatcttgccttacttttggaagagaga
ctgtaattgaatatttggtctctttcggagtgtggattcgcactcctcaagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgttagtattccttggactcacaaggtg
ggaaactttactgggctttattcatctacagtacctatctttaatcctgaatggcaaactccttcatttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaggagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaagccagacattatttagagactctttggaaggctggtattctatataagagggaatccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatccaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggcattttggggtggagccctcaggctcagggcatattgacaacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707615_FT00000_P-A Feature FT:source JQ707615_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C18). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgctctcaggcaagccattctc
tgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcaatggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707632_FT00000_P-A Feature FT:source JQ707632_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C4). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggcctcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859903_FT00000_P-A Feature FT:source EU859903_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P40). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccaccaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707613_FT00000_P-A Feature FT:source JQ707613_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C15). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactatgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatcccgatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707640_FT00000_P-A Feature FT:source JQ707640_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C14). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacacatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AY934766_FT00000_P-A Feature FT:source AY934766_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 24233). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcggcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggctcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctagcaaaaccaagaaatggggttattccctaaacttcatgg
ggtatgtaattggaagttggggtacattgccacaagatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ctatcctgccttgatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatggacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtgcgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggcaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaatatgggcctaaagattagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtttccttcggagtgtggattcgcactcctccagcctataggccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccccatctttaatcctgaatggcaaactccttctttccctaaaatcca
tttacatgaggacattattaatagatgtcagcaatttgtaggccctctcactgtcaatgaaaagagaaggttgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaaggaattaaaccttattatcctgatcaa
gtagttaatcattacttccagacccgacattatttacatactctttggaaggckggkattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859934_FT00000_P-A Feature FT:source EU859934_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C60). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatgcaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctaccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggaactgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctcttttggagtgtggattcgcactcctccaccctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaattccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaacatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatcccgattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacactca
tcctcaggccatacagtggaa
>gnl|hbvnuc|GQ477486_FT00000_P-A Feature FT:source GQ477486_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P57). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgtaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taaagcaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagagcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaccgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagtaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgcctcatgacttctttccttccgtcagagatctcctagacaccg
ccgcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattcta
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatacatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacgcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgcaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctaaccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatccaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcttccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AF090838_FT00000_P-A Feature FT:source AF090838_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaagaccccaaagtcaggggtctgtattttcctgctggtggctccagttcagaaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gaagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccttttacacaatgtgg
atatcctgccttaatgcccttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggaactgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgctcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttcctaacgtcagagatctcctagacaccg
cctcagctctgtttcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagctattctc
tgctggggggatgtgatgaatctagctacctgggtgggtgctaatttggaagatcaagcatccagggatctagtagtcaa
ttatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttgccttacttttggaagagaca
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaaaattca
tttacaagaggacattattaataggtgtgaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaagttaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagagaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccccagtgtca
acaattcctcctcctgcctccgccaatcggcagtcaggaaggcagcccactcccatctctccacctctaagagacagtca
tcctcaggcgatgcagtggaa
>gnl|hbvnuc|JQ707321_FT00000_P-A Feature FT:source JQ707321_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C31). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttgggggacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctggacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ854700_FT00000_P-A Feature FT:source KJ854700_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 313-N-BRA). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgtctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggctattctctaaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtgtgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttatcctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttgggagtctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgatttctttccttccgtccgggatctacttgatacag
catcagctctgtatcgggaagccttagagtctcctgagcattgctcaccgcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagnag
ttgtcctggagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagatgttgctaatagatgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctaggttctatcctaacagtactaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaaccagacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggatcctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB246335_FT00000_P-A Feature FT:source AB246335_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagaatcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggakcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
gttatgtaattggaagttggggtacattgcctcaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggcttcgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttcttttcctaaaattca
tttacatgaagacattgctaatagatgtcaacaatttgtaggccctctcactgtaaatgaaaaaagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggtggggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggatcactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactccccctcacggaggtgttttggggtggagccctcaggctcagggcatattggcaacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB697501_FT00000_P-A Feature FT:source AB697501_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No19). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatcttctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707566_FT00000_P-A Feature FT:source JQ707566_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C46). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ788725_FT00000_P-A Feature FT:source DQ788725_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate serum 07/92). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccgtccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgccccatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcccttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtaagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtcgcccgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttgggagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctgtctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatattttcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaatcaggtaggagtgggagcat
tcgggccagggctcacccctccacatggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccacgcagtggaa
>gnl|hbvnuc|EU859946_FT00000_P-A Feature FT:source EU859946_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C155). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggagcattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatacatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaaatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggtcctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ477496_FT00000_P-A Feature FT:source GQ477496_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P94). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatacatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgagtcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacgatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB480038_FT00000_P-A Feature FT:source AB480038_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatcttctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707533_FT00000_P-A Feature FT:source JQ707533_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C11). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagctgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KF922409_FT00000_P-A Feature FT:source KF922409_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3791v4). Complete genome. [Riboviria] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
tactcaaccctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttggcaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatctacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttaggaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taaatcaacagtatatgaacctttaccccgttgcccggcaacggtctggtctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggctataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcggaactgacaattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatcctgcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaaaatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcggaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactggactttactcttctactgtccctgtctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaatttaa
ttatgcctgctagattttatcctaacagtactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcagccaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccccctggggttctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctacagtgcca
gcagttcctcccactgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB775201_FT00000_P-A Feature FT:source AB775201_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB12-0929). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggctattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ692578_FT00000_P-A Feature FT:source FJ692578_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50083). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
gttatgtaattggaagttggggtacattgccacaggagcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacctcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactaaaattaa
ttatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccccgcattcggagc
caattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaagtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgccg
gtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|V00866_FT00000_P-A Feature FT:source V00866_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3200 residues).
ttccactgccttgcaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgatcatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctaagtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gctacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttagccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcatttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatccagagatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtc
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcattcgcaaaggcatggggacgaatctt
tctgttcccaaccctctgggattccttcccgatcatcagttggaccctgcattcggagccaactcaacaaatccagattg
ggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcattcgggccagggctcacccctc
cacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtcaacaattcctcctcctgcctcc
accaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB480036_FT00000_P-A Feature FT:source AB480036_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgcctttcaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggcctatctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AY934773_FT00000_P-A Feature FT:source AY934773_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9414346). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgtcgaacatggac
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttrtcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattaccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
atcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
gtaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggaraccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttttttccttctgtccgggatctacttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagcaattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggcaattttaccgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacacgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattaaaattaa
ttatgcctgctagattttatcccaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattatttccagacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggttaccaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MF925362_FT00000_P-A Feature FT:source MF925362_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BD-HBV05). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccaccgctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccacatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaacatggag
aacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtagaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctaacaaaacaaaaagatggggttattccctgaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttagaaaactacct
gtcaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtcaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgmcagatcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgcctcatgacttctttccgaatgtccgggatctactagatacag
cctcagctctgtttcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggatgtgatgaatctagctacctgggtgggtactaatttggatgatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagata
ctgtccttgagtttttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggccaaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttcttttccaaaaattca
tttacatgaagaccttgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtggttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaatcccatcaaggaccactggccacaagccaaccaggtaggagtgggagctt
tcgggccagggttcactcccccacacggaggtgtcttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB116093_FT00000_P-A Feature FT:source AB116093_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH25). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaactttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaa
cactcaaccctgttcccaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgtgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggccacccgtgtgtcntggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctagcaaaacaaagagatggggttattcactaaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaattaagcattgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttataaggcctttc
taagtaaacaatatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtgctgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgcggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaaagcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatttactagatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaga
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactaaaattaa
ttatgcctgccagattttatcctaacagcactaaatatttgccactagataaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccgtcaaggatcactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattgaccacagtgcca
gcaggtcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707318_FT00000_P-A Feature FT:source JQ707318_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C28). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccgctgtcttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctggtggtggctccagttcaggaa
cagtaaaccgtgctccgaatattgcctctcacatctcgtcaatctccccgaggactggggaccctgtgaggaacgtggac
aatgtcacatcagtgttcaaaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttgggggacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagaataggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccgtgcagtggaa
>gnl|hbvnuc|LC458431_FT00000_P-A Feature FT:source LC458431_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JRC-HB03). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttccygctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ023660_FT00000_P-A Feature FT:source JQ023660_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1160). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccgaatattgcctctcacatatcatcaatctcctcgaggactgggggccctgccacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtgtttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgggtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactcccttaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttagaaaacttcct
atcaatcggcctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
tcagtaaacagtatatgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcgaaactcattgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtgctgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctgtatcgggaagacttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaaggcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaagtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccctcttttcgtaaaattca
tctacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactgaaataaa
tcatgcctgataggttttaccgtaacagcactaaatatttgcctttagacaaaggaattaagccttattatccagatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtgaagccctcaggctcagggcatattggccacggtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggaagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707558_FT00000_P-A Feature FT:source JQ707558_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C38). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ854703_FT00000_P-A Feature FT:source KJ854703_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 65-SE-BRA). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaaactctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaagacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaagcaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggactttgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagacacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatttaktartcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactggactttattcttctactgtccctatctttaatcctgaatggcaaactccctcttttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctcttactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctaggttttatcctaacagtaccaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB480040_FT00000_P-A Feature FT:source AB480040_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatyttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcktggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttrcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatcttctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859949_FT00000_P-A Feature FT:source EU859949_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C152). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagctcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaagaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaatcaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MN585097_FT00000_P-A Feature FT:source MN585097_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MB-146). Complete genome. [Hepadnaviridae] (length=3212 residues).
tgccacaaccttccaccaagctctacaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctcagaatattgcctcgcacatctcgtcaatctccacgaggactggggaccctgtgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaaccaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggatattccctacacttcatgg
gatatgtaattggtagttggggaacattgccacaggatcatattatacacaaaatcaaagaatgttttagaaaactgccg
gttaataggcctattgattggaaagtatgtcaaaggattgtgggtctcttgggctttgctgccccattcacacaatgtgg
gtaccctgctttaatgcctttgtatgcatgtattcaagctaaacaggcttttactttctcgccaacttataaggcctttc
taagtaaacagtatctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgttcgctgacgcaaccccc
actggctggggcttggccctaggacatcagcgcatgcgtggaacctttgtggctcctccgccgatccatactgcggaact
ccttgcagcctgttttgctcgctgccggtcaggagcaaatctcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctatcgtccccttctccgtctgccgttccgaccgaccac
ggggcgaacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcggatcctgcccaaggtcttacataagcggactcttggactccctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggtta
aatttaggaggttgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatcatctcttgt
tcatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataaagaatttgg
agctactgtggagttactctcatttttgccttctgacttctttccttccgtccgagatctcctagataccgcctcagctc
tatatcgggaagccttagaatctcctgagcattgcacacctcatcatacagcactcaggcaagcaattcttggctggggg
gaattaatgacgctcgctacctgggtgggcaataatttagaagatccagcatctagagacctagtagttaattatgtcaa
tactaacatgggcctaaagatcaggcaattattgtggtttcatatctcctgtcttacttttggaagagaaactgtgcttg
agtatttggtttcctttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatcttatcaacactt
ccggaaactactgttgttagacgacggggacatggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatc
tccatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaacttt
actgggctttattcttctactgtacctgtctttaatcctgagtggcatactccttcttttcctaagattcatttacatga
ggatattattaataggtgtcaacaatttataggccctcttacagtaaatgaaaaaaggagattaaaactaatcatgcctg
ctaggttctatcctaactgcaccaaatatttgccattagacaaaggaattaagccttattatccagaacatgtagttaat
cattacttccaaaccagacactatttacatactctttggaaggctggtatcctatataagagggaaactacacgtagcgc
ttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggctacccaaacctcgcaaaggcatg
gggacgaatctttcagttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagccaactcaaa
caatccagattgggacttcaaccccatcaaggaccactggccagaagccaatcaggtaggagtgggagcatttgggccag
ggttcacccctccacacggaggtcttttggggtggagcccgcaggctcagggcacattgaccacagtgccagcagttcct
cctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggc
aatgcagtggaa
>gnl|hbvnuc|EU859900_FT00000_P-A Feature FT:source EU859900_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P42). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaaggggatcacccgtgtgtcttgggcaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaagactcttggactcccagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaagcactgggaggagctgggggaagagaataggtta
aaggtctttgtattaggaggctgtaagcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
caaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707601_FT00000_P-A Feature FT:source JQ707601_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C41). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatatcgtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacacttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccggtcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ843186_FT00000_P-A Feature FT:source KJ843186_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag25). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagcgctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattaccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
taagtaaacaatacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgttcccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgattcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatatttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaaaattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaatccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ477477_FT00000_P-A Feature FT:source GQ477477_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P31). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccgtccaccaagatccgcaggaccccaaagtcaggggtctgtgttttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggggaccctgtgaagaacagggag
aacatcacatcaggattcctaggacccctgcacgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctcaaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgccatgcctcatcttcttattggttcttctggattatcaaggtatattgcccgtttgtcctct
aattccaggagcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgcgagcttactctcgtttttgcctcatgacttctttccttccgtcagagatctcctagacaccg
ccacagctctgtttcaagaagccttagagtctcctgagcattgctcatctcaccatactgcaatcaggcaagccattctc
tgctggggggaattgatgtctctagcttcctgggtgggtaataatttggacgatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagata
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtgaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacacactctttggaaggctggtattctatataagaggcaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatcccgattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccacgcagtggaa
>gnl|hbvnuc|JQ707341_FT00000_P-A Feature FT:source JQ707341_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C6). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttgggggacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagccttcaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactggactttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattctgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctcagagacagtca
tcctcaggccgtgcagtggaa
>gnl|hbvnuc|MH580642_FT00000_P-A Feature FT:source MH580642_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 443). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaactttccaccaagctctgcaagatcccagggtcaggggtctgtatttccctgctggtggctccaattcaggaa
cagtaaaccctgttccgaccactgcctctcacatctcatcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggcatacatttaaatcctaacaaaaccaaaagatggggttattccctaaacttcatgg
gatacataattggaagttggggatcactgccacaggatcatattgtacaaaaaatcaaacattgttttagaaaacttccc
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atacccggccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtcaacagtatatgaacctttaccccgttgccaggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacctcttttccatggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggcctctttcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactcttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgtccgagatctcctagataccg
cctcagctctgtatcgggaagcattagagtcacctgagcattgttcacctcaccatacagctctcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatctcttgccttacttttggaagagaaa
ctgtgcttgagtatttggtatcttttggagtgtggattcgcactcctccagcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtacctatctttaatcctcaatggcaaactccttcttttccaaagattca
tttacatgaggacattattaatagatgtcaacaattcgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagcaccaaatatttgcccctagacaaggggattaaaccttattatcctgaacat
gtagttaatcattactttcaggcccgacattatttgcatactctttggaaggctggtattctatataagagggaaactac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggttaccaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccgcaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgactacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagagagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GU563557_FT00000_P-A Feature FT:source GU563557_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-78). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgcggctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggcactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaagctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagaatctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagacccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacactatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KM606737_FT00000_P-A Feature FT:source KM606737_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Cuba13a). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaa
cagtaagccctgttccgaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccaaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagcacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggatcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaataggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgccgctccctttacacagtgtgg
ataccctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctctctcggaaat
atacctcctttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccaacatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactcttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgcggagttactctcatttttgccttctgacttctttccttccgtccgagatctcctagataccg
cctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagagatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctgccttacttttggaagagaaa
ctgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccatggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcccgaatggcaaactccttcttttcctaagattca
tttaaaggaggatattgttaataggtgtcaacaatttgtgggccctctcaccgtaaatgaaaaaaggagactgaaattaa
ttatgcctgctagattttatcctaacagcacaaaatatttgcccctagacaaagggattaaaccttattatcctgatcac
gtagttaatcattacttccagactcgacattatttacatactctttggaaggctggtattctatataagagggaaactac
acgtagcgcctcattctgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggttaccaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggatcactggccacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttttggggtggagccctcaggctcagggcatattgaccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccgtgcagtggaa
>gnl|hbvnuc|KP718095_FT00000_P-A Feature FT:source KP718095_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 8809_TR). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagcgctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggtacattaccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcagaggcaggtcccctagaagaagaaccccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctcttactgtgaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaatccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaycctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacgggggaattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagacaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AY233275_FT00000_P-A Feature FT:source AY233275_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 163). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaa
cacacaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaagactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatctacaacaacgagtacgggaccttgcaagacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgtttcagaaaacttcct
gtcaatcgccctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgcagctccctttacacaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
tgagtaaacagtatatggacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacttcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcagcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggctggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcctttttgccttctgacttctttccttccgtccgggatctacttgatacag
cctcagcactgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaatatgggcctaaaaatcagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctccttcggggtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgcccctatctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaagttaa
ttatgcctgctagattttatcctaacagcacgaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcctcaacacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactggaacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagctt
acggcccagggctcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattgactacagcgcca
gtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ349296_FT00000_P-A Feature FT:source FJ349296_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacagctttccaccaagctctacaagatcccagagtcaggggcctgtattttcctgctggtgggtccagttcaggaa
cagtcagccctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatactaacaaaacaaaaagatggggttattccctgaacttcatgg
gatacataattggaagttggggatcattaccacaggatcatattgtacaaaaaattagacactgttttagaaaacttcct
gttaataggcctattgattggaaagtgtgccaaagaattgtgggtcttttgggctttgccgctccctttacacaatgtgg
ctaccctgctttaatgcctttgtacgcatgtatacaagctaaacaggcttttactttctcgccaacttacagggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcacaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcgggg
ctgaatcccgcggacgacccctctcggggccgcttggggctctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aagttaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatcatctcttgt
acatgtcccactcttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataaagaatttgg
agctactggggagttactctcttttttgccttctgacttctttccttccgttcgagatcttctaaacaccgcctcagctc
tctatcgggaagccctaaagtctcctgggcattgctcacctcaccatacagcactcaggcaagccattctctgctggggg
gaattaatgactctagctacctgggtgggcaataatttggaaaatccagcatccagggatctagtagtcaattatgttaa
tactaacatgggcctaaagatcaggcaactatgggggtttcatatttcttgtcttacttttggaagagaaacagtacttg
agtatttggtctctttcggagtgtggattcgcactcctccagcatatagaccacaaaatgcccctatcttatcaacactt
ccggaaactactgttgttagatgtagggaccgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatc
tcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaacttt
actgggctttattcctctactgtacctatctttaatcctgaatggcaaactccttcttttcctaagatacatttacatga
agacattattgataggtgtcagcaatttgtgggccctctcactataaatgaaaagagaagattaaaattgattatgcccg
ctagattctatcctaacagcacaaaatatttgccactagacaaaggaattaaaccttattatcctgatcaggtggttaat
cattactttcagacccgtcattatttacatactctgtggaaggcgggtattctatataagagggaaactacacgtagcgc
ctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggacatcaaaacctcgcaaaggcatg
gggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagccaactcaaa
caatccagattgggacttcaaccccatcaaggaccactggccagcagccaatcaggtaggagtgggagcatttgggccag
ggttcacccctccacacggaggtattctggggtggagccctcaggctcagggcacattgactaccgtgccaacagttcct
cctcctgcctccaccaatcggcagtcaggaaggcagccgactcccatctctccacctctaagagacagtcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|KT749837_FT00000_P-A Feature FT:source KT749837_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL15). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707332_FT00000_P-A Feature FT:source JQ707332_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C41). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaagaagatggggttattccctaaacttcatgg
gttacgtaattggaagttgggggacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaattcggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaaa
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaagacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatattttcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtgggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707399_FT00000_P-A Feature FT:source JQ707399_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C6). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatgcggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707542_FT00000_P-A Feature FT:source JQ707542_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C21). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttaccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgagaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB453979_FT00000_P-A Feature FT:source AB453979_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH1). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatcttctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB775200_FT00000_P-A Feature FT:source AB775200_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB12-0925). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggctattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707676_FT00000_P-A Feature FT:source JQ707676_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_42). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctttcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgattggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaagtatttgcccttagataaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707312_FT00000_P-A Feature FT:source JQ707312_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C22). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttgggggacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttaatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
tcatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttctggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KF922417_FT00000_P-A Feature FT:source KF922417_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v4). Complete genome. [Riboviria] (length=3221 residues).
ttccacagcttgtcatcaagctctgcaagatcccagagtcaggggcctgtatttccctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgacgactggggaccctgtgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtatctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggaacaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattccctaaactttatgg
gctatgtaattggaagttggggtacgttgccacaggatcatattgtacaaaaaatcaaatgctgttttagaaaacttcct
gtcaatagacctatcgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
tgagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctagggtgtactgccaactggattcttcgcggaacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccctcgaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagtcgggggaggagatgaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagtacgggatttacttgatacag
catcagctctgtatcgggaagccttagaatctccggagcattgctcccctcaccatacagcactcaggcaagccattcta
tgctggggggatgtaatgaatctagctacttgggtgggtactaatttggaagacccagcatccagggatcaagtagttaa
ttatgttaatattaacatgggcataaagattagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttagtttctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcatcacttccggaaactactgttgttagacgatgaggccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctaattttaatcctgaatggcaaactccttcctttcctaaaattca
tttacatggggacattattaataggtgtcagcaatttgtaggccctctcactgcaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattttatcctaacagcactaaatacttgcctctagacaaagggattaaaccttattatcctgaccaa
gtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatccaaacctcgc
aaaggcatggggacgaatctttctgttccaaaccctctgggattccttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttctggggtggagccctcaggctcagggcatattggctacattgcca
gcaattcctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatacagtggaa
>gnl|hbvnuc|KX827298_FT00000_P-A Feature FT:source KX827298_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate geno9.4). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgtcttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aactccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattgggagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggctttgctgccccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgagcgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctccgctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcga
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctactcacactaaatatttgcccttagacaaagggattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatccaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707310_FT00000_P-A Feature FT:source JQ707310_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C20). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttgggggacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctggacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KM519453_FT00000_P-A Feature FT:source KM519453_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_Wild_SA). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaactttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagcccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttaggaaacttcct
gtcaatcgacctatagattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggccttcactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgatccctcacggggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgctgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtttttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagatactg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggcaataatttggaagatccagcatccagggatctagtagttaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttacggggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctagattttatcctaacagtactaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttgcatactctttggaaggctggaatcctatataagagggaaactac
acgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KP168423_FT00000_P-A Feature FT:source KP168423_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate NRB517). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctatattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgtcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgttattggaagttggggtacattgccacaggatcatatcatacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatctatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtacacagtacatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggcctctatcgtccccttctacgtctaccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttacagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattcty
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactggactttattcctctactgtccctatctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattaaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcccctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattacttccaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaaccac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggcctcaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AY233281_FT00000_P-A Feature FT:source AY233281_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 303). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cacacaaccctgttccaaatattgcctctcacatctcgccaatctcctcgaagactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatctacaacaacgagtacgggaccttgcaagacctgcacgactcctgctcaaaacaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgtttcagaaaacttcct
gtcaatcgccctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgcagctccctttacacaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
tgagtaaacagtatatggacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacttcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcccgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aggatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcagcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctacttgatacag
cctcagcactgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaatatgggcctaaaaatcagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctccttcggggtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaagttaa
ttatgcctgctagattttatcttaacagcattaaatatttgcctctagacaaagggattaaaccttattatccagatcaa
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcctcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagaccgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagctt
acggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattgactacagcgcca
gtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707417_FT00000_P-A Feature FT:source JQ707417_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C44). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctatattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KX357643_FT00000_P-A Feature FT:source KX357643_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MK156ETH). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacgaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctgaatttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttctgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaaatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aagatttatgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagacacag
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcacatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacattactaacaggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtggttcatcattactttcaaacccgacattatttgcatactctctggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaactcctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB937793_FT00000_P-A Feature FT:source AB937793_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-0302). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AY934763_FT00000_P-A Feature FT:source AY934763_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ik3346). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacggggccttgcagaagctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttataccctaaacttcatgg
gttacagaattggaagttggggatcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccctttacacaatgtgg
ataccctgccttaatgcctttatatgcatgtattcaagctaagcaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcctgttttgctcgcagcaggtctggggcaaaactcatcgggactgataattctgtcgtcctctctcggaaat
atacatcctttccatggctgctaggatgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctatcgtccccttctccgtctgccgtaccgaccgacgac
ggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgagatctcctggacaccg
cctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtacttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtacctatctttaatcctgaatggcaaactccttcttttcctaagattca
tttacatgaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctaacagcactaaatatttgcccctagacaaagggattaaaccttattatcctgatcag
gtagttaatcattacttccaaactcgacattatttacatactctgtggaaggctggtattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggttaccaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgaacatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccaaaagccaatcaggtaggagtgggagcat
ttggaccagggttcacccccccacacggaggtgttctggggtggagccctcaggctcagggcatattgactacagtgcca
gcagttcctcctactgcctccaccaatcggcagtcaggaaggcaacctactcccatatctccacctctaagagacagtca
cccccaggcagtgcagtggaa
>gnl|hbvnuc|HM011485_FT00000_P-A Feature FT:source HM011485_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagcgttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttcccaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccatgcaaaacctgcacgacttctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgcttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgaatccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggatattccctgaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtggtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcrgcg
ctgaatcccgcggacgacccctcgcgcggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttacatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttayataagcggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttg
aaggtgtttgttttaggaggctgtaggmataaattggtctgcgcaccatcatcatgtaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggctggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgcwcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggatgatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctgccttacttttggaagacaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccaaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccctcttttcctaaaattca
tttacatgaagacattattaataggtgtcagcaatttgtaggccctcttactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaaggaattaaaccttattatcctgatcag
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatataagagggaaactac
acgtagcgcctcattctgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaacccgctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaagaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggctcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattgaccacggtgcca
gcagttcctcctcctgcctccaccaatcggcaggcaggaaggcagcctactcccatctctccacctctaagagaaagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AM282986_FT00000_P-A Feature FT:source AM282986_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaatatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggaacaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaaccttcggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacgttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcctgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttcaaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcgaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ692580_FT00000_P-A Feature FT:source FJ692580_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50085). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
gttatgtaattggaagttggggtacattgccacaggagcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacctcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactaaaattaa
ttatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccccgcattcggagc
caattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaagtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgccg
gtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ843173_FT00000_P-A Feature FT:source KJ843173_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag11). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattaccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcatatatcttgccttacttttggaagagaga
ctgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaatccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggaagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707652_FT00000_P-A Feature FT:source JQ707652_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C34). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgcttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaatcaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MH464825_FT00000_P-A Feature FT:source MH464825_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA103). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaggctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagacttgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccagggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttataccgctgt
tactaattttcttttgtctttgggtatacatttaaaccctaacaaaacgaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttaggaaacttcct
gtcaatcgacccattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taaatcaacagtacatgaacctttaccccgttgcccggcaacggtctggtctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggctatcggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcggaactgacaattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtatcatccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataaaaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccattctcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggttggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttcccccggtccgggatctacttggaacag
ccgcagctctgtatcgggaagccttagagtcttctgatcattgttcacctcaccatacagcactcaggcaagcccttcta
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatcctgcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctcttttggagtgtggattcgcacacctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtg
ggaaatttcactgggctctactcttctactgtccctgtctttaatcctgaatggcaaactccttcctttcctaaaattca
tttacaggaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattacttccagaccagacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcagccaagcctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccagcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctacactgcca
gcagttcctcccactgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MT426093_FT00000_P-A Feature FT:source MT426093_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3864 transfection clone). Complete genome. [Riboviria] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattgggagttggggaactttgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggagct
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcgggactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccctctcggggccgcttgggactttctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaaccttatcatccagatcag
gtggttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatccaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB194951_FT00000_P-A Feature FT:source AB194951_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMR82). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaaatttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaa
cagtcaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggggtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttggctttgggcatacatttaaaccctaacaaaacaaaaagatggggttattcccttaacttcatgg
gatacataattggaagttggggatcattgccacaggatcatattgtacaaaaacttaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ataccctgctttaatgcctttgtatgcatgtatacaagctagacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcattgggactgataattctgtcgtcctttctcggaaat
atacatcttttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccctctcggggccggttgggactctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtagagttactctcgtttttgccttctgacttctttccttccgtccgagatctcctagataccg
cctcagctctatatcgggaagcccttgagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggatgtaacgaatctagccacctgggtgggtactaatttggaagatccggcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
cagtacttgaatatttggtttctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgttcctatctttaatcaggaatggcaaactccttcttttcctaagattca
tctacatgaggacattattaatagatgtcaacaatttgtgggccctctcaatgtaaatgaaaaaagaagattgaagttaa
ttatgcctgctagattttatcctaatagtaccaaatatttgcccctagacaaagggattaaaccttattaccctgatcat
gtagttaatcattactttcaggcaagacattatttacatactctttggaaggctggtattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggttaccaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaacccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacatggaggcgttctggggtggagccctcaggctcagggcacattgactacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaagaagacagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859919_FT00000_P-A Feature FT:source EU859919_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P19). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttcctctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ477466_FT00000_P-A Feature FT:source GQ477466_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P12). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattaccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggatctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcttgcccaaggtcttatataagcggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagactaggtta
atgatttttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctrgacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacatcaccatactgcactcaggcaagccgttctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatctatcttgccttatgtttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgcaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctctggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatccaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccccccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB937791_FT00000_P-A Feature FT:source AB937791_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB05-0890). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaactttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcgcgaggtcgcttgggactgtatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacatttctaataggtgtcaacaatttgtaggccctctcactgtaaatgaaaagagacgactgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggcaacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ331047_FT00000_P-A Feature FT:source GQ331047_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-56). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaaccttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttcagaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgtaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctcgactcgtggtggacttctctcaattttctagggggatcacccgcgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggaaccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctat
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaagagatggggttactccctaaacttcatgg
gatatgtaattggaagttggggaacattaccacaggatcatattgcacaaaaacttaaacactgttttagaaaacttcct
gttaataggcctattgattggaaggtatgtcaacgaattgtgggtcttttgggctttgccgctccttttacacaatgtgg
ataccctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccattggccatcagcgcatgcgcggaacctttgcggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcttttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggtcgcttgggactctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactctcatcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtgtgtttaaggactgggaggagtcgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccctataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctccttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgtcttacttttggaagagaaa
ctgtgcttgagtatttggtttctttcggagtgtggattcgcactcctcctgcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagggaccgaggtaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcaaaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtg
ggaaattttactgggctttattctactactgtacctacctttaatcctgattggcaaactccttcttttcctaagattca
tttacatgaggacattattaataggtgtcaacattttgtgggccctcttactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctaggttctatcctaccagcactaaatatttgcccctagacaaagggattaaaccctattatccagatcag
gtagttaatcattacttccagactcgacattatttacatactctttggaaggctggtattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaacacctcgc
ataggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttttggggtggagccctcaggctcagggcatattgaccacagtgcca
aaggttcctcctcctgcctcgaccaatcggcagtcaggaaggcagccgactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GU563546_FT00000_P-A Feature FT:source GU563546_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-66). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtgaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgccattagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AJ344115_FT00000_P-A Feature FT:source AJ344115_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBsAg negative patient X27). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaagacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcattttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctca
aactacaagatcaacaacaaccagtacgggatcatgcaaaacctgcacgattcctgctcgcggcaaatctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaagctaccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctagcaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtaggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcttgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggatcctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggcactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgttctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttatataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatttttgtgttaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctt
tgctggggggaattgatgactctagcttcctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgtcaatactaacatgggtttgaagatcaggcaactattgtggtttcatatatcttgcctcacttttggaaaagata
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcatcacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaccaacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttcaaaaccagacattatttacatactctttggaaggctggtattttatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcacattgaccacagtgcca
acaattcctcctcctgcatccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctcagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ477491_FT00000_P-A Feature FT:source GQ477491_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P75). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaaatctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaccaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattaccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcttgcccaaggtcttacacaagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccacgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagcttctgtggacttactctcttttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcattcatcttgcattacttttggaagagata
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccactaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctagggaacctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgcaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctctggaaggcgggtattctatataagagggaaactac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatccaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccccccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707616_FT00000_P-A Feature FT:source JQ707616_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C2). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaggttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ477494_FT00000_P-A Feature FT:source GQ477494_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P80). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacggggccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
cctgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatattgtattgggggccaagtctgtacaacatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtattcatttaaaccctaacaaaaccaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacrcaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacrtcgtttccatggctgctaagctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgcctactgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgtgcta
tgctggggggaattgatgactttagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctgtctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagaccag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttcggttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaatcccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707628_FT00000_P-A Feature FT:source JQ707628_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C33). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctcggcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcaca
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgcttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
gaccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KU605532_FT00000_P-A Feature FT:source KU605532_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1486Baseline). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgtctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcctaggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggcaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgccattagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaacactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707638_FT00000_P-A Feature FT:source JQ707638_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C12). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggagttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ854707_FT00000_P-A Feature FT:source KJ854707_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 895-N-BRA). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaagagatggggctattccctaaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtaaatcggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgctttaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcacgaggccgcttgggaatctatcgtccccttctccgtctgccgtaccatccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcaccgcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaaccctgaatggcaaactccttcttttcctaaaattca
tttacatgaagatgttgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctaggttctatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaaccagacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggatcctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
tcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KU605537_FT00000_P-A Feature FT:source KU605537_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM4643F1). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccacagagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgtctctcacatctcgtcaatctcctcgacgactggggaccctgtgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
tcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaaccacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattccctaaactttatgg
gctatgtaattggaagttggggtacattaccacaggaccatattgtacaaaaaatcaaatgctgttttagaaaacttcct
gtcaatagacctatcgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgggatctacttgatacag
catcagctctgtatcgggaagccttagaatctccggagcattgctcccctcaccatacagcactcaggcaagccattcta
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatttagtagtcaa
ttatgttaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttagtctctttcggagtgtggatacgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
gggaattttactgggctttattcctctactgtccctaattttaatcctcaatggcaaactccttcctttcctaaaattca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcccgctagattttatcctaacagcactaaatacttgcctctagacaaaggaattaaaccttattatcctgatcaa
gtagttaatcattacttccagaccagacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttccaaaccctctgggattccttcccgatcatcaactggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacattgcca
acagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB116088_FT00000_P-A Feature FT:source AB116088_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-NEP30). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgggtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaayttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggttctgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttatgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
gttatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaamtcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggcttcgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtcaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgcggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccctcaggtcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcagcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacctttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctatttcgggaagccttagagtctcctgagcattgctcatctcaccatacagcactcaggcaagccattgta
tgctggggggaattaatgactctaggtacctgggtgggtaataatttggaagatccagaatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgcctcacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacaacgaggccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgattggcaaactccttcttttcctaaaattca
tttacatgaagacattgctaataggtgtcaacaatttgtaggccctctcactgtaaatgaaaaaagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttacgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggatcctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtgggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707337_FT00000_P-A Feature FT:source JQ707337_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C46). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcactaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttgggggacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtcaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctggacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactggactttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcgtggggacgaatctttctgtccccaaccatctgggattctttcccgatcatcagttggaccctgcattcggaga
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KF922406_FT00000_P-A Feature FT:source KF922406_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3791v1). Complete genome. [Riboviria] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
tactcaaccctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatctacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttaggaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taaatcaacagtatatgaacctttaccccgttgcccggcaacggtctggtctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggctataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcggaactgacaattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatcctgcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactggactttactcttctactgtccctgtctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaatttaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcagccaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctacagtgcca
gcagttcctcccactgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859922_FT00000_P-A Feature FT:source EU859922_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P09). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ692593_FT00000_P-A Feature FT:source FJ692593_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48054). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacagctttccaccaagctctgcaaratcccaaagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcgcatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgcwcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggcttttccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgccgt
aaccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggatcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggcttttactttctcgccaacttacaaggcctttc
taagtacacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacctktataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgtccgagatctcctagataccg
cctcagctctgtttcgggaagcattagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattcta
tgctggggggaattaatgactctagctacctgggtgggtaataatttggacgatccagtatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaggatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctataraccacaaaatgcccctatctta
tcaacacttccggaaactrctgttgttagacgacgaggcaggtcccctagaagacgaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttgsactcataaggtgggaaat
tttactgggctttattcctctactgtacctagctttaatcctgactggcaaactcctgcttttcctaaaattcatttaca
tgaggacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagaytgaaattgattatgc
ctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaaccttattatcctgatcagatagtt
aatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatataagagrgaaaccactcgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggatatcagcacctcgcaaaggc
atggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccacatcaagaaccactggccacaagccaatcaggtaggagtgggagcatttgggc
cagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgactacagtgccagcagtt
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX357647_FT00000_P-A Feature FT:source KX357647_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BL13ETH). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaactttccaccaaactctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctgaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttaggaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtaggtcttctgggctttgccgctccatttactcaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcgaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccaaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccattggatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aagatttatgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagacacag
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgactggcaaactccttcttttcctaaaattca
tttacatgaagacattgctaacaggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtggttaatcattactttcaaacccgacattatttgcatactctctggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaacacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattcttccccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB116089_FT00000_P-A Feature FT:source AB116089_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-NEP39). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcgaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccacgtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctgaatttcatgg
gttatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggcttcgccgctccatttacacaatgcgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taaatgcacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggatgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgcggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccaccaggtcctgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcagcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtgcagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcatcatacagcactcaggcaagccagtctc
tgctgggtggaattaatgactctagctacctgggtggggaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaag
ttgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttcttttcctaaaattca
tttacatgaagacattgctaataggtgtcaacgatttgtaggccctctcactgtaaatgaaaaaagaagactaaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtcttttggggtggagccctcaggctcagggcatattgaccacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|HE576988_FT00000_P-A Feature FT:source HE576988_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P5.9). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttcaagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggaaggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcatttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaataataacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggcgggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KR905426_FT00000_P-A Feature FT:source KR905426_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICI-28). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcaccgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattctctaggggaatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgcccgtttgttctct
aattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactgctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggggtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
gttatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
actagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctccacaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcatcatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatcaagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgttcttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acacagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccacatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ692576_FT00000_P-A Feature FT:source FJ692576_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50022). Complete genome. [Hepadnaviridae] (length=3221 residues).
ytccacagctttccaccaarctctgcaagatcccagartcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgctgaatatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtactgggggccaaaactgtacaacatcttgagtccctttatactgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
gttatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacaatatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacctcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcgcggggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgcctactgacttctttccttccgtccgagatctactagatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatacagcactcaggcaagccattctc
tgctgggtggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ttgtccttgagtttttggtctctttcggagtgtggattcgcactcctccaccctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagaggacgaccccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccgtcttttcctaaaattca
tttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactaaaattaa
ttatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaagggattaaaccttattatcctgatcag
gtagttaatcattactttcaaacccgacattatttacatactctgtggaaggctgggatcctatataagagggaaacttc
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaacacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgccg
gtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707606_FT00000_P-A Feature FT:source JQ707606_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C48). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaagggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtatacccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatattgatgatatcgtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttccccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
rcgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MN476102_FT00000_P-A Feature FT:source MN476102_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV.CCC194). Complete genome. [Riboviria] (length=3221 residues).
ttccacagctttccaccaagctctacaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagaggtgggggtattccctgaatttcatgg
ggtatgtgattggaagttggggtactttgccacaggatcatattgtacaaaaaatcaaacaatgttttcgaaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgataattctgtcgtcctttcccggaaat
atacatcatttccatggctgctaggttgtactgccaattggattcttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcgcgcggccgcttgggaatctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctctacgcggtctccccatctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactgttgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttccaaaaattca
tttacatgaagacattattaataggtgtcagcaattcgtaggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaaggaattaaaccttattatcctgatcat
gtagttaatcattactttcaaaccagacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatactcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatactggctacagtgcca
gcagttcctcctcctgcctcctccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707559_FT00000_P-A Feature FT:source JQ707559_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C4). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcytgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707614_FT00000_P-A Feature FT:source JQ707614_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C17). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcgggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MT426095_FT00000_P-A Feature FT:source MT426095_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3912 transfection clone). Complete genome. [Riboviria] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagaaggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgggggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggacatcagcgcatgcgtggaactttagtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttatgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatgtatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctcttcagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattccttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggaggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB937795_FT00000_P-A Feature FT:source AB937795_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1191). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccaccgctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggga
cactcaaccctgttccaaatattgcctctcacatctcatcaatctccttgaagactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
amttccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatrtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatwccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtctgtcagagaattgtaggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgctttaatgcctttgtatgcatgtatacaagcaaaacaggcttctactttctcgccaacttacaaggcctttc
taagtaaacagtatatggacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtccttcctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcccatcagattctgcccaaggtcttacataagtggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgttagtatcccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttcttttccaaaaattca
tttacatgaagacattgctaatagatgccagcaatttgtgggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttccgttcccaaccctctgggattctttcccgrtcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcct
tcgggccagggttcactcccccacacggcggtgttctggggtggagcccgcaggctcagggcatattggccacagtgcca
acagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ692590_FT00000_P-A Feature FT:source FJ692590_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50152). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaactttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacctcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgcggtcgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccgccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagacccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcctgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaacccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707319_FT00000_P-A Feature FT:source JQ707319_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C3). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatctcagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctacgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
cattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttgggggactttgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggacgatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactggactttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagggacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AY233274_FT00000_P-A Feature FT:source AY233274_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 0962). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatactgcctctcacatctcgccaatctcctcgaggactggggaccctgcgtggaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaatttcctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taaatcaacagtatatgaacctttaccccgttgcccggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagcaggtctggagcaaaactcatcggaactgacaattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatcctgcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcatatttcctgccttacttttggaagagaaa
ctgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcaggagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttactcctctactgtccctgtctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcaacaatttgtaggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaaggaattaaaccttattatcctgatcaa
gtagttaatcattactttcagacccgacattatttacatactctttggaaggctgggattctatataagaaggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcagccaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
acagtacctcccactgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ477482_FT00000_P-A Feature FT:source GQ477482_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P46). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctacaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtggcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctca
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgctttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccattataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattatc
tgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagagatctagtagtcaa
ttatgttaatactaacatgggtttaaagctcaggcaactattgtggtttcatatttcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctcaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707386_FT00000_P-A Feature FT:source JQ707386_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C34). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaatttttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttaccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaagaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859915_FT00000_P-A Feature FT:source EU859915_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P07). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ854702_FT00000_P-A Feature FT:source KJ854702_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 41-CW-BRA). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
atcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaattggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagacacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcgctcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttagaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactatccctatctttaatcctgaatggcaaactccctcttttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctcttactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctaggttttatcctaacagtactaaatacttgcctctagacaaagggattaaaccttattatccggatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KT749846_FT00000_P-A Feature FT:source KT749846_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL4f). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggcctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatctagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctgtctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggagggctggtattctatataagagagaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FN545831_FT00000_P-A Feature FT:source FN545831_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctctgggcatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggatcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatggacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgttgtcctttctcggaaat
atacatcctttccatggctgctaggctgtactgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcgacg
ctgaatcccgcggacgacccctctcggggccgcttggggctctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagtttaggcta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccattatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactattcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgtccgagatctcctagataccg
cctcagctctatatcgggaagcactagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcttgtcttacttttggaagagaaa
cggtacttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtgcctagctttaattctgaatggcaaactccttcttttcctaagattca
tttacatgaggacattattaatagatgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattgaaattga
ttatgcctgctagattctatcctaacagcaccaaatatttgcccctacacaaaggaattaaaccttattatcctgatcag
atagttaatcattactttcaggcccgacattatttacatactctttggaaggctggtattctatataagagggaaaccac
tcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggatatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgactacagtgcca
gcagttcctcctcctgcctccgccaatcggcagtcaggaaggcagcctacacccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707327_FT00000_P-A Feature FT:source JQ707327_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C37). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgattcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttgggggacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagatcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctggacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaagccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707379_FT00000_P-A Feature FT:source JQ707379_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C24-9). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgca