HBVdb

Dataset for nucleotide sequence Genomes of genotype A

[Download (right click)] [Alignment] [Repertoires]

875 sequence(s)

>gnl|hbvnuc|AB014370_FT00000_P-A Feature FT:source AB014370_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 11D11HCC). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaaactctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaacgatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctgggtggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaacattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB064314_FT00000_P-A Feature FT:source AB064314_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgggtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcccttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
gtacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaaatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcactatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatacggcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggttccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttccttccctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB116078_FT00000_P-A Feature FT:source AB116078_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-USA712). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aagatttttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcaagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataacttggacgatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctaaccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB241115_FT00000_P-A Feature FT:source AB241115_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PhCH09). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaactttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttagaaaacttcct
gttaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggctttcactttctcgccaacttacaaggcctttc
taaataaacagtacatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctagggtgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccatcagcg
ctgaatcccgcggacgacccctcgcgcggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggtgaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactatccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagacgactgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttacctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaaccttgctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcagagc
caattcaaacaatccagattgggacctcaaccccgtcaaggacccctggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtcttttggggtggagccctcaggctcagggcatattgaccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB300366_FT00000_P-A Feature FT:source AB300366_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient8). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctctgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgattcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggacttccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatattttcccttagacaaaggaattaaacattattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggactccaaccccatcaaggaccactggccagtagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB300367_FT00000_P-A Feature FT:source AB300367_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient9). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggcactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatcttctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB453981_FT00000_P-A Feature FT:source AB453981_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH3). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggcctatctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB697487_FT00000_P-A Feature FT:source AB697487_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No1). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aatttcaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtktgtttaargactgggaggagytgggggaggagattaggtta
aaggtctttgtaytaggaggctgtaggcataaattggtctgykcaccagcaccatgcaactttttcacctctgcctaatc
atctcwtgtwcatgtccyactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccktataa
agaatttggagctwctgtggagttactctcktttttgccttctgacttctttccttccrtymgagatctyctmgacaccg
cctcwgctctgtatcgrgargccttagagtctcckgarcattgytcacctcaccatacwgcactcaggcaagcyattcts
tgytggggkgarttgatgamtctrgcyacctgggtgggwartaatttggaagayccagcatccagggawytagtagtcar
ytatgtyaatrytaayatgggyytaaaratcagrcaactattgtggtttcayatwtcytgycttacttttggaagagara
ctgtwcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB697489_FT00000_P-A Feature FT:source AB697489_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No3). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatcttctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB697506_FT00000_P-A Feature FT:source AB697506_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No28). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gaagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgtttcagaaaacttccy
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaaccyttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggcctatctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AF090840_FT00000_P-A Feature FT:source AF090840_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggccttcc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtggggcctctcactgtaaatgaaaagggaagattgagattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagaccag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttcggttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctttccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AF536524_FT00000_P-A Feature FT:source AF536524_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccctccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaagacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtattcatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttaggaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcaactctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacccatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AJ344115_FT00000_P-A Feature FT:source AJ344115_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBsAg negative patient X27). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaagacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcattttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctca
aactacaagatcaacaacaaccagtacgggatcatgcaaaacctgcacgattcctgctcgcggcaaatctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaagctaccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctagcaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtaggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcttgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaccctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggatcctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggcactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgttctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttatataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatttttgtgttaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctt
tgctggggggaattgatgactctagcttcctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgtcaatactaacatgggtttgaagatcaggcaactattgtggtttcatatatcttgcctcacttttggaaaagata
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcatcacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaccaacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttcaaaaccagacattatttacatactctttggaaggctggtattttatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcacattgaccacagtgcca
acaattcctcctcctgcatccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctcagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AM184125_FT00000_P-A Feature FT:source AM184125_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate O64). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaagaa
cagtaagccctgttcagaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgcacaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gctacataattggatgttggggatcattgccacaagatcatattgttcagaaaatcaaagattgttttcgaaaactccct
gttaacagacctattgattggaaagtatgtcaacgcattgtgggtcttttgggctttgccgcttcattcacacaatgtgg
ttaccctgctttaatgcctctgtacgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcaaccggtctggagcaaaactcatcgggacggataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggctgtactgccaactggattcttcgcgggacatcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactattcaagcctccaaactgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctcctagataccg
cctcagctctatatcgggaagcactagagtctcctgaacattgctctcctcaccatacagcactcaggcaagccattctc
tgctggggggagttaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaatatgggcctaaagatcagacaactgttgtggtttcatatttcttgccttacttttggaagagaaa
ctgtacttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcacaaggtg
gggaattttactgggctttattcttccactgtacctatctttaatcctgaatggcaaactccttcctttcccaggattca
tttacatgaggacattattaataaatgtcaacaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctaccccaacagcaccaaatatttgccactagacaaagggattaaaccttattatcctgatcat
gtggttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatataagagggaaactac
acgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggttaccaaaacctcgc
aaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgactaccttgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AM184126_FT00000_P-A Feature FT:source AM184126_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N35). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctacaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaagccctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgcacaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctatacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gctacatcattggatgttggggatcattgccacaagatcatattgttcacaaaatcaaagattgttttcgaaaacttcct
gttaatagacctattgattggaaagtatgtcaacgcattgtgggtcttttgggctttgccgctccattcacacaatgtgg
ataccctgctttaatgcctctgtacgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcttttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcacgcggacgacccctctcggggtcgcttgggactctatcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgagatctcctagataccg
cctcagctctatatcgggaagcactagagtctcctgagcattgctctcctcaccatacagcactcaggcaagccattctc
tgctggggggagttaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaatatgggcctaaagatcaggcaactgttgtggtttcatatttcttgccttacttttggaagagaaa
cggtacttgagtatttggtctcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
gggaattttactgggctttattcttctactgttcctatctttaatcctgaatggcaaactccttcttttcccaagattca
tttacatgaggacattattaatagatgtcaacaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctaacagcaccaaatatttgccacttgacaaagggattaaaccttattatcctgatcag
gtagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatataagagagaaactac
acgtagtgcttcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggttaccaaaacctcgc
aaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgactaccgtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tccgcaggccatgcagtggaa
>gnl|hbvnuc|AY233274_FT00000_P-A Feature FT:source AY233274_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 0962). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatactgcctctcacatctcgccaatctcctcgaggactggggaccctgcgtggaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaatttcctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taaatcaacagtatatgaacctttaccccgttgcccggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagcaggtctggagcaaaactcatcggaactgacaattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatcctgcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcatatttcctgccttacttttggaagagaaa
ctgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcaggagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttactcctctactgtccctgtctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcaacaatttgtaggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaaggaattaaaccttattatcctgatcaa
gtagttaatcattactttcagacccgacattatttacatactctttggaaggctgggattctatataagaaggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcagccaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
acagtacctcccactgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AY738141_FT00000_P-A Feature FT:source AY738141_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtcttttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacattacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattctcaaaatatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagttggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
tactaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtgcaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccgtcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcgtggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccaygcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaaatattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatcttcaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggctctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacgggggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccaccgctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AY862867_FT00000_P-A Feature FT:source AY862867_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H4-zhus). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggttccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgcagctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcgggactgacaattctgttgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtccgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccctgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccaccaaggaccactggccagcagccaaccaggtaggagtgggagcat
ttgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ298163_FT00000_P-A Feature FT:source DQ298163_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctaggggaagcacacgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
cctgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatttggtattgggggccaagtctgtacagcatcgtgagtccctttacaccgctgt
tacaaattttctgttgtctctgggtattcatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggcagttggggaacattaccacaggatcatattgtacaaaagatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgctgcgccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcaagtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tacgtcaccagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccctcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggaactgggggaggagaataggtta
atgatttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacacttataa
agaatttggagctactgtggagttgctctcttttttgcctcctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattgtc
tgctggggagaattgatgaatctagccacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtataaagatcaggcaactattgtggtttcatatatcttgcattacttttggaagagaga
ttgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaacattca
tttacaagaggacattattgatcggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtgttctatataagagagaatccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatccaaacctcgc
aaaggcatggggacgaatctttcagttcccaacccgctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggatttcaaccccatcaaggacaactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcagggaggcagcccactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ298165_FT00000_P-A Feature FT:source DQ298165_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggactcctaggacccctactcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctaggggaagcacccgtgtgtcttggccaaaattcgcagtccc
caacccgcaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
cctgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatttggtattgggggccaagtctgtacagcatcgtgtgtccctttacaccgctgt
tacaaattttctgttgtctctgggtattcatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggcagttggggaacattaccacaggatcatattgtacaaaagatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgctgcgccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcaagtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tacgtcaccagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccctcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggaactgggggaggagaataggtta
atgatttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacacttataa
agaatttggagctactgtggagttgctctcttttttgcctggtgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattgtc
tgctggggagaattgatgaatctagctacctgggtgggtaataatttgcaagatccagcatccagggatctcgtagtcaa
ttatgttaatactaacatgggtataaagatcaggcaactattgaggtttcatatatcttgcattacttttggaagagagg
ttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgggaccgaggctggtcccatagaagaagaactccctcgcctcgcag
acgcagatcccaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttagtattccgtggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaacattca
tttacaagaggacattattgatcggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaatccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatccaaacctcgc
aaaggcatggggacgaatctttcagttcccaacccgctgggattctttcccgatcatcagttgggccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcaccccaccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcagggaggcagcccactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU414133_FT00000_P-A Feature FT:source EU414133_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaaaaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacaaaagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccctgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttccgccagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctgggcggatgtgacgaatctagctacctgggtgggtaataatttggaagatcaagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatacatcttgccttacttttggaagagaga
ctgtacttgaatatttrgtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacggaaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatscagatcag
gtagttaatcattacttcmaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaacaggtrggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594388_FT00000_P-A Feature FT:source EU594388_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggcgggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594389_FT00000_P-A Feature FT:source EU594389_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaaatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggtcctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctaaccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccagccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594391_FT00000_P-A Feature FT:source EU594391_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattctctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtgttaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggacctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccaacagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859907_FT00000_P-A Feature FT:source EU859907_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P29). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcagggatctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859908_FT00000_P-A Feature FT:source EU859908_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P28). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859909_FT00000_P-A Feature FT:source EU859909_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P31). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859911_FT00000_P-A Feature FT:source EU859911_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P26). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgcacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtaccgatctttaatcctgactggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859912_FT00000_P-A Feature FT:source EU859912_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P23). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttggtagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859918_FT00000_P-A Feature FT:source EU859918_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P17). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859935_FT00000_P-A Feature FT:source EU859935_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C14). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctaaccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859938_FT00000_P-A Feature FT:source EU859938_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C133). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccacgtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcctgttttgctcgcagccggtctggagcaaaactcatcggcacggacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcgtgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagagaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctaccgcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccgtgcagtggaa
>gnl|hbvnuc|EU859939_FT00000_P-A Feature FT:source EU859939_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C130). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctacaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccacgtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacattattggaagttggggaacattaccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttggggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtgaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaagccatgcagtggaa
>gnl|hbvnuc|EU859952_FT00000_P-A Feature FT:source EU859952_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C56). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaaccttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttcagaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgtaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctcgactcgtggtggacttctctcaattttctagggggatcacccgcgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggaaccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctat
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaagagatggggttactccctaaacttcatgg
gatatgtaattggaagttggggaacattaccacaggatcatattgcacaaaaacttaaacactgttttagaaaacttcct
gttaataggcctattgattggaaggtatgtcaacgaattgtgggtcttttgggctttgccgctccttttacacaatgtgg
ataccctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccattggccatcagcgcatgcgcggaacctttgcggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcttttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggtcgcttgggactctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactctcatcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtgtgtttaaggactgggaggagtcgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccctataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctccttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgtcttacttttggaagagaaa
ctgtgcttgagtatttggtttctttcggagtgtggattcgcactcctcctgcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagggaccgaggtaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtg
ggaaattttactgggctttattctactactgtacctacctttaatcctgattggcaaactccttcttttcctaagattca
tttacatgaggacattattaataggtgtcaacattttgtgggccctcttactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctaggttctatcctaccagcactaaatatttgcccctagacaaagggattaaaccctattatccagatcag
gtagttaatcattacttccagactcgacattatttacatactctttggaaggctggtattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaacacctcgc
ataggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttttggggtggagccctcaggctcagggcatattgaccacagtgcca
aaggttcctcctcctgcctcgaccaatcggcagtcaggaaggcagccgactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ692554_FT00000_P-A Feature FT:source FJ692554_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_24063). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaaactctacaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgctccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcaaaagctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctctgggcatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggatcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaactccct
gtcaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatggacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcctatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtgtttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgttcgagatctcctagataccg
cctcagctctatatcgggaagcactagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtacttgagtatttggtctcttttggagtgtggattcgcactcctccagtctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctccactgtacctagctttaatcctgaatggcagactccttcttttcctaagattca
tttacatgaggacattattaatagatgtcaacaatttgtgggccctcttactgtaaatgaaaagagaagattgaaattga
ttatgcctgctagattctatcctaacagtaccaaatatttgcctctacacaaagggattaaaccttattatcctgatcag
atagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatataagagggaaaccac
tcgtagcgcctcattttgcgggtcaccatattcctgggaacaagagctacatcatgggaggttggatatcaaaacctcgc
aatggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaagcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcacattgactacagtgcca
gcagttcctcctcctgtctccgccaatcggcagtcaggaaggcagcctacacccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ692561_FT00000_P-A Feature FT:source FJ692561_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48040). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaactttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggccacacgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtactgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
gctatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacaatatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacctcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttcgcggggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttatataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagaytaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcmtcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcttttttgcctymtgacttctttccttccgtccgggatctactagatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggatgtaatgactctagctacctgggtgggtactaatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaayatgggcctaaaaatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttyggagtgtggattcgcactcctccaccytatagaccaccaaatgcccctatctta
tcaacacttccggaractgctgttgttagatgtcgagcccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccgtcttttcctaaaattca
tttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactaaaattaa
ttatgcctgctagrttttatcctaacagcaccaaatatttgcctctagacaaagggattaaaccttattatcctgatcag
gtagttaatcattactttcaaacccgacattatttacatactctgtggaaggctggratcctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaycctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaggtrggagtgggagcat
tcgggccagggttcactcccccacacggaggtgtkttggggtggagccctcaggctcagggcatattggccacagtgccg
gtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ692600_FT00000_P-A Feature FT:source FJ692600_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50034). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatyacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgyaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggatcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggcttttactttctcgccaacttacaaggcctttc
taaatacacagtatatgaacctttaccccgttgctcggcaacggccgggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggayattgacccttataa
agaatttggagctactgtggagttactctcttttttgcctactgattactatccwtccgtccgagatctcctagataccg
cctcagctctstatcgggawgcattagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccatwctm
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatcwagtagtcaa
ttatgttaatmataacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagata
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgasaccgaggcaggtcccctagaagacgaactccctcgcctcgcag
acgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttcctttcctaaaattca
tttacatgaggacattattaatagatgtcaacaatttgtgggcyctctcactgtaaatgaaaagagaagattgaaattga
ttatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaaccttattatcctgatcag
atagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatataagagggaaaccac
tcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggatatcaacacctcgc
aaaggcatggggacgaatctttckgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccacatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgactacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacwcccatctctccaccyctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ692605_FT00000_P-A Feature FT:source FJ692605_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50059). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaarctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatcttgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttckaggggratctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagwctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggatcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggcttttactttctcgccaacttacaaggcctttc
taagtacacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgagtgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccmttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgtccgagatctcctagataccg
cctcrgctctgtatcgggaagcattagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggawgatccagcrtccagggatctagtagtcaa
ttatgttaatactmacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ytgtacttgaatatttggtctctttcggagtgtggatacgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgtactccctcgcctcgcag
acgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaayctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaggacattattaatagatgtcaacaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattga
ttatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaaccttattatcctgatcag
atagttaatcattacttccaggctcgacattatttacatactctctggaaggctggtattctatataagagggaaaccac
tcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggtyggatatcaacacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccacatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgactacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ692606_FT00000_P-A Feature FT:source FJ692606_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50061). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccccagttttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattccyargacccccgctcgtgttacaggcggggtctttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtatctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccamcagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtgattggaagttggggatcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtctattgggctttgccgccccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggcttttactttctcgccaacttacaaggcctttc
taagtacacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgtccgagatctcctagataccg
cctcagctctgtatcgggaagcattagagtctcctgagcattgcacacctcaccatacagcactcaggcaagccattctc
tgctggggggagttaatgactctagctacctgggtgggtaataatttggacgatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagacaaa
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaactccctcgcctcgcag
acgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttcttttcctaagattca
tttacatgaggacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattga
ttatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaaccttattatcctgatcag
atagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatataagagggaaaccac
tcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggatatcaactcctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccacatcaaagaccactggccacaagccaatcaggtaggagtgggagcat
ttggcccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgactacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacccatctctccacctctaagagacagcca
tcctcaggccatgcaatggaa
>gnl|hbvnuc|GQ184324_FT00000_P-A Feature FT:source GQ184324_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1122). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttacactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttctttttggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgacttctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcctgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactctggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgccattagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctccgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccacgcagtggaa
>gnl|hbvnuc|GQ477478_FT00000_P-A Feature FT:source GQ477478_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P34). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgaaggataccagagtcaggggtctgtattctcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgattcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtccaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaaagaattgtgggccttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggctttgccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagcttatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttacctactgactactatccttccgtcagagatcttctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagaccaccaaatgcccctatctta
tcaacacttccggaaaatactgttgttagaccacggggccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaatattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagaggaaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaatcccatcaaggaccactggccagcagccaaccaggtaggagcgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ477480_FT00000_P-A Feature FT:source GQ477480_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P41). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcagaatcccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctaggggaatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgtccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagaataggtta
atgatttttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagcttctacggagttactctcgtttttgccttctgacttctttcctaacgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgcacacctcaccatactgcactcaggcaagccgttctc
tgctggggggaattgatgaatctagctacctgggtgggtagtaatttgcaagatccagcatccagggatctagtagtcaa
ttatgtcaatactaacatgggtttaaagttcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagatgtcgggaccgacgcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacgcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcaccgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagagaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagatacagcatgggaggttggtcatccaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaacccaatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggcattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ477488_FT00000_P-A Feature FT:source GQ477488_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P64). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaagttcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcatgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattaccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtaggtcttttgggctttgctgccccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctttctcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccacgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgcctgctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacatcaccatactgcaatcaggcaagccattctc
tgctggggggaattgatgactctagcttcctgggtgggtaataatttggatgatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ttgtacttgaatttttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctactgtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggatattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctctggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattctgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ477502_FT00000_P-A Feature FT:source GQ477502_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P123). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagaatctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagctatatggatgatgtggtattgggggccacatctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaacccaaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaaaactgttttcgaaaacttcct
gttaacaggcctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacgggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaggctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagagtaggtta
atgatttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagctactgtggagttactctcgtttttgcctgctgacttctttcctaacgttagagatctcctagacaccg
cctcagccctatatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggacttgatgaatctagctacctgggtgggtggtaatttgcaagacccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttcaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagaccacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactcataaggtg
ggaaacttttctgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacatcattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctgcccatactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaagccagacattatttacatactctttggaaggcgggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatccaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtatca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GU563554_FT00000_P-A Feature FT:source GU563554_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-25). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaaaaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctctgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|HE576988_FT00000_P-A Feature FT:source HE576988_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P5.9). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttcaagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggaaggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcatttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaataataacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggcgggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|HE576989_FT00000_P-A Feature FT:source HE576989_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P2.2.11). Complete genome. [Hepadnaviridae] (length=3221 residues).
tcccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggaaggaaattgcacctgtattcccatcccattgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcatttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgattggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggcgggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|HM011485_FT00000_P-A Feature FT:source HM011485_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagcgttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttcccaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccatgcaaaacctgcacgacttctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgcttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgaatccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggatattccctgaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtggtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcrgcg
ctgaatcccgcggacgacccctcgcgcggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttacatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttayataagcggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttg
aaggtgtttgttttaggaggctgtaggmataaattggtctgcgcaccatcatcatgtaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggctggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgcwcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggatgatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctgccttacttttggaagacaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccaaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccctcttttcctaaaattca
tttacatgaagacattattaataggtgtcagcaatttgtaggccctcttactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaaggaattaaaccttattatcctgatcag
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatataagagggaaactac
acgtagcgcctcattctgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaacccgctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaagaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggctcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattgaccacggtgcca
gcagttcctcctcctgcctccaccaatcggcaggcaggaaggcagcctactcccatctctccacctctaagagaaagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|HM535200_FT00000_P-A Feature FT:source HM535200_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 947 Harare). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgttgaacatggag
aacatcacatcgagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttaggaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taaatcaacagtatatgaacctttaccccgttgcccggcaacggtctggtctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggctataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcggaactgacaattctgtcgtcctgtctcggaaat
atacatcttttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatccgatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaaaatcagacaactattgcggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttactcctctactgtccctgtctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattacttccagacccgacattatttacatactctttggagggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcagccaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctacagtgcca
gcagttcctcccactgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707307_FT00000_P-A Feature FT:source JQ707307_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C18). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttgggggacattgccccaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactggactttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707330_FT00000_P-A Feature FT:source JQ707330_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C4). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttgggggacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtcaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctggacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattctgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707388_FT00000_P-A Feature FT:source JQ707388_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C37). Complete genome. [Hepadnaviridae] (length=3221 residues).
cgccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctactagtcaa
ttatgttaatggtgacatgggtttaaaaattaggcaactagggaggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707393_FT00000_P-A Feature FT:source JQ707393_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C42). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707396_FT00000_P-A Feature FT:source JQ707396_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C47). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatattaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707419_FT00000_P-A Feature FT:source JQ707419_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C48). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctccttgacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccggggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcagaccatgcagtggaa
>gnl|hbvnuc|JQ707536_FT00000_P-A Feature FT:source JQ707536_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C14). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattctctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaaaaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctacgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707538_FT00000_P-A Feature FT:source JQ707538_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C16). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattccttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707547_FT00000_P-A Feature FT:source JQ707547_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C27). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgttgtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctgt
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707556_FT00000_P-A Feature FT:source JQ707556_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C35). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707568_FT00000_P-A Feature FT:source JQ707568_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C48). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtttgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgtttccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707612_FT00000_P-A Feature FT:source JQ707612_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C13). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcctgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707614_FT00000_P-A Feature FT:source JQ707614_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C17). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcgggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707615_FT00000_P-A Feature FT:source JQ707615_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C18). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgctctcaggcaagccattctc
tgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcaatggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707645_FT00000_P-A Feature FT:source JQ707645_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C24). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggttggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707647_FT00000_P-A Feature FT:source JQ707647_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C27). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtattttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707648_FT00000_P-A Feature FT:source JQ707648_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C28). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactatgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707669_FT00000_P-A Feature FT:source JQ707669_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_28). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctacacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtaggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgattggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaagtatttgcccttagataaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707672_FT00000_P-A Feature FT:source JQ707672_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_32). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgattggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaagtatttgcccttagataaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JX096952_FT00000_P-A Feature FT:source JX096952_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 11-10165). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggactgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggaatgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttt
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgccattagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttcaaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatcactccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KF922407_FT00000_P-A Feature FT:source KF922407_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3791v2). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
tactcaaccctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacgggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatctacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttaggaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taaatcaacagtatatgaacctttaccccgttgcccggcaacggtctggtctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggctataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcggaactgacaattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatcctgcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcatatttcttgccttacttttggaagggaaa
ctgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactggactttactcttctactgtccctgtctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgagggcattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaatttaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattacttccagacccggcattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcagccaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccccgcattcggagc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctacagtgcca
gcagttcctcccactgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KF922421_FT00000_P-A Feature FT:source KF922421_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v8). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagcttgccatcaagctctgaaagatcccagagtcaggggcctgtatttccctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgacgactggggaccctgtgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtttctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggaacaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattccctaaactttatgg
gctatgtaattggaagttggggtacgttgccacaggatcatattgtacaaaaaatcaaatgctgttttagaaaacttcct
gtcaatagacctatcgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
tgagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctagggtgtactgccaactggattcttcgcggaacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccctcgaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagtcgggggaggagatgaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagtacgggatctacttgatacag
catcagctctgtatcgggaagccttagaatctccggagcattgctcccctcaccatacagcactcaggcaagccattcta
tgctggggggatgtaatgaatctagctacttgggtgggtactaatttggaagacccagcatccagggatcaagtagttaa
ttatgttaatattaacatgggcataaagattagacaactattgtggtttcatatttcttgcattacttttggaagagaaa
ctgtccttgagtatttagtctctttcggagtgtggattcgcactcctccagcctatggaccaccaaatgcccctatctta
tcatcacttccggaaactactgttgttagacgacgaggccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctaattttaatcctgaatggcaaactccttcctttcctaaaattca
tttacatgaggatattattaataggtgtcagcaatttgtaggccctctcactgcaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattttatcctaacagcactaaatacttgcctctagacaaagggattaaaccttattatcctgaccaa
gtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttccaaaccctctgggattccttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttctggggtggagccctcaggctcagggcatattggctacattgcca
gcaattcctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatacagtggaa
>gnl|hbvnuc|KJ843166_FT00000_P-A Feature FT:source KJ843166_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag04). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaaccttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgtttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcatatatcttgccttacttttggaagagaga
ctgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaaaattca
tttacaagaggacattattaataggtgtcagcaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtatcctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggaagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ843173_FT00000_P-A Feature FT:source KJ843173_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag11). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattaccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcatatatcttgccttacttttggaagagaga
ctgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaatccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggaagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ843192_FT00000_P-A Feature FT:source KJ843192_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag31). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgtttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcagcaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtatcctatataagagggaatccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ854690_FT00000_P-A Feature FT:source KJ854690_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 16338-NE-BRA). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattctcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggctattccctaaatttcatgg
ggtatgtaattggaagttggggtacattgccacaagatcatattgtacaaaaaatcaaacaatgttttagaaaacttcct
gtcaatcggcctattgattggaaagtgtgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttatcctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttgggactctatcgtccccttcttcgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgatttctttccctccgtccgggatctacttgatacat
cctcagctctgtatcgggaagccttagaatctcctgagcattgctcaccgcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctatctttaaccctgaatggcaaactccttcttttcctaaaattca
tttacaggaagatgttgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctaggttctatcctaacagtactaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaaccagacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggatcctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatactggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ854691_FT00000_P-A Feature FT:source KJ854691_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 16650-NE-BRA). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatctacctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaagcactgttttagaaaacttcct
atcaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacccaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
nnctcttgtacatgtcccacttttcaagcctccaagctgtgccttggttggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttccgtccgggatctactagacacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccctcttttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctcttactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctaggttttatcctaacagtactaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaagcccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatacagtggaa
>gnl|hbvnuc|KJ854701_FT00000_P-A Feature FT:source KJ854701_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 349-SE-BRA). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttcccaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgtgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctgcaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggctattccctaaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtgtgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttatcctgcattaatgcctttgtatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtaaccagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaacactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtatttaaagactgggaggagttaggggaggagactaggtta
atgatctatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgatttctttcctaccgcccgggatctacttgatacag
cctcagctctgtatcgggaagcattagagtctcctgagcattgctcaccgcaccatacagcactcaggcaagccatacta
tgctggggggatatactgactctaggtacctgggtgggtaataatttggaagatcaaacatccagggatctagtagtcaa
ttatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaar
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctcaagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctacggtccctatctttaaccctgaatggcaaactccttcttttcctaaaattca
tttacatgaagatgttgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagragactgaagktga
ttatgcctgcgaggttctrtcckaacaggactaaatatttggctctggacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaaccagacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcatttttcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcgaaacctcgc
aaaggcatggggacgaacctttcggttcccaaccctctgggattctttcccgatcatcagttggatcccgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KP168427_FT00000_P-A Feature FT:source KP168427_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EMB201). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccatcaagctctgcaagatcccagagtcaggggcctgtactttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcggggaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgggtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatctacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggayggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatwccta
tgggrgtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacamcatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctagcaaaacaaagagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacactgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaactgcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgcaccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtcaacagtatatgaacctttaccccgttgcccggcaacggcctggtttgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaacctcatcgggactgataattctgtcgtcctttcgcggaaat
atacatcctttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcrgacgacccctcgcggggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtgcgggatctacttgatacag
cctcagctctgtaccgagaagccttagagtctcctgagcattgctcacctcatcacacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttagaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ttgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctctctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctcttactgtcaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctttagacaaaggaattaaaccttattatcctgatcaa
gtagttaatcattacttccagaccagacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcatacaatccagattgggacttcaatcccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatrttggctacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KP168434_FT00000_P-A Feature FT:source KP168434_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KSM564). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagcgttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctcgactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattcccttaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgctcccttcacacaatgtgg
ttaccctgcattaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcacggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtactgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggacgcttgggtctgtatcgtccccttctccgtctaccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagattctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctgctagatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctcttttggagtgtggattcgcactcctccggcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatttttaatcctgagtggcaaactccttcttttcctaaaattca
tttacatgaagacattattaataggtgccagcaatttgtaggtcctctcactgtaaatgaaaaaagaagactaaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctttagacaaagggattaaaccttattatcctgatcat
gtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaagaccactggccacaagccaatcaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatactggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KP168435_FT00000_P-A Feature FT:source KP168435_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MBS117). Complete genome. [Hepadnaviridae] (length=3218 residues).
ttccacaacctttcaccaagctctacaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cartaaaccctgttcaaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcrccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcytggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtrtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttctkctggattaycaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggayggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagytatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacmaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggatcatattgtacaaaaaatcaaacactgttttcgaaaacttcct
gtaaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ctaccctgccttaatgcctttatatgcatgtatacaagcaaaaacggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggctattggccaccagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagcaggtctggagcaaaactcattgggactgataattctgtcctcctttctcggaaat
atacatcstttccatggctgctagggtgtgctgccaactggattcttcgcgggacgtcctttgtctacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctatcggccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtccgttccagctcatccgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtgcgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaatatgggcctaaagattagacaactgttgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtattccttggactcacaaggtt
ggaaattttactgggctctattcctctactgttcctctctttaatcctgaatggcaaactccttcctttcctaaaattca
tttacatgaggacattattaatagatgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattaaacttaa
ttatgcctgctaggttctaccctaactctactaaatatttgcctttagacaaaggaattaagccctattatcctgaacat
gtagttaatcattacttccaatctcggcactatttacacaagctctggaaggcgggtatcttatataagagagaaacaac
ccacagagcctcattctttgggtcaccatattcttgggaacaagagctacatcatggggctttcttggacggtccctctc
gagtggggaaagaatcagtccaccagcaatcccctgggattttttcccgaccaccagttggatccagctttcggagccaa
ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccacaagccaatcaggtaggagtgggagcatttg
gcccagggttcacccctccacacgggggccttttggggtggaaccctcaagctcagggcatattgcatacagtgccaact
attcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctgagagacagtcatcc
tcaggccatgcagtggaa
>gnl|hbvnuc|KP718091_FT00000_P-A Feature FT:source KP718091_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1771). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagcgctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggtacattaccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctytgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cytcagctctatatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctcttactgtgaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagarggaatccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagacaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KP718092_FT00000_P-A Feature FT:source KP718092_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1891). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttycaccaagcrctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggtacattaccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtrctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atytyttgtacatgtcccactgttcaagcctycaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattyts
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaratcaggcaactattgtggtttcayatatcytgccttacttttggaagagaga
csgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctcttactgtgaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaatccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcaaggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagacaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KR905431_FT00000_P-A Feature FT:source KR905431_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICI-77). Complete genome. [Hepadnaviridae] (length=3203 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagcacaggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttacaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtaaaaaaactcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttcctttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcaaacctcgcaaaggcatggggacgaac
ctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagccaattcaaacaatccaga
ttgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcattcgggccagggttcactc
ccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgccagcagtgcctcctcctgcc
tccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtg
gaa
>gnl|hbvnuc|KT151617_FT00000_P-A Feature FT:source KT151617_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 803). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtggcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcytgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtcctgggggccaagtctgtacaacaccttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattagacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgccccatttacacaatgtgg
ttaccctgctttaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtcaacagtatgtgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgrggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcacctrccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaaatggtctgcgcaccatcctcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactagcgagttactctcttttttgccttctgacttctttccttccgttcgggatctactagatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtttctttcggagtgtggatccgcactcctccaccctatagaccascaaatgcccctatctta
tcaacacttccggaaactactgttattagaggaagaggccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactggactttattcttctactgttcctatctttaatcctgactggcaaactccttcytttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcag
gtagttaatcattactttaaaacccgacattatttacatactctttggaaggctgggattctatataagagggaatctac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccgtcaaggaccattggccammagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcaggcaggacgacagcctactcccatctctccacctctaagagacagtca
tcctcaggccgtgaagtggaa
>gnl|hbvnuc|KT347087_FT00000_P-A Feature FT:source KT347087_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM265). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtgcctccagttcaggaa
cacacaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaagactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaacgagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaatcctaacaaaacaaaaagatggggttattccctaaatttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgtttcagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtctcttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaagcctttc
tgagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacttcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccctcgcgaggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctacttgatacag
cctcagcactgtatcgggaagccttagagtctcctgagcattgctcacctcatcatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatcctgcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctccttcggggtgtggattcgcactcctccagcctatagacccccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaagttaa
ttatgccggctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattacttccaaaccagacattatttacatactctctggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggcctcaagccaaccaggtaggagtgggagctt
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcagtcaggcatattggctacagcgccagta
gttcctcctcctgcctccaccaatcggcagtcagagcagcctactcccatcttctcccctctaagagacagtcatcctca
ggccatgcagttgaa
>gnl|hbvnuc|KT366471_FT00000_P-A Feature FT:source KT366471_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C-EICI.50). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacttcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacagcatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
gttatgtaattggaagttggggtacattgccacaggatcatattgtacacaaaatcaaacactgttttagaaaacttcct
gtcaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactggactttattcttctactgtccctatctttaatcctgaatggcaaacaccttcttttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggcaatgcagtggaa
>gnl|hbvnuc|KT749831_FT00000_P-A Feature FT:source KT749831_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL8). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaggctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacgacctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactcttgctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaataccaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttcaaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatttctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KT749834_FT00000_P-A Feature FT:source KT749834_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL9a). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggcctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatctagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcat
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctgtctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggagggctggtattctatataagagagaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KT749837_FT00000_P-A Feature FT:source KT749837_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL15). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KT749843_FT00000_P-A Feature FT:source KT749843_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL5c). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctatgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattccttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KT749844_FT00000_P-A Feature FT:source KT749844_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL25). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggagcattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctacttgacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggtcctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KT749850_FT00000_P-A Feature FT:source KT749850_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL21). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgttctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctcttcagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgccagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KU605533_FT00000_P-A Feature FT:source KU605533_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM8787Baseline). Complete genome. [Hepadnaviridae] (length=3227 residues).
ttccacagctttccaccaaactctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatactgcctctcacatctcgtcaatctcctcgaagactggggaccctgcgttgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgccaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttgggggacattgccacaggatcatattatacaaaaaatcaaacactgttttaggaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taaatcaacagtatatgaacctttaccccgttgcccggcaacggtctggtctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggctataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcgaaactcatcggaactgacaattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtatcgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtca
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaaatttttcacctctgcataatc
atctcttattcatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatcctgcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctcttttggagtgtggattcgcacacctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctctactcttctactgtccctgtctttaatcctgaatggcaaactccttcctttcctaaaattca
tttacaggaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattacttccagaccagacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcagccaagcctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaggccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctacagtgcca
gcagttcctcccactgcctccaccaatcggcagttaggaaggcagcctactcccatctctccacctctaaagagaacagt
cagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU605539_FT00000_P-A Feature FT:source KU605539_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM4643F3). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccacagagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgtctctcacatctcgtcaatctcctcgacgactggggaccctgtgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
tcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaaccacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattccctaaactttatgg
gctatgtaattggaagttggggtacattaccacaggaccatattgtacaaaaaatcaaatgctgttttagaaaacttcct
gtcaatagacctatcgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgggatctacttgatacag
catcagctctgtatcgggaagccttagaatctccggagcattgctcccctcaccatacagcactcaggcaagccattcta
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatttagtagtcaa
ttatgttaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttagtctctttcggagtgtggatacgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
gggaattttactgggctttattcctctactgtccctaattttaatcctcaatggcaaactccttcctttcctaaaattca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcccgctagattttatcctaacagcactaaatacttgcctctagacaaaggaattaaaccttattatcctgatcaa
gtagttaatcattacttccagaccagacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttccaaaccctctgggattccttcccgatcatcaactggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacattgcca
acagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MF772351_FT00000_P-A Feature FT:source MF772351_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1141). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggctattccctaaatttcatgg
ggtatataattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtgtgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaatcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcgtttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatctgatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcaccgcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagatattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctaggttctatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaaccagacattatttacatactctttggaaggaggggattctatataagagagaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
acaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccattggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MH464814_FT00000_P-A Feature FT:source MH464814_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA92). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcacctctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttaggaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttttcgccaacttacaaggcctttc
taaatcaacagtacatgaacctttaccccgttgcccggcaacggtctggtctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcctgttttgctcgcagccggtctggagcaaaactcatcggaactgacaattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtatcgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcagwccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatcctgcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcatatttcttgccttacctttggaagagaaa
ctgtccttgagtatttggtctcttttggagtgtggattcgcacacctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctctactcttctactgtccctgtctttaatcctgaatggcaaactccttcctttcctaaaattca
tttacaggaggacattattaataggtgtcagcaatttgtaggccctctaactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattacttccagaccagacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcagccaagcctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctacagtgcca
gcagttcctcccactgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MK512455_FT00000_P-A Feature FT:source MK512455_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw2079). Complete genome. [Hepadnaviridae] (length=3200 residues).
ttccacagctttccatcaagctctgcaagatcccagagtcaggggcctgtattcccctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcttcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccagggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgattccct
catgttgctgtacaaaacctacggacgggaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggcccagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taacaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
gatatgtaattggaaggtgggggacattgccacaggatcatattgtacaaaaaatcaaacaatgttttcgaaaacttcct
gtcaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaggcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcacggggccgcttgggtctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcgctctccccgtctgtgccttctcatctgccgtcacctctggcagttgcatggagaccac
cgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaatgtcaacgaccgaccttg
aggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaagatttttgtattagga
ggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatcatctcttgtacatgtccc
actgttcaagcctccaagctgtgccttggatggctttggggcatggacatcgacccttataaagaatttggagctactgt
ggagttactctcatttttgccttctgacttctttccttcagtccgggatctacttgatacagcctcagctctgaatcggg
aagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctctgctggggggaattaatg
actctagctacctgggtgggtaataatttggaagatcctgcatccagggatctagtagtcaattatgttaacactaacat
gggcctaaagatcagagaactgttgtggtttcatatttcttgccttacttttggaagagaaactgtccttgagtatttgg
tctctttcggagtgtggatccgcactcctccagcctatagaccaccaaatgcccctatcttatcaacacttccggaaact
actgttgttagatgtcgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgcc
gcgtcgcaaaagatctcaatctcgggaatctaaatgttagtattccttggactcataaggtgggaaattttactgggctt
tattcctctactgtccctatctttaatcctgaatggcaaactccttcctttccaaaaatccatttacatgaggacattat
taataggtgtcagcaatttgtgggccctctcactgtaaatgaaaagcgaagattgaaattaattatgcctgctagatttt
atcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaagtagttaatcattacttc
cagacccgacattatttacatactctttggaaggctgggattctatataagagggaaactacacgtagcgcctcattttg
cgggtcaccatattcttgggaacaagagctacatcatgggaggttggttaccaaaacctcgcaaaggcatggggacgaat
ctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagccaattcaaacaagccaga
ctgggacttcaaccccatcaaggaacactggccacaggccaaccaggtaggagtgggagcattcggcccagggttcactc
ccccacacggaggtgtttcggggtggagccctcaggctcagggcatattggctactctggcagcagttcctcctcctgcc
tccaccaatcggcagtcaggacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK512457_FT00000_P-A Feature FT:source MK512457_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw3173). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacacctttccacccagctctgcaagatcccagagtcaggggcctgtattgtcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatcttgtcaatctcctcgaggactggggaccctgcttcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccagggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggttcattgccacaggatcatattgtacaaaaaatcaaacaatgttttagaaaacttcct
gttaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtatacaggcgaaacaggcttttactttctcgccaacttacaaggcctttc
taaatacacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatggtcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttcagtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggatgtaatgactctagctacctgggtgggtactaatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaatttaactgggctttattcctctactgtccctatctttaatcctgaatggcagactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagtactaaatatttgccactagacaaagggattaaaccttattatccagatcaa
gtagttaatcattacttccagacccgacactatttacatactctctggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccaccaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgtcttggggtggagccctcaggctcagggcatattggctaccttgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcattggaa
>gnl|hbvnuc|MK512464_FT00000_P-A Feature FT:source MK512464_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw2016). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatatcgtcaatctcctcgaggactggggaccctgctccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccagggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaactttatgg
gatatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacattgttttagaaaacttcct
gttaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaagcgaaccaggcttttactttctcgccaacttacaaggcctttc
taagtacacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcttttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgttccgtcggct
ctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcacctgccggtccgtgtgcacttcgagtcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaggtcttgcccaaggtcttatataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggatgagattaggtta
atggtttatgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtcgagttactctcgtttttgccttctgacttttttccttcagtccgggatctacttgatactg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatacagcactcaggcaagccactctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatcctgcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttgccttacttttggaagagaca
ctgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttcttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatttcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttttcctaacagtactaaatattcgcctctagacaaagggattaaaccttattatccagatcaa
gtagctaatcattacttccagacccgacattatttacatactctcaggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtccggatattcttgggaacaagagctagatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttcggttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccaccaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctactttgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MK512471_FT00000_P-A Feature FT:source MK512471_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-120). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaaactctgcaagatcccaaagtcaggggcctgtatcttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggcccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattacacaaaaaatcaaacactgttttaggaaacttccc
gtcaatcgacctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgccgttgtatgcatgtatacaagcgaagcaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggctattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggttgtactgccaactggattcttctcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgggggcgcttgggactctaccgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcttgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactcttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgttgagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
ccggagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgtcaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacgcataaggtg
ggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcctttccaaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagtactaaatatttgcctctagacaaagggattaaaccttattatccagatcca
gtaggtaatcattacttccagacccgacattatttacatactctctggaaggctgggattctatataggagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttcgttaccaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggatcctgcattcggagc
caactcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattgactacagtgcca
acagttcctcctcctgcttccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccgtgcagtggaa
>gnl|hbvnuc|AB116090_FT00000_P-A Feature FT:source AB116090_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-NEP40). Complete genome. [Hepadnaviridae] (length=3200 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
atcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccattcacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcaaaacaggcttttactttctcgccaacttataaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctctctcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atggtttatgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
cttcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacatttggaagagaaa
ctgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttccaaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctcttactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaaccagacattatttacatactctttggaaggctgggatcctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcattcgcaaaggcatggggacgaacctt
tctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagccaattcaaacaatccagattg
ggacttcaaccccatcaaggaccactggccgcaagccaaccaggtaggagtgggagcattcgggccagggttcactcccc
cacacggaggtgttttggggtggagccctcaggctcagggcatattgaccacagtgccagcagtgcctcctcctgcctcc
accaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB116091_FT00000_P-A Feature FT:source AB116091_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH1). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagcttttcgccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcntggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagcacgggaacctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
ggtatgtaattggaagttggggttcattgccacaggatcatattgtacaaaaaatcaaacgctgttttagaaaacttcct
gtcaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtattcaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tgaatcaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcngcg
ctgaatcccgcggacgacccttcgcggggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggttggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
ccaccgctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctt
tgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgtcaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaca
ctgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctagattttatcctaacagcactaaatacttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatataagagggaaactac
acgtagcgcctcattctgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccgtcaaggatcactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattgaccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatacagtggaa
>gnl|hbvnuc|AB246338_FT00000_P-A Feature FT:source AB246338_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggcctatctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB362931_FT00000_P-A Feature FT:source AB362931_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcaaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacgtacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcctttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgtttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgcacacctcaccatactgcactcaggcaagccattctc
tgctgggtggaattgatgactctagctacctgggtgggtaataatttggatgatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccgctggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB697501_FT00000_P-A Feature FT:source AB697501_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No19). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatcttctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB775199_FT00000_P-A Feature FT:source AB775199_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB10-0708). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaarctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB775201_FT00000_P-A Feature FT:source AB775201_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB12-0929). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggctattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB937794_FT00000_P-A Feature FT:source AB937794_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-0666). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB937798_FT00000_P-A Feature FT:source AB937798_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB14-0383). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcgaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatcttctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AJ012207_FT00000_P-A Feature FT:source AJ012207_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctacaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcaagg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttgccttacttttggaagagaaa
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AM180624_FT00000_P-A Feature FT:source AM180624_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CAE168). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaagccctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaaaacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcarggtatgttgcycgtttgtcctct
aattccaggatccamaaccaccagtacgggaccctgcagaacctgcacgactcctgcacaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctaacaaaacaaaaagatggggttattctctaaatttcatgg
gttacataattggaagttggggatcattgccacaagaycatattgttcaaaaamtcaaagactgttttagaaaacttcct
gttaacagacctattgattggaaagtttgtcaacgcattgtgggtcttttgggctttgccgctccgttcacacaatgtgg
ataccctgctttaatgcctttgtacgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcttttccatggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggrmtctaccgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtgtttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactcttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgttcgagatctcctagataccg
cctcagctctatttcgggaagcactagagtctcctgagcatggttctsctcaccatacagcamtcaggcaagccattctt
tgctggggggakgtaatgactctagccacctgggtgggtrmtaatttggaagatccagcatcccgggatctagtagtcaa
ttatgtcaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgttcttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggamtctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtacctatctttaatcctgaatggcaaactccttcttttccaaagattca
tttacatgaggacattattaatagatgtcaacaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgcgagattttatcctaacagtaccaaatatttgccattagacaaagggattaaaccttattatcctgatcat
gtagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatataagagggaaactac
acgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggttaccaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaycctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
ttggaccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcacattgactatggtgcca
gcggttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AM295797_FT00000_P-A Feature FT:source AM295797_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tgagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattatcaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattacccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggccggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctgtctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AY233275_FT00000_P-A Feature FT:source AY233275_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 163). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaa
cacacaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaagactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatctacaacaacgagtacgggaccttgcaagacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgtttcagaaaacttcct
gtcaatcgccctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgcagctccctttacacaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
tgagtaaacagtatatggacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacttcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcagcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggctggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcctttttgccttctgacttctttccttccgtccgggatctacttgatacag
cctcagcactgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaatatgggcctaaaaatcagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctccttcggggtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgcccctatctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaagttaa
ttatgcctgctagattttatcctaacagcacgaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcctcaacacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactggaacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagctt
acggcccagggctcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattgactacagcgcca
gtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AY233279_FT00000_P-A Feature FT:source AY233279_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 28). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcatctcacatctcgtcaatctcctcgaggactggggaccctgcgctgaacatggag
aacatcacatcaggattcctagggcccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaatgctgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgagtcttttgggctttgctgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcaaaacaggcttttattttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtccttgctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgttccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcctaaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cttcagctttgtatcgggaagccttagagtctccggagcattgctcccctcaccatacagcacacaggcaagccattctc
tgctggggggaattaatgactctagccacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttgtcttacttttggaagagaaa
cggtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgagatcgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctaactgtaaatgagaagagaagattaaaattaa
ttatgcctgctagattttatcctaacagcaccaaatatctgcctttagacaaagggattaagccttattatcctgatcaa
gtagttaatcattactttcagaccagacattatttacatactctttggaaggctggaattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggccagcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcgtattggctacagtgcca
ccagttcttcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AY233281_FT00000_P-A Feature FT:source AY233281_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 303). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cacacaaccctgttccaaatattgcctctcacatctcgccaatctcctcgaagactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatctacaacaacgagtacgggaccttgcaagacctgcacgactcctgctcaaaacaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgtttcagaaaacttcct
gtcaatcgccctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgcagctccctttacacaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
tgagtaaacagtatatggacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacttcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcccgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aggatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcagcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctacttgatacag
cctcagcactgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaatatgggcctaaaaatcagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctccttcggggtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaagttaa
ttatgcctgctagattttatcttaacagcattaaatatttgcctctagacaaagggattaaaccttattatccagatcaa
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcctcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagaccgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagctt
acggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattgactacagcgcca
gtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AY233285_FT00000_P-A Feature FT:source AY233285_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 795). Complete genome. [Hepadnaviridae] (length=3221 residues).
tcccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggac
cactcaaccctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccccgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttaggaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taaatcaacagtatatgaacctttaccccgttgcccggcaacggtctggtctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggctataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcggaactgacaattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctcagtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtggggaataatttggaagatcctgcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggacccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttactcttctactgtccctgtgtttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcagccaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagtcctcaggctcagggcatattggctacagtgcca
gcagttcctcccactgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AY934771_FT00000_P-A Feature FT:source AY934771_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 27439). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctacaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
tcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattrtcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
gttacgtaattggcagttggggtacattaccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaaccggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcattgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggatgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctatgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgttcgggatctactagatactg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtttctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatttttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacattattaacaggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagacgactgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcag
gtggttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggatcctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagtgcctcctcctgcctccgccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AY934772_FT00000_P-A Feature FT:source AY934772_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1908). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgtcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggcccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
gattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgtaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttagaaaacttcct
ctcaatcgacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttacccggccttaatgcccttgtatgcatgtatacaggcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcgcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcygcctgttttgctcgcagccggtctggagcaaamctcatcgggactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcacggggccgcttgggtctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtataaagactgggaggtgttgggggaggagattaggtta
atgatctgtgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctgggtggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtgggtcctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttttcctaacagcaccaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatactcttgggaacaagagctacatcatgggaggttggttaccaaaacctcgc
aaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AY934774_FT00000_P-A Feature FT:source AY934774_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9615549). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttaggaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggaactgataattctgtcgtcctttcgcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagcggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggtta
aaggtttatgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctacagtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcagactccttcttttcctaaaattca
tttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagaggagactaaaattaa
ttatgcctgctaggttttaccctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggcgggtattctatataagagggaaactac
acgtagcgcctcattttgcgagtcgccatattcttgggaacaagagctacatcataggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattgaccacagtgcca
acagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU185789_FT00000_P-A Feature FT:source EU185789_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU8). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactgkggaccctgtgacgaacatggag
aacatyayatcaggactcctaggacccctgctygtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagaatctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattgggtcttctggattatcaaggtattttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaarttgcacctgtaywscsrtcccatcgtcctgggcttkcgcaaaataccta
tgggagtggggctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtmcctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtgcaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagata
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcamcaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaw
ttmtgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgygggtcaccatawtcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggtccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594383_FT00000_P-A Feature FT:source EU594383_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctacaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttctgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttgatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaatattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594384_FT00000_P-A Feature FT:source EU594384_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttccgtcagagatcttctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggcaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccatctctaagagacagtca
tcctcaggcaatgcagtggaa
>gnl|hbvnuc|EU594387_FT00000_P-A Feature FT:source EU594387_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggcactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcaattggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatacagtggaa
>gnl|hbvnuc|EU594390_FT00000_P-A Feature FT:source EU594390_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtgggacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggacctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859916_FT00000_P-A Feature FT:source EU859916_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P03). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859917_FT00000_P-A Feature FT:source EU859917_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P13). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
agtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859923_FT00000_P-A Feature FT:source EU859923_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P15). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgcctttcaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtga
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859927_FT00000_P-A Feature FT:source EU859927_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P25). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaacccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtttccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859936_FT00000_P-A Feature FT:source EU859936_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C10). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctaaccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859946_FT00000_P-A Feature FT:source EU859946_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C155). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggagcattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatacatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaaatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggtcctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859951_FT00000_P-A Feature FT:source EU859951_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C62). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccaatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ692558_FT00000_P-A Feature FT:source FJ692558_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48008). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttacacmaaactcagcaagatcccagagtcaggggcctrtatttccctgctggtggctccagttcaggaa
cactcaaccctgttccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
cctgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttctgggggccaagtctgtacaacatcttgagtccctttataccgctgt
tascaattttcttttrtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
gttatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacaatatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacctcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttcgcggggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttatataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccaacctcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactttcgtttttgccttatgacttctttccttccgtccgggatctactagatacag
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatgcagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcacatttcttgcattacttttggaagagaag
ttgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgtggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgagtggcaaactccgtcttttcctaaaattca
tttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactaaacttaa
ttatgcctgctaggttttatcctaacagcaccaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctgtggaaggctgggatcctatataaaagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggggc
caattcaaacaatccagattgggacttcaacccmgtcaargaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgccg
gtagttcctcctcctgcctctaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccctgmagtggaa
>gnl|hbvnuc|FJ692575_FT00000_P-A Feature FT:source FJ692575_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50020). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccaaagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggawcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattrtcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaatwccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccay
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacaycttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
gttatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
atcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcaaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatcwgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacctcatcgggactgacaattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcmtcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagacacag
cctcagctttgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatacttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggyaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccctcttttccaaaaattca
tttacatgaagacattgctgataggtgtcagcaatttgtaggccctcttactgcaaatgaaaagagaagactgaaattaa
ttatgcctgctaggttttatcctaacagtactaaatatttacctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatataagagagaaactac
acgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccccgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatrttgrccacagtgcca
gcagttcctcctcctgcctccwccaatcggcagtcaggvaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccrtgcagtggaa
>gnl|hbvnuc|FJ692598_FT00000_P-A Feature FT:source FJ692598_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50018). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcatctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
tcagagtctagacttgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccrayttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaycarggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctrt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggatcrttgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcawgtatacaagctagacaggcttttactttctcgccaacttacaaggcctttc
taagtacacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcccatcagatcctgcccaaggtcttayataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aagatttttgtattaggaggctgtaggcataaattggtctgcgcaccatcwtcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtrgagttactctcttttttgccttctgacttctttccttccgtccgagatctcctagataccg
cctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaagtaatgratctaggtaactgggtgggtaataatttggaagatcmagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagama
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagaccayyaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaactccctcgcctcgcag
acgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttcctttcctaaaattca
tttacatgaagacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattga
ttatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaaccttattatcctgatcag
atagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatataagagggaaaccac
tcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggatatcaacacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccacatcaaggaccactggccacaagccaatcaggtgggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgactacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ692603_FT00000_P-A Feature FT:source FJ692603_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50050). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaarctctgcaagatcccagagtcaggarcctgtgtcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcmtcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggttgacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcagaacctgcactactcctgctcaaggcaactctatgtttccct
catgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggatcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgcagccccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggcttttactttctcgccaacttacaaggcctttc
taagtacacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgcctgccgtaccggccgwccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagagtaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcttcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccattataa
agaatttggagctwctgtggagttactctcttttttgccttctgacttctatccttccgtccgagatctcctagataccg
ccacagctctgtatcgggamkcattagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaactccctcgcctcgcag
acgaagaactcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaggacattatcaatagatgtcaacaatttgtgggccctctcactgcaaatgaaaagagaagattgaaattga
ttatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaaccttattatcctgatcag
atagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatataagagagaaaccac
tcgtagcgcctcattttgygggtcaccatattcttgggaacaagagctacatcatgggaggtcggayatcaacacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggacccygcattcggrgc
caactcaaacaatccagattgggacttcaaccacatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgactacagtgcca
gcagttccgcctcctgcctccaccaatcggcagtcrggaaggcagcctacrcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ692612_FT00000_P-A Feature FT:source FJ692612_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50132). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagcgctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcacagaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaatwccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctctgggyatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggatcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggcttttactttctcgccaacttacaaggcctttc
tragtacacagtatatgaacctttaycccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcmggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggtctctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
awgrtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccmttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgtccgagatctcctagataccg
cctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactmacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccascctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaactccctcgcctcgcag
acgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaayctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattga
ttatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaaccttattatcctgatcag
atagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatataagagggaaaccac
tcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggatatcaacacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccacatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgactacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FM199978_FT00000_P-A Feature FT:source FM199978_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcttcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccmattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattaccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taaatacacagtatatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaacctcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtccccttctccgtctaccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcggatcctgcccaaggtcttacataagaggactcttnnnnnnnnnnnnn
nnnnnnnnnccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtcacctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttagaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttgccttacttttgggagagaaa
ctgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagtactaaatatttgcctctagacaaagggattaaaccttattatccagatcaa
gtagttaatcattacttccagacccgacattatttacatactctctggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccaccaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctactttgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FN545826_FT00000_P-A Feature FT:source FN545826_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaacatggag
aacatcacatcaggattcctaagacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgccttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctcaaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacgaccagtacaggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgytgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
waccaattttcttttgtctttgggtatacatttaaatacaaacaaaacaaaaagatggggttattctctaaacttcatgg
gatacataattggaagttggggatcattaccacaggatcatattgtacgaaaaattagacaatgttttagactacttcct
gttaataggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgccgctccctttacacaatgtgg
ctatcctgcattaatgcctttgtatgcatgtatacaaactaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
cctcgcagcttgttttgctcgcagccggtctggagcacaactcatcgggactgataattctgtcgtcctctctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttatataagaggactcttggactcccagcaa
tgtcaatgaccgaccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcttcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactyttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttaatctcgtttttgccttctgacttctttccttccgttcgagatcttctagataccg
cctcagctctctatcgggaagcactagagtctcctgagcattgttcacctcaccatacmgcactcaggcaagccattctc
tgctggggggacttaatgactttagctacctgggtgggcaataatttggaagatccggcatccagggatctagtagtcaa
ttatgttaataataccacgggcttaaagatcaggcaactattgtggtttcayatttcttgtcttacttttggaagagaca
ccgtacttgagtatttggtctctttcggagtgtggattcgcactcctccagcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtacctatctttaatcctgaatggcaaactccttcttttcctaagataca
tttacatgaggacattattaataggtgtcagcaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcccgctagattctatcctaacagtacaaaatatttgcccttagacaaaggaattaaaccttattatcctgatcag
gtagttaatcattacttccagacccgtcattatttacatactctgtggaaggctggtattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggacatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaatcaggtaggagtgggagcat
ttgggccagggytcacccctccacacggaggtattctggggtggagccctcaggctcagggcatattgactacagtgcca
acagttcctcctcctgcctccaccaatcggcagtcaggaaggcagccgactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FN545828_FT00000_P-A Feature FT:source FN545828_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaactttccaccaagctctacaagatcccagggtcaggggcctgtatttccctgctggtggctccaattcaggaa
cagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggrtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcatgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcytggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgactccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctaacaaaaccaaaagatggggttattccctaaacttcatgg
gatacataattggaagttggggatcactgccacaggctcatattgtacaaaaaatcaaacattgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atacccggccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtaaccagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacctcatcgggactgataattctgtcgtcctttcgcggaaat
atacatcctttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggcctctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagaycttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccaccatcatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactcttcaagcctccaagctgtgccttgggkggctttggggcatggacattgacccttataa
agaatttggcgctactgtagagttactctcttttttgccttctgacttctttccttccgtccgagatctcctagataccg
cctcagctctgtttcgggaagcattggaatcacctgagcattgtacacctcaccatacagcactcaggcaagccattctt
tgctggggggaattaatgactctagcttcctgggtgggtaataatttgcaagatccagcatccagggatcaagtagtcga
ttatgttaacactaacatgggcctaaaaatcaggcaactattgtggtttcatatttcttgtctcacttttggaagacaaa
ctgtacttgagtatttggtatcttttggagtgtggattcgtactcctccaccctacagaccactaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagggacccaggccggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaatcttactgggctttattcttctactgtacctatctttaatcctgaatggcaaactccttcttttccaaagattca
tttacacgaggacattattaatagatgtcaacaattcgtgggccctctcaccgtaaatgaaaagagaagattaaaattaa
ttatgcctgctagattttatcctaatagcaccaaatatttgcccctagacaaagggattaaaccttattatcctgaacat
atagttaatcattactttcaggcccaacattatttgcatactctttggaaggctggtattctatataagagggaaactac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagtgctacctcatgggaggttggttgccaaaacctcgc
aaaggcatggggacgaatctgtctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
ttgggccaggrttcacccctccacacggcggtgttctggggtggagccctcaggctcagggcatactgacaacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FN545830_FT00000_P-A Feature FT:source FN545830_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaactttccaccaagctctgcaagatcccagggtcaggggcctgtatttacctgctggtggctccaattcaggaa
cagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggaytcctaggacmcctgctcgtgttacaggcgggatttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcatggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatccacgaccaccagyacgggaccctgccgaacctgcacgactcctgctcaaggcaactctatgtttccct
cctgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccctcatcatgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctaacaaaaccaaaagatggggttattccctaaacttcatgg
gatacacaattggcagttggggatcactgccacaggctcatattgtccaaaaaatcaaacattgttttaggaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atacccggccttaatgcctttatatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tacgtgaacaatatatgaacctttaccccgttgcccggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaacmctcatcgggactgataattctgtcgtcctttcacggaaat
atacatcctttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggcctatatcgtccccttctccgtctgccgtatcgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactcttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgtccgagatctcctagatacag
cctcagccctgtttcgggaagcattggaatcacctgagcattgtacacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgtctcacttttggaagagata
ttgtactggagtatttggtatcttttggagtgtggattcgcactcctccagcctacagaccactaaatgcccctatctta
tcaacacttccggaaactgctgttgttagacgaagggaccgaggtcggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcatcaggtg
ggaaattttactgggctttattcttctactgtacctatctttaatcctgaatggcaaactccttcttttccaaagattca
tttacatgaggacattattaatagatgycaacaattygtgggccctctcaccgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcccctagacaaagggattaaaccttattatcctgaacat
gtagttaatcattactttcaggcccgacattatttgcatactctttggaaggctggtattctatataagagggaaactac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttcgttgccaaaacctcgc
aaaggcatggggacgaatctttctgttccaaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccaccaaggaccactggtcacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggcggtgttctggggtggagccctcaggctcagggcatattgacaacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccayccagtggma
>gnl|hbvnuc|FN545833_FT00000_P-A Feature FT:source FN545833_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaactttccaccaagctctgcaagatcccagggtcaggggcctgtatctccctgctggtggctccaattcaggaa
cagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctrctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
rcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
cctgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcrtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttataccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctagcaaaaccaaaagatggggttattccctaaacttcatgg
gatacataattggcagttggggatcactaccacaggatcatattgtacataaaatcaaacattgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaaagaattgtgggtcttttgggcttcgctgctccatttacacaatgtgg
atacccagccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtaaccagtatatgaacctttaccccgttgcccggcaacggtctggtctgtgccaagtatttgctgacgcaacaccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtcctttcccggaaat
atacatcatttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggcctctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttatataagaggactcttggactcccagcca
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactcttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgtccgagatctcctagataccg
cctcagctctgtttcgggaagcattagagtcacctgagcattgttcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ctatgttaatactaacatgggcctaaagatcaggcaaatattgtggtttcatatttcttgtctcacttttggaagagaag
ttgtgcttgagtatttggtatcttttggagtgtggattcgcactcctccagcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcacaaggtg
ggaaattttrcggggctttattcttctactgtacctatctttaatcctgaatggcaaactccttcttttccaaagattca
tttacatgaggacattattaatagatgtgaacaattcgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagcaccaaatatttgcccctagacaaagggatcaaaccttattatcctgaacat
gtagttaatcattactttcaggcccgacattatttgcatactctgtggaaggctggtattttatataagagggaaactac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttcgttaccaaaacctcgc
aaaggcatggggacgaatctttctgtgcccaaccctctgggattttttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacgtcaaccccttcaaggatcactggccacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcacattgactacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacactca
tcctcaggccattcagtggaa
>gnl|hbvnuc|FN545834_FT00000_P-A Feature FT:source FN545834_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaactttccaccaagctctgcaagatcccagggtcaggggcctgtatctccctgctggtggctccaattcaggaa
cagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctrctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttrttggttctgctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
cctgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaratwccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaycttgagtccctttataccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctagcaaaaccaaaagatggggttattccctaaacttcatgg
gatacataattggcagttggggatcactaccacaggatcatattgtacataaaatcaaacattgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggcttcgctgctccatttacacaatgtgg
atacccagccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggtctggtctgtgccaagtatttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtcctttcacggaaat
atacatcatttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggcctctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcayctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttatataagaggactcttggactcccagcca
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
awgrtytwtgtattaggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactcttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgcccgagatctcctagagaccg
cctcagctctgtatcgggaagcattagagtcacctgagcattgttcacctcaccatacagcactcaggcaagccattctc
tgctgggtggaattaatgactctagctacctgggtgggtaataatttggatgatccagcatccagggatctagtagtcaa
ctatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgtatcacttttggaagagaag
ttgtgcttgagtatttggtatcttttggagtgtggattcgcactcctccagcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttgcactcataaggtg
ggaaattttacggggctttattcttctactgtacctatctttaatcctgaatggcaaactccttcttttccaaagattca
tttacatgaggacattattaatagatgtgaacaattcgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagcaccaaatatttgcccctagacaaagggatcaaaccttattatcctgaacat
gtagttaatcattactttcaggcccgacattatttgcatactctgtggaaggctggtattttatataagagggaaactac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggtycgttaymaaaacctcgc
aaaggcatggggacgaatctttctgtgcccaaccctctgggattttttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacgtcaaccccttcaaggatcactggccacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatactgactacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacgcccatctctccacctctaagagacactca
tcctcaggccattcagtggaa
>gnl|hbvnuc|FN545836_FT00000_P-A Feature FT:source FN545836_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctacaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttcwggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatccacaactaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggatcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaaactagacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatggacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttcacggaaat
atacatcatttccatggctgctaggctgtactgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtyttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaarctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgtccgagacctcctagataccg
cctcagctctatatcgggaagcactagagtctcctgagcattgctcacctcatcatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtacttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtgcctaactttaatcctgaatggcagactccttcttttcctaagattca
tttacatgaggacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattga
ttatgcctgctagattctatcctaacagcaccaaatatttgcccctacacaaaggaattaaaccttattatcctgatcaa
atagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatataagagggaaaccac
gcgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggatagcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgactacagtgcca
gcagttcctcctcctgcctccgccaatcggcagtcaggaaggcagcctacacccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FN545838_FT00000_P-A Feature FT:source FN545838_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagmtttccaccaagctctgrmagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaagccctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttgtcctcc
aattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggyatacatttaaaccctaacaaaacmaaaagatggggttattccctaaacttcatgg
gctacataattggatgttggggaacattaccacaagatcatattgttcacaaactcaaagattgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaacgcattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgctttaatgcctctgtacgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacctcatcgggactgataattctgtcgtcctttcccggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcttgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgagatctcctagataccg
cctcagctctatttcgggaagcattagagtctcctgagcattgctctcctcaccatacggcactcaggcaagccattctc
tgctggggggatgtaatgtctctagctacctgggtgggtactaatttggaagatccagcatccagggaacaagtagtcag
ttatgttaatactaatatgggcctgaagatcaggcaactgttgtggtttcatatttcttgccttacttttggaagagaag
ttgtacttgagtatttggtctcttttggggtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagactacggaaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
gggaattttactgggctttattcttctaccgtacctatctttaatcctgaatggcaaactccttcttttcccaagattca
tttacatgaggacattattaatagatgtcaacaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctaacagcaccaaatatttgccacttgacaaaggaattaaaccttattatcctgatcat
gtagttaatcattacttccaggcccgacattatttacataccctttggaaggctggtattctatataagagggaaactac
acgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggttaccaaaacctcgc
aaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggactacaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
tcgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatatcgactaccgtgcca
gcagttcctcctcctgcctccaccaatcggcagtcagggaggcagcctactcccatctctccacctctaagagacagtca
tccgcaggccatgcagtggaa
>gnl|hbvnuc|GQ161813_FT00000_P-A Feature FT:source GQ161813_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GU1021). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagcacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcatgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggatcattgccacaggatcatattgtacaaaaaatcaaaaattgttttagaaaacttcct
attaataggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggctttgcagctccctttacacaatgtgg
ataccctgccttaatgcctttgtatgcgtgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatgtgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaactcattgggactgataattctgtcgtcctctctcggaaat
atacctcctttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagcggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactcttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcaccacacwgcactmaggcaagccattctt
tgytggggggaattaatgactctagctacctgggtgggcaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctgccttacttttggaagagaaa
ctgtacttgagtatttggtctctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtg
ggaaattttactgggctttattcctctactgtacctatctttaatcctgaatggcaaactcctacttttcccaagattca
tttacatgaggacattgttaataggtgtcaacaatttgtgggtcctctcacagtaaatgaaaaaagaagattaaaattga
ttatgcctgctagattctatcctaacagtacgaaatatttgcccctagacaaaggaattaaaccttattatcctgatcat
gtagttaatcattacttccagacccgacattatttacatactctttggaaggctggtattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggttaccaaaacctcgc
aaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caacacaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgactactgtgcca
gcagttcctcctcctgctgccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ477482_FT00000_P-A Feature FT:source GQ477482_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P46). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctacaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtggcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctca
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgctttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccattataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattatc
tgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagagatctagtagtcaa
ttatgttaatactaacatgggtttaaagctcaggcaactattgtggtttcatatttcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctcaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ477486_FT00000_P-A Feature FT:source GQ477486_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P57). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgtaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taaagcaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagagcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaccgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagtaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgcctcatgacttctttccttccgtcagagatctcctagacaccg
ccgcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattcta
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatacatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacgcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgcaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctaaccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatccaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcttccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GU563553_FT00000_P-A Feature FT:source GU563553_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-10). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaacctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattaccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttaccattagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GU563558_FT00000_P-A Feature FT:source GU563558_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-90). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
attcatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccggcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgattggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaagtatttgcccttagataaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|HM535205_FT00000_P-A Feature FT:source HM535205_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 72 Mutare). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagccaggggcctgtattttccggctggtggctccagttcaggaa
cactcaaccctgttccaaatactgcctctcacatctcggcaatctcctcgaggactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
cctgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggctattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacaatgttttaggaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taaatcaacaatatatgaacctttaccccgttgcccggcaacggtctggtctgtgccaagtgtttgctgacgcaactccc
actggttggggcttggctgtaggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaacctcatcggaactgacaattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaaaattagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcgg
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttactcttctactgtccctgtctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattactttcagacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcagccaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgctcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctacagtgcca
gcagttcctcccactgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JN182330_FT00000_P-A Feature FT:source JN182330_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cattcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgtcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagcacgggaccctgcaagacctgcacggctcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaagccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggttcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaactgcct
gtcaatcgacctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggacatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctacttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaactaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcttttccgaaaatcca
tttacacgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattatttccagacccgacattatttgcatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggttaccaaaacctcgc
aaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagcca
tcctcaggcaatgcagtggaa
>gnl|hbvnuc|JQ707317_FT00000_P-A Feature FT:source JQ707317_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C27). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaaactctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttgggggacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagaataggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatcttctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcactacttccaaaccagacattatttacatactctttggaaggctggtgttctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707321_FT00000_P-A Feature FT:source JQ707321_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C31). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttgggggacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctggacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707333_FT00000_P-A Feature FT:source JQ707333_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C42). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttacccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttgggggacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactggactttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctcagagacagtca
tcctcaggccgtgcagtggaa
>gnl|hbvnuc|JQ707361_FT00000_P-A Feature FT:source JQ707361_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C37). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctacacttcatgg
gttacgtaattggaagttggggaacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgtacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtcagagatctcctggacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggacccggcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccacgcagtggaa
>gnl|hbvnuc|JQ707366_FT00000_P-A Feature FT:source JQ707366_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C44). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctacacttcatgg
gttacgtaattggaagttggggaacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggaattactctcgtttttgccttctgacttctttccttccgtcagagatctcctggacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaagactggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaacacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggacccggcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccacgcagtggaa
>gnl|hbvnuc|JQ707390_FT00000_P-A Feature FT:source JQ707390_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C39). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707394_FT00000_P-A Feature FT:source JQ707394_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C44). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaagaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707406_FT00000_P-A Feature FT:source JQ707406_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C19). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccttgctcttcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707407_FT00000_P-A Feature FT:source JQ707407_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C20-9). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707549_FT00000_P-A Feature FT:source JQ707549_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C29). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctacgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatatggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707558_FT00000_P-A Feature FT:source JQ707558_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C38). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707577_FT00000_P-A Feature FT:source JQ707577_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C15). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttaccggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatatcgtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatggacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagacattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaacgatcaggcgactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattga
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707579_FT00000_P-A Feature FT:source JQ707579_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C17). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatatcgtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
tactaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacctcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttccccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcacattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707589_FT00000_P-A Feature FT:source JQ707589_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C27). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaagggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggggtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggcctttagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
tactaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgagactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctaaccacactaaatatttccccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707590_FT00000_P-A Feature FT:source JQ707590_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C28). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaagggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggggtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcctttagctatgtggatgatgtggtattgggcgccaagtctgtacagcatcgtgaggccctttataccgctgt
tactaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggcgctactgcggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttccccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707610_FT00000_P-A Feature FT:source JQ707610_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C10). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagctcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707620_FT00000_P-A Feature FT:source JQ707620_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C24). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaaa
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707633_FT00000_P-A Feature FT:source JQ707633_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C41). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaattggtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707652_FT00000_P-A Feature FT:source JQ707652_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C34). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgcttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaatcaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KF214661_FT00000_P-A Feature FT:source KF214661_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2008-8). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatttccctgctggtggctccagttcaggaa
cactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgtgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacagcatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctaacaaaacaaagagatggggttactccctgaatttcatgg
gatatgtaattggaagttggggtaccttgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggcctcgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggctttcacttcctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaacctcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctgtttcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcctgtcctgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtacgggatctactagatacag
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggagagctgttctg
tgttggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatctagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgttcttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttcttttcctaaaattca
tttacatgaggacattgctaataggtgtcaacaatttgtaggccctctcactgtaaatgaaaaaaggagattaaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaaccttattatcctgatcat
gtagttaatcattacttccaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaacccgctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
tcagtgcctcctcctgcctcctccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KF922409_FT00000_P-A Feature FT:source KF922409_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3791v4). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
tactcaaccctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttggcaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatctacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttaggaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taaatcaacagtatatgaacctttaccccgttgcccggcaacggtctggtctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggctataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcggaactgacaattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatcctgcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaaaatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcggaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactggactttactcttctactgtccctgtctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaatttaa
ttatgcctgctagattttatcctaacagtactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcagccaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccccctggggttctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctacagtgcca
gcagttcctcccactgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KF922420_FT00000_P-A Feature FT:source KF922420_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N005v7). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagcttgccatcaagctctgaaagatcccagagtcaggggcctgtatttccctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgacgactggggaccctgtgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtttctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggaacaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattccctaaactttatgg
gctatgtaattggaagttggggtacgttgccacaggatcatattgtacaaaaaatcaaatgctgttttagaaaacttcct
gtcaatagacctatcgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
tgagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctagggtgtactgccaactggattcttcgcggaacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccctcgaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagtcgggggaggagatgaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagtacgggatctacttgatacag
catcagctctgtatcgggaagccttagaatctccggagcattgctcccctcaccatacagcactcaggcaagccattcta
tgctggggggatgtaatgaatctagctacttgggtgggtactaatttggaagacccagcatccagggatcaagtagttaa
ttatgttaatattaacatgggcataaagattagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttagtttctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcatcacttccggaaactactgttgttagacgacgaggccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctaattttaatcctgaatggcaaactccttcctttcctaacattca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgcaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattttatcctaacagcactaaatacttgcctctggacaaagggattaaaccttattatcctgaccaa
gtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatccaaacctcgc
aaaggcatggggacgaatctttctgttccaaaccctctgggattccttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttctggggtggagccctcaggctcagggcatattggctacattgcca
gcaattcctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatacagtggaa
>gnl|hbvnuc|KJ843218_FT00000_P-A Feature FT:source KJ843218_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ag63). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagcgctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattaccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgttcccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaatccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ854686_FT00000_P-A Feature FT:source KJ854686_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1356-SE-BRA). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctcgcacatctcgtcaatctcctcgaggactggggaccctgcgacgaatatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctgt
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggatggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacctcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgrggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttatataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagccacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaayctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccctcctttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctcttactgtaaatgaaaagagaagactaaaattaa
ttatgccagctaggttttatcctaacagtactaaatatttgcctctagacaaagggattaaaccttattatccggatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgtcccaaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ854694_FT00000_P-A Feature FT:source KJ854694_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 17822-NE-BRA). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggctattccctaaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcccattgattggaaagtgtgtcagagaattgtgggccttttgggctttgccgctccatttacacaatgtgg
ttatcctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaactttcgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgatttctttccttccgtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagaatctcctgagcattgctcaccgcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaaccctgaatggcaaactccttcttttcctaaaattca
tttacatgaagatgttgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctaggttctatcctaacagtactaaatatttgcctctagacaaagggatcaaaccttattatcctgatcat
gtagttaatcattactttcaaaccagacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggatcctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ854696_FT00000_P-A Feature FT:source KJ854696_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 18158-SE-BRA). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagcttcccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgacgaacatggag
aacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
ggtatgtaattggaagttggggaacattgccacaggagcatattgtacaaaaaatcaaacactgttttagaaaacttcct
atcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgcccgcagcaggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagacacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatttagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccctcttttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctcttactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctaggttttatcctaacagtaccaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggcagggattctatataagagggaaactac
acgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KP168428_FT00000_P-A Feature FT:source KP168428_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KN195). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgctgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaartctgtacaacaccttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagaggtgggggtattccctgaatttcatgg
ggtatgtaattggaagttggggtactttgccacaggatcatattgtacaaaaaatcaaacaatgttttagaaaacttcct
gtcaatcgtcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
tgagtaaacagtacatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggactggagcaaaactcatcgggactgataactctgtcgtcttgtctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcgcgcggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagaataggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttccgacttctttccttccgtccgggatctactagatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgcacacctcaccatactgcactcaggcaagccgttcta
tgctggggggaattaatgactctagctacctgggtgggtaataatttggacgatcmagcatccagggatctagtagtcaa
ttatgttaatactcacatgggcctaaagatcaggcaactgttgtggtttcatatttcttgccttacttttggaagaraaa
ctgtccttgagtatttagtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgtcgcgaccgaggyaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttccaaaaattca
tttacatgaagacattattaataggtgtcagcaattcgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaaggaattaaaccttattatcctgatcag
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagagaaactac
ccgtagcgcctcattttgcgggtcaccatactcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccgatcatcagttggacccggcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggcctcagtgcca
gcagttcctcctcctgcctcatccaatcggcaggcaggaaggcagcctactcccatctctccacctctaagagacagcca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KP168433_FT00000_P-A Feature FT:source KP168433_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate NRB04). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcrccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagaggtgggggtattccctgaatttcatgg
ggtatgtaattggaagttggggtactttgccacaggatcatattgtacaaaaaatcaaacaatgttttagaaaacttcct
gtcaatcgtcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattgatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaccctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaattggattcttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcgcgcggccgcttgggaatctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccatctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccakcaycatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattcty
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcagacaactgttgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaatttcactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttccaaaaattca
tttacatgaagacattattaataggtgtcagcaattcgtaggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctagattttatcctaacagtactaaatatttgcctctagacaaaggaattaaaccttattatcctgatcat
gtagttaatcattactttaaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatactcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccaacaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcaaggcatattggctacagtgcca
gcagttcctcctcctgcctcctccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KP718090_FT00000_P-A Feature FT:source KP718090_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PA-01-1348). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagcgctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggtacattaccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctytgcctaatc
atctyttgtacatgtcccmctgttcmagcctycaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctcttactgtgaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagarggaatccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagacaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KP718097_FT00000_P-A Feature FT:source KP718097_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GP13-1943). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagcgctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggtacattaccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaacattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctcttactgtgaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaatccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagacaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KP718100_FT00000_P-A Feature FT:source KP718100_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 137_HIV). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagcgctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggakcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagkccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggtacattaccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttatttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatytcctagacaccg
cctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccrgcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctcyagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctcttactgtgaatgaaaagagaagattgaaattra
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaatccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagacaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KR905425_FT00000_P-A Feature FT:source KR905425_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICI-24). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatattgcccgtttgtcctct
aattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatatttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtctctttataccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
atcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttatatgcatgtatacaagcgaaacaggcctttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttgggactatatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagacacag
cctcagctctatttcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattactgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaattgctgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctatctttaatccagaatggcaaaccccttcttttcctaaaattca
tttacatgaagacattgctaaaaggtgtcagcaatttgtaggccctctcacagtaaatgaaaaaagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caatacaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagtacctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KT151614_FT00000_P-A Feature FT:source KT151614_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 969). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtggcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcytgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
ggtatgtaattggatgttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgcygctccttttacacaatgtgg
ttatcctgcattaatgcctttatatgcatgtatacaagcgaaacaggcytttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcgtttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgrrgccgcttgggactgtatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactcycagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaargactgggaggagytgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactkttcaagcctccaagctgtgccttggrtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagacacag
cctcagctctatatcgggaagccttagagtctcctgagcattgctctcctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatccagaatggcaaaccccttcytttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaacccgctgggattctttcccgatcatcagttggacccagcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccammagccaaccaggtaggagtgggagcat
tcgggccagggttcacyccyccacacggmggtgttttggggkggagccctcaggctcagggcatattggccacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggacgacagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggnn
>gnl|hbvnuc|KT347088_FT00000_P-A Feature FT:source KT347088_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM285). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttaggaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taaatcaacagtatatgaacctttaccccgttgcccggcaacggtctggcctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggctataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcggaactgacaattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggctgtgctgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatcctgcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctcttttggagtgtggattcgcacccctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttactcttctactgtccctgtctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttacctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcagccaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctacagtgcca
gccgttcctcccactgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KT366466_FT00000_P-A Feature FT:source KT366466_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C-EICI.7). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatattgcccgtttgtcctct
aattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatatttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtctctttataccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
atcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttatatgcatgtatacaagcgaaacaggcctttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttgggactatatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagacacag
cctcagctctatttcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattactgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaattgctgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctatctttaatccagaatggcaaaccccttcttttcctaaaattca
tttacatgaagacattgctaaaaggtgtcagcaatttgtaggccctctcacagtaaatgaaaaaagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caatacaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagtacctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KT366470_FT00000_P-A Feature FT:source KT366470_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C-EICI.31). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagcacaggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttacaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtaaaaaaactcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgactggcaaaccccttcctttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KT749829_FT00000_P-A Feature FT:source KT749829_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL7). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KT749849_FT00000_P-A Feature FT:source KT749849_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FL4c). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggcctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatctagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctgtctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggagggctggtattctatataagagagaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KX357649_FT00000_P-A Feature FT:source KX357649_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate AA86ETH). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccatagctttccaccaaactctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctgaatttcatgg
gttatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaactcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttctgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtcaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgatccctcgcgaggccgcttgggtctctatcgtccccttcttcgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactattggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgcctcgagacttctatccttccgtccgggatctaatagacacag
cctcagctctatttcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccgttctc
tgctggggggaattaatgactctagctamctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagata
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgtcgagacagaggcaggtccactagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaatattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacattattaacaggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcag
gtggttaatcattactttaaaacccgacattatttgcatactctctggaaggctgggattctatataagagggagactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaacacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctgagagacagtca
tcctcaggccgtgcagtggaa
>gnl|hbvnuc|KX827293_FT00000_P-A Feature FT:source KX827293_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate geno5.4). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacaccccatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagagtcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcgacaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcgggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccaacagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KY886219_FT00000_P-A Feature FT:source KY886219_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatcttctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|LC051141_FT00000_P-A Feature FT:source LC051141_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB14-0620). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggga
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatccacaaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttaggaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggtctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcccatcagagcctgcccaaggtcttacataagcggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagattaggtta
aaggtttatgtattaggaggctgtaggcataaattggtctgcgcaccaccatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggttggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactggactttattcctctactgtccctatctttaatcctgaatggcagactccttcttttcctaaaattca
tttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagaggagactaaaattaa
ttatgcctgctaggttttaccctaacagcactaaatatttgcctctagacaaagggattaaaacttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggaccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
acagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|LC074724_FT00000_P-A Feature FT:source LC074724_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate p621). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatcttctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MF925407_FT00000_P-A Feature FT:source MF925407_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BD-HBV54). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccaccgctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaa
cactcaaccctgttccacatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctgaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaactacct
gtcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccaccctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttcttttcctaaaattca
tttacatgaagaccttgctaatagatgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtggttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagctt
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcgacagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MH464809_FT00000_P-A Feature FT:source MH464809_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA87). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatyttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcatctcacatctcgtcaatctcctcgaggactggggaccctgcgctgaacagggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagrgggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttgtggattaccagggtatgttgcccgtttgtcctct
aattgcaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggcccagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaatgctgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcaaaacaggcttttattttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggytggggcttggctatcggccatcrgcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgttccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcta
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtytwtgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtctcactgttcaagcctccaagctgtgccttgggtggctttgaggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cttcagctttgtatcgggaatccttagagtctccggagcattgctcccctcaccatacagcactcaggcaagccattctc
tgctgggkggaattaatgamtctagcyacctgggtgggtartaatttgsaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagwttagacaaatattgtggtttcatatttcttgtctyacttttggaagagaaa
cggtccttgagtatttggtctctttcggrgtgtggattcgcactcctccaccctatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagatgccgagctcgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctaactgtaaatgaaaagagaagattaaaattaa
ttatgcctgctagattttatcctaacagcaccaaatatctgcctttagacaaagggattaagccttattatcctgatcaa
gtagttaatcattacttccagaccagacattatttacatactctttggaaggctggaattctatatmagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggccagcaaaacctcgc
aatggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtmggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcgtactggctacagtgcca
ccagttcttcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MH464818_FT00000_P-A Feature FT:source MH464818_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MA96). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcacctctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttaggaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttttcgccaacttacaaggcctttc
taaatcaacagtacatgaacctttaccccgttgcccggcaacggtctggtctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcctgttttgctcgcagccggtctggagcaaaactcatcggaactgacaattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtatcgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatcctgcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcatatttcttgccttacctttggaagagaaa
ctgtccttgagtatttggtctcttttggagtgtggattcgcacacctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctctactcttctactgtccctgtctttaatcctgaatggcaaactccttcctttcctaaaattca
tttacaggaggacattattaataggtgtcagcaatttgtaggccctctaactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattacttccagaccagacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcagccaagcctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctacagtgcca
gcagttcctcccactgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MH580627_FT00000_P-A Feature FT:source MH580627_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 299). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaactttccaccaagctctgcaagatcccagggtcaggggtctgtatttccctgctggtggctccaattcaggaa
cagtaaaccctgttccgaccactgcctctcacatctcatcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggcatacatttaaatcctaacaaaaccaaaagatggggttattccctaaacttcatgg
gatacataattggaagttggggatcactgccacaggatcatattgtacaaaaaatcaaacattgttttagaaaacttccc
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atacccggccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtcaacagtatatgaacctttaccccgttgccaggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacctcttttccatggctgctaggctgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggcctctttcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactcttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgtccgagatctcctagataccg
cctcagctctgtatcgggaagcattagagtcacctgagcattgttcacctcaccatacagctctcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatctcttgccttacttttggaagagaaa
ctgtgcttgagtatttggtatcttttggagtgtggattcgcactcctccagcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtacctatctttaatcctcaatggcaaactccttcttttccaaagattca
tttacatgaggacattattaatagatgtcaacaattcgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagcaccaaatatttgcccctagacaaggggattaaaccttattatcctgaacat
gtagttaatcattactttcaggcccgacattatttgcatactctttggaaggctggtattctatataagagggaaactac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggttaccaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccgcaagccaatcaggtaggagtgggcgcat
ttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgactacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagagagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MK512472_FT00000_P-A Feature FT:source MK512472_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-65). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgctttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaatcgacctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaagttacaaggcctttc
taaagacacaatatttgcacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggctataggccatcagcgcatgcgtggaaggtttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaacctcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtgctgccaattggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aagatttttgtattaggaggctgtaggcataaattggtgtgcgcaccattctcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaacgactctagctacctgggtgggcaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctatctttaatcctgattggcaaactccttcctttccaaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagtactaaatatttgcctctagacaaagggattaaaccttattatccagaccaa
gtagttaatcattacttccagacccgacattatttacataccctctggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctatctgttcccaacccgctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaatcccaccaaatgcccctgtccccaaaatgcccctatccgagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatactggctactttgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaaaagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MK512475_FT00000_P-A Feature FT:source MK512475_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate rw14-25). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaaactctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttctcaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgtcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
cattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaagcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcaatttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacgaagagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttagaaaacttcct
gttaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaagccaaacaggcttttactttctcgccaacttacaaggcctttc
taagtacacagtatatgaacctttaccccgttgcccggcaacggtctggtctgtgccaagtgtttgctgactcaactccc
actggctggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcgggaat
atacatcatttccatggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcccatcagatcctgcccaaggtcttatataagagaactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aagatttatgtattaggaggctgtaggcataaattggtttgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcgactgcggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttgccttacttttggaagagata
ctgtccttgagtatttggtatcctttggagtgtggatccgcactcctccaccctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtg
ggaaattttacggggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagtactaaatatttgcccctagacaaagggattaaaccttattatccagatcaa
ggagttaatcattacttcaagacccgacattatttacatactctctggaaggctgggattctatataagagagaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccaacaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggcccaggattcactcccccacacggaggtgttttggggtggagcccccaggctcagggcatattagctactttgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB076678_FT00000_P-A Feature FT:source AB076678_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala14). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctcgcacatctcgtcaacctcctcgaggactggggaccctgcgtcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggttcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaactgcct
gttaatcgacctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctacttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggcaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcctttcctaaaatcca
tttacaagaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattatttccagacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggttaccaaaacctcgc
aaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggcaatgcagtggaa
>gnl|hbvnuc|AB076679_FT00000_P-A Feature FT:source AB076679_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala35). Complete genome. [Hepadnaviridae] (length=3221 residues).
tttcacagctttccaacaagccctacaagatcccagagtcaggggcatatatcttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggttccacccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgcttgatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
cctgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgtaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaacttcatgg
gatacgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttaggaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcgaaactcattgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtgctgccaactggattcttcgcggaacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactattcaagcctccaagctgtgccttggctggctttggggcatggacattgacccttataa
agaatttggagctagtgtggagttactctcgtttttgccttctgacttctttccttcagtccgggatctacttgatacag
cctcagctctgtatcgggaggccttagagtctccggagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctgggtggaattaacgactctagctacctgggtgggtaataatttggaagatcatgcatccagggacctagtagtcaa
ttatgtaaatgataatatgggactaaagctcagacaactattgtggtttcatatttcttgccttacttttggaaaacaaa
ctgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatcgaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagagaccgaggcgggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttgttgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcctttcctaagatcca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattttatcctaaccgcactaaatatttgcctctagacaaagggattaaaccttattattctgatcaa
gtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggttaccaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagactgggacttcaaccccatcaaggaccgctggccacaagccaaccaggtaggagtgggagcgt
tcggcccagggttcactcccccacacggaggtgttttggggtggaaccctcaggctcagggcatattgactacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcagggaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccgtgcagtggaa
>gnl|hbvnuc|AB116087_FT00000_P-A Feature FT:source AB116087_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-IND8). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaaactctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
gttatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaactcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggatgtttcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacgtcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagacaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccaccttatagaccaccaaatgcccctatctta
tcaacacttccggaaactgctgttgttagacgacgagtccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtg
ggaaattttgctgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttcttttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctttggacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggatttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
acgggccagggttcactcccccacacggaggtgtcttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcaatggaa
>gnl|hbvnuc|AB126580_FT00000_P-A Feature FT:source AB126580_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-RU204). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaagacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaatccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacatatagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaagcactgttttaggaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacagtgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttacnccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctctcgtacatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccctcataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccctccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctggtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacagggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggagggtggtcatcaaaacctcgc
aaaggcatggggacgaatctttctggttccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacaggca
tcctcaggccaagcagtggaa
>gnl|hbvnuc|AB241114_FT00000_P-A Feature FT:source AB241114_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PhHCC01). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagaatcaggggcctgtattttcctgctggtggctccacttcaggaa
cagtcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
gttatgtaattggaagttggggtacattgcctcaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttcttttcctaaaattca
tttacatgaagacattgctaatagatgtcaacaatttgtaggccctctcactgtaaatgaaaaaagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggtggggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggatcactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactccccctcacggaggtgttttggggtggagccctcaggctcagggcatattggcaacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB697496_FT00000_P-A Feature FT:source AB697496_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No11). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatcttctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB697498_FT00000_P-A Feature FT:source AB697498_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No15). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgcttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgykcaccagcaccatgcaactttttcacctctgcctaatc
atctcktgtwcatgtccyactgttcaagcctccaagctgtgccttgggtggctttgggrcatggacattgacccktataa
agaatttggagctwctgtggagttactctcktttttgccttctgacttctttccktcygtymgagatctyctmgacaccg
cctcwgctctgtatcgrgargccttagagtctcckgarcattgytcacctcaccatacwgcactcaggcaagcyattcts
tgytggggkgarttgatgamtctrgcyacctgggtgggwartaatttggaagaycmagcatccagggayytagtagtcar
ytatgtyaatrytaayatgggywtaaaratcagrcaactattgtggtttcayatwtcttgycttacttttggaagagara
ctgtwcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB697509_FT00000_P-A Feature FT:source AB697509_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No32). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatcttctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaacccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB775200_FT00000_P-A Feature FT:source AB775200_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB12-0925). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggctattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB937791_FT00000_P-A Feature FT:source AB937791_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB05-0890). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaactttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcgcgaggtcgcttgggactgtatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacatttctaataggtgtcaacaatttgtaggccctctcactgtaaatgaaaagagacgactgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggcaacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB937796_FT00000_P-A Feature FT:source AB937796_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1196). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaactttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctcgcgaggtcgcttgggactgtatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacatttctaataggtgtcaacaatttgtaggccctctcactgtaaatgaaaagagacgactgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggatcctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggcaacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AF043560_FT00000_P-A Feature FT:source AF043560_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA2). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
ggtatgtaattggaagttgggrtacattgccacaggatcrtattgtacaaaaaatcaaacactgttttagaaaacttcct
atcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatktacacaatgtgg
ttaccctgcattaatrcctttgtatgcatgtatacaagcaaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgacaattctgtcgtcctttctcggaaat
atacatcgtttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagacacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcttaaggtg
ggaaactttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctcttactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctaggttttatcctaacagtactaaatatttgcctctagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AJ309370_FT00000_P-A Feature FT:source AJ309370_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient X104). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagcactgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttaccata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaagctcatcggcactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagagtaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgttgagttactctcgtttttgccttctgacttctttccttccgtcagagatcttctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaaccccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggcgggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtgggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttgggttggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctacgaaacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AM410963_FT00000_P-A Feature FT:source AM410963_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tgagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattatcaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattacccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggccggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctgtctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AY233290_FT00000_P-A Feature FT:source AY233290_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 85). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccaccgctttccaccaagctctgcaagatcccagagtcaggggcctgtatttccctgctggtggctccagttcaggaa
tactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgacgactggggaccctgtgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagacttgtggtggacttctctcaattttccagggggcccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccaccatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacaccttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccagaacaaaacaaagagatggggttattccttaaactctatgg
gctatgtaattggaagttggggttccctgccacaggatcatattgtacaaaaaatcaaatgctgttttagaaaacttcct
gtcaatagacctatcgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtcaacagtatctgaacctttaccccgttgcccggcaacggcttggtctgtgccaagtgtttgctgacgcaaccccc
cctggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgccctttcgcggaaat
atacatcctttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttggggatctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggacttttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccattatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agagtttggagctactgtggagttactctcgtttttgccttctgatttctttccttcagtacgggatctacttgatacag
cctcagctctgtatcgggaagccttagaatctccggagcattgctcccctcaccatacagcactcaggcaagccattcta
tgctggggggatgttatgaatctagcttcctgggtgggtaataatttggacgatccagcatccagggatcaagtagtcaa
ttatgttaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttgccttacttttggaagacaaa
ctgttcttgagtatttagtctctttcggagtgtggatacgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtacctaagtttaatcctgaatggcaaactccttcctttcctaacattca
tttacatgaggatattattaataggtgtcagcaatttgtaggccctctcactaaaaatgaaaaaagaagattaaaattga
ttatgcccgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatccagatcaa
atagttaatcattacttccagaccagacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagatacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttccaaaccctctgggattccttcccgatcatcaactggaccctgcattcggagc
caattcaaacaatcccgattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacattgcca
acagttcctcctcctgcctcgaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggctatgcagtggaa
>gnl|hbvnuc|AY903452_FT00000_P-A Feature FT:source AY903452_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaaattgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
ggtatgtaattggaagttggggtaccttgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
atcaatcgccctattgattggaaagtctgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgtcgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccaccaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagacacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagagatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctcgttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtggggaat
tttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccctcttttcctaaaattcatttaca
tgaagatattgccaataggtgtcagcaatttgtaggccctcttactgtaaatgaaaagagaagactaaaattaattatgc
ctgctaggttttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcatgtagtt
aatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgcaaaggc
atggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcattcgggc
cagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgccagcagtt
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY934767_FT00000_P-A Feature FT:source AY934767_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 27178). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
tactcaaccctgttcccaatattgcctcgcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaattttatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ataccctgcattaatgcctttatatgcgtgtatacaagcgaaacgggcttttactttctcgccaacttacaaggcctttc
tgaggaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggcctctatcgtccccttctccgtctgccgtaccatccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgatttctttccttccgtccgggatctactagatacag
cttcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccggcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccgtggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaagacattactactaggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaaggaattaaaccttattatcctgatcag
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggcggggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AY934768_FT00000_P-A Feature FT:source AY934768_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 25830). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
tactcaaccctgttccaaatattgcctcgcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtactggaccctgcaaaacctgcacgactcctgctcaaggcaactctatggttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaattttatgg
gttatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
ataccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
tgagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctcgcagcttgttttgctcgcagccggtctggagcaaaactcatcgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgatttctttccttccgtccgggatctactagatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggcaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagattaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaactcctgcttttcctaaaattca
tttacatgaagacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcccctagacaaaggaattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagaaagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ298164_FT00000_P-A Feature FT:source DQ298164_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgaggaacatggag
aacatcacatcaggactcctaggacccctactcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctaggggaagcacccgtgtgtcttggccaaaattcgcagtccc
caacctgcaatcactcaccaacctcctgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
cctgttgctgtacgaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatttggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
tacaaattttctgttgtctctgggtattcatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggcagttggggaacattaccacaggatcatattgtacaaaagatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgccaaagaattgtgggtcttttgggctttgctgcgccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcaagtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tacgtcaccagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccctcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattccgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggaactgggggaggagaataggtta
atgatttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacgttgacacttataa
agaatttggcgctactgtggagttgctctcttttttgcctggtgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattgtc
tgctggggagaattgatgaatctagctacctgggtgggtaataatttgcaagatccagcatccagggatctcgtagtcaa
ttatgttaatactaacatgggtataaagatcaggcaactattgtggtttcatatatcttgcattacttttggaagagagg
ttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttagtattccgtggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaacattca
tttacaagaggacattattgatcggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaatccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatccaaacctcgc
aaaggcatggggacgaatctttcagttcccaacccgctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaagaaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcaccccaccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcagggaggcagcccactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EF208113_FT00000_P-A Feature FT:source EF208113_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient B, serum 05/93). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcattttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcaccgtgagtccctttatactgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattaccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcccgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagactaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcacggtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594385_FT00000_P-A Feature FT:source EU594385_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagctatatggatgatatggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccattggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594395_FT00000_P-A Feature FT:source EU594395_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagagatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccctggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859898_FT00000_P-A Feature FT:source EU859898_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P45). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
gtatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcaa
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859910_FT00000_P-A Feature FT:source EU859910_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P27). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttgggaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859924_FT00000_P-A Feature FT:source EU859924_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P16). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgactggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
tcatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatttctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859930_FT00000_P-A Feature FT:source EU859930_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C126). Complete genome. [Hepadnaviridae] (length=3227 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccacgcccatcagatcctgcccaaggtcttacataagaggactcttggacttc
cagcaatgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagatt
aggttaaaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgc
ctaatcatctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccc
ttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctag
acaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcc
attctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagt
agtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaa
gagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccct
atcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcc
tcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcat
aaggtgggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaa
gattcatttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattga
aattaattatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatcca
gatcaggtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagaggga
aaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaa
cctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcatt
cggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgg
gagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccaca
gtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagaga
cagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859933_FT00000_P-A Feature FT:source EU859933_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C67). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccaacagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859942_FT00000_P-A Feature FT:source EU859942_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C110). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatctagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859944_FT00000_P-A Feature FT:source EU859944_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C105). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctacaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctgggctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattccgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactgtctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggacgatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctcaagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccaacaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|EU859945_FT00000_P-A Feature FT:source EU859945_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C102). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcccttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaacaagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ692601_FT00000_P-A Feature FT:source FJ692601_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50035). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggatcattgccacaggatcatattgtacaaaaaatcaaacactgttttaggaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggcttttactttctcgccaacttacaaggcctttc
taagtacacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcacaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagaytaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgtccgagatctcctagataccg
cctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaactccctcgcctcgcag
acgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaggacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattga
ttatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaaccttattatcctgatcag
atagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatataagagggaaaccac
tcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggatatcaacacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccacatcaagraccactggccacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttctgggatggagccctcaggctcagggcatattgactacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ692604_FT00000_P-A Feature FT:source FJ692604_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50052). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagcyctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtraaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggatcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaacaggcccattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggcttttactttctcgccaacttacaaggcctttc
taagtacacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgcctgctgacttctttccttccgtccgagatctcctagataccg
cctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggacttaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaccacgggcctaaggatcaggcaattattgtggtttcatatttcttgccttacttttggaagagata
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagacgaactccctcgcctcgcag
acgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaggacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattga
ttatgcctgccagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaaccttattatcctgatcag
atagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatataagagggaatccac
tcgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggatatcaacacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcaattggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccacatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgactacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ692610_FT00000_P-A Feature FT:source FJ692610_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50104). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaycaarmtctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggatccctaggacccctgctcgtgttacaggcggggtttttcttgtggacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaatctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtaccaaacctatggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggatcattgccacaggatcatattgtacaaaaaattaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgccccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggcttttactttctcgccaacttacaaggcctttc
tragtacacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcyggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgytaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatyctcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcctacttttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacmcgtataa
agaatttggagctagtgtggagttactctcttttttgccttctgacttctttccttccgtccgagatctcctagataccg
cctcagctctgtatcgggaagcattagagtctcckgagcatwkctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaacgactctagstacctgggtgggtaataatttgcaagatccagcatccagggatcaagtagtcra
ttatgttaatactcacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagacyaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagrccgaggcaggtcccctagaagacgtactccctcgcctcgcag
acgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtgcctagctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaggacattattaatagatgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattga
ttatgcctgctagattttatcctaacagcaccaaatatttgcccctacacaaagggattaaaccttattatcctgatcag
atagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggtcggatatcaacaccccgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccacatcaaggaccattggccacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgactacagtgcca
gcagttcctcctcttgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|FN545829_FT00000_P-A Feature FT:source FN545829_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaactttccaccaagctctgcaggatcccaaggtcaggggcctgtatttccctgctggtggctccaattcaggaa
cagtaaaccctgttccgaatactgcctctcacatctcgtcaatctccgcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgttcccct
catgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctaacaaaaccaaaagatggggttattccctaaacttcatgg
gatacataattggaagttggggatcactgccacaggctcatattgtacaaaaaatcaaacattgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atacccggccttaatgcctttatatgcatgtatacaagctaaacaggcttttactttctcaccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcrgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttcgcggaaat
atacatcctttccatggctgctaggctgtactgccaactggattcttcgmgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccctctcggggccgcttgggcctctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttcacatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtytttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcctgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactyttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgcccgagatctcctagataccg
cctcagccctgtatcgggaaggattggaatcacctgagcattgtacacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctcgtagtcaa
ttatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcttgtctcacttttggaagagagg
ttgtacttgagtatttggtatcttttggagtgtggattcgcactcctccagcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagggaccgagctcggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtacctatctttaatcctgaatggcaaactccttcttttccaaagattca
tttacatgaggacattattaatagatgtcaacaattcgtgggccctctcaccgtaaatgaaaagagaagattgaaattaa
ttatgcccgctagattttatcctaacagcaccaaatatttgcccctagacaaagggattaaaccttattatcctgaacat
gtagttaatcattactttcaggcccaacattatttgcatactctttggaaggctggtattctatataagagggaaactac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggttgccaaaacctcgc
aaaggcatggggacgaatctttcggttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccaacaaggaccactggtcacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggcggtgttctggggtggagccctcaggctcagggcatattgacaacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtct
tcctcaggccatacagtggaa
>gnl|hbvnuc|FN545835_FT00000_P-A Feature FT:source FN545835_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaactttccaccaagctctacaagatcccagggtcaggggcctgtatttccctgctggtggctccaattcaggaa
cagtaaaccctgttccgaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcatgggctttcgcaaaataccta
tgggggtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctaacaaaaccaaaagatggggttattccctaaacttcatgg
gatacataattggaagttggggatcactgccacaggctcatattgtacaaaaaatcaaacattgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atacccggccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaacyccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttcgcggaaat
atacatcctttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggcctctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcttgcccaaggtyttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccaccatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactcttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgtccgagatctcctagataccg
cctcagctctgtatcgggaagcattggaatcacctgagcattgtacacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaacactaacatgggcctaaaaatcaggcaactattgtggtttcatatttcttgtctcacttttggaagagaaa
ctgtacttgagtatttggtatcttttggagtgtggattcgtactcctccagcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagggaccgaggccggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtacctatctttaatcctgaatggcaaactccttcttttccaaagattca
tttacacgaggacattattaatagatgtcaacaattcgtgggccctctcaccgtaaatgaaaagagaagattaaaattaa
ttatgcctgctagattttatcctaatagcaccaaatatttgcccctagacaaagggattaaaccttattatcctgaacat
gtagttaatcattactttcaggcccaacattatttgcatactctttggaaggctggtattctatataagagggaaactac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggttgccaaaacctcgc
aaaggcatggggacgaatctgtctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtaggagtgggagcat
ttgggccagggttcacccctccacacggcggtgttctggggtggagccctcaggctcagggyatactgacaacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcartggaa
>gnl|hbvnuc|GQ331047_FT00000_P-A Feature FT:source GQ331047_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-56). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaaccttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttcagaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgtaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctcgactcgtggtggacttctctcaattttctagggggatcacccgcgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggaaccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctat
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaagagatggggttactccctaaacttcatgg
gatatgtaattggaagttggggaacattaccacaggatcatattgcacaaaaacttaaacactgttttagaaaacttcct
gttaataggcctattgattggaaggtatgtcaacgaattgtgggtcttttgggctttgccgctccttttacacaatgtgg
ataccctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccattggccatcagcgcatgcgcggaacctttgcggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcttttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggtcgcttgggactctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactctcatcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtgtgtttaaggactgggaggagtcgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccctataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctccttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgtcttacttttggaagagaaa
ctgtgcttgagtatttggtttctttcggagtgtggattcgcactcctcctgcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagggaccgaggtaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcaaaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtg
ggaaattttactgggctttattctactactgtacctacctttaatcctgattggcaaactccttcttttcctaagattca
tttacatgaggacattattaataggtgtcaacattttgtgggccctcttactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctaggttctatcctaccagcactaaatatttgcccctagacaaagggattaaaccctattatccagatcag
gtagttaatcattacttccagactcgacattatttacatactctttggaaggctggtattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaacacctcgc
ataggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttttggggtggagccctcaggctcagggcatattgaccacagtgcca
aaggttcctcctcctgcctcgaccaatcggcagtcaggaaggcagccgactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ414522_FT00000_P-A Feature FT:source GQ414522_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagcaaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcaataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagcttatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtaccgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcatctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ477462_FT00000_P-A Feature FT:source GQ477462_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P4). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgcttgatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggttttgggggccaagtctgtacaacatcgtgaagccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctgacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattaccacaggatcatatagtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtggggcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
taagtaatcagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagatcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggarctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccctgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgcctcatgacttctatccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagaatctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgacgagtctaggcacctgggtgggtaataatttggacgatcaagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcttaaagctcaggcaactattgtggtttcacatatcttgccttacttttggaagagaga
ctgtaattgaatatttggtctctttcggagtgtggattcgcactcctcaagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgttagtattccttggactcacaaggtg
ggaaactttactgggctttattcatctacagtacctatctttaatcctgaatggcaaactccttcatttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaggagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaagccagacattatttagagactctttggaaggctggtattctatataagagggaatccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatccaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggcattttggggtggagccctcaggctcagggcatattgacaacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ477472_FT00000_P-A Feature FT:source GQ477472_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P24). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagatctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttaacaagaatcctcacaatacc
gaagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcatgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaactttatgg
gttacataattggaagttggggaacactgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtcaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgcctactgacttctttcctggcgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattaacgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaataccaacatgggtttaaaaatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaatacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ477484_FT00000_P-A Feature FT:source GQ477484_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P54). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcaccagtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatttttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggaattactctcgtttttgccttctgacttctttccttccgtcagagatcttctagacaccg
cctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggatgtgatgtctctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacagcaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggacggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaagaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ477487_FT00000_P-A Feature FT:source GQ477487_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P60). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaaactctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaagccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacatcattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgcggacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcctgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcttttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgattcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactctcggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagaataggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatctccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgcctcatgacttctatccttccgtcagagatcttctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgtcgactctagctacctgggtgggtaataatttgcaagattcagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatacatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctataggccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggccggtcccctagaggaagaactccctcgcctcgcag
acgcagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctcttcagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattatcaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaacttaa
ttatgcctgctagattctatccttctcacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaaaccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaagccatgcagtggaa
>gnl|hbvnuc|GQ477493_FT00000_P-A Feature FT:source GQ477493_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P79). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgctttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggaa
aacatcacatcaggattcctagaacccccgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatccc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacacgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtctctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgattcacctctgc
acgttgcatggaaaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aagatttttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccctgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgcctactgacttctttccttccgccagggatcttctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcaatcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaacaatttggacgatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgcattacttttggaagagata
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccactaaatgcccctatctta
tcaacacttccggaaactactgttgttagatgtcgggaccgacgccggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctcttcagtacctatctttaatcctgaatggcaaactccttcctttcctgagattca
tttacaagaggacattatcaataggtgtgaacactttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaagtatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctgtctgttcccaacccgctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccctcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacacctccacacggcggtattttggggtggagccctcaggctcarggcatatggaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggag
>gnl|hbvnuc|GQ477501_FT00000_P-A Feature FT:source GQ477501_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P116). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagaatctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccattgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaaccaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacccaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tacgtgaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggaactgggggaggagattaggtta
atgatttttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctacagtggagttactctcgtttttgcctcatgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgacaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattcta
tgctggggggaattgacgactttaggtacctgggtgggtaataatttgaacgatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagata
ctgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaatgcttccggaaactgctgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctgtctttaatcctgaatggcaaactccttcctttccaaaaattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagaccag
atagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttcggttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagccgccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GU563546_FT00000_P-A Feature FT:source GU563546_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-66). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtgaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgccattagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|GU563547_FT00000_P-A Feature FT:source GU563547_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-23). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaaactctgcaagattccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcttcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattgtacagaaaatcaaacactgttttagaaaacttcct
gttaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgccgctccatttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taaatacacagtatatgaacctttaccccgttgcccggcaacggcctggtctatgccaagtgtttgctgacgcaactccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctccaggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggaggattggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcttgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggttggctttggggcatggacattgacccttataa
agaatttggagctactacggacttactctcttttttgccttctgacttctttccttcagtccgggatctacgtgatacaa
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcatctcaccatacagcaatcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatctttcttgcattacttttggaagagaca
ctgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctatctttaatccggaatggcaaactccttcctttcctaaaatcca
tttacatgaggacattattaatagatgtgagcaatttgtaggccctctcacagtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagtactaaatatttgcctctagacaaagggattaaaccttattatccagatcaa
gtagttaatcattacttccagacccgacattatttacatactctctggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctatctgttcccaaccctctgggattcttccccgatcatcagttggaccccgcattcggagc
caattcaaacaatccagactgggacttcaaccccaccaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcggcccagggttcactcccccacacggaggtgttttgggatggagccctcaggctcagggcatattggctactttgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JN182318_FT00000_P-A Feature FT:source JN182318_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cattcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgtcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctcctatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggttcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaactgcct
gtcaatcgacctgttgattggaaagtatgtcaaagaattgtgggtcttttgggccttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggacatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaaggctgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggcctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatnnnnctttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctacttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaactaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcttttccgaaaatcca
tttacacgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattatttccagacccgacattatttgcatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggttaccaaaacctcgc
aaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccgatcatcagttggaccctgcattcggggc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagcca
tcctcaggcaatgcagtggaa
>gnl|hbvnuc|JN182321_FT00000_P-A Feature FT:source JN182321_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cattcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgtcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacttccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggttcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaactgcct
gtcaatcgacctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggacatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccacggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacacccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttggggggggagattaggtta
agggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctacttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaactaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcttttccgaaaatcca
tttacacgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattatttccagacccgacattatttgcatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggttaccaaaacctcgc
aaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagcca
tcctcaggcaatgcagtggaa
>gnl|hbvnuc|JN182327_FT00000_P-A Feature FT:source JN182327_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagcttttcaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cattcaaccctgttccaaatattgcctctcacatctcgtcaacctcctcgaggactggggaccctgcgtcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagcacgggaccctgcaagacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggttcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaactgcct
gtcaatcgacctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggacatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctagggtgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcacggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaacttttnnnnnnnnnnnnnnnn
nnnnnnnnnnnatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctacttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaactaatgactctagctacctgggtgggtaataatttggaagatccagcgtccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcttttccgaaaatcca
tttacacgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcactatttccagacccgacattatttgcatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggttaccaaaacctcgc
aaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccgatcaccagttggaccctgcattcggagc
caattcaaacaatccagactgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccccacggaggtgttttggggtggggccctcaggctcagggcatattggctacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagcca
tcctcaggcaatgcagtggaa
>gnl|hbvnuc|JQ707301_FT00000_P-A Feature FT:source JQ707301_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C12). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttgggggacattgccacaagatcatattgtacataagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
tctagccgcttgttttgctcgcagccggtctggagcaaaactcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatcttctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactggactttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707309_FT00000_P-A Feature FT:source JQ707309_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C2). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctttgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcatctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattcccttaacttcatgg
gttacgtaattggaagttgggggacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaacactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
tcatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707311_FT00000_P-A Feature FT:source JQ707311_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C21). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttgggggacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctggacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactggactttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctcagagacagtca
tcctcaggccgtgcagtggaa
>gnl|hbvnuc|JQ707320_FT00000_P-A Feature FT:source JQ707320_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C30). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttgggggacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactggactttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctaactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
aaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctcagagacagtca
tcctcaggccgtgcagtggaa
>gnl|hbvnuc|JQ707337_FT00000_P-A Feature FT:source JQ707337_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C46). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcactaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgagtcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttgggggacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtcaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctggacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactggactttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcgtggggacgaatctttctgtccccaaccatctgggattctttcccgatcatcagttggaccctgcattcggaga
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707344_FT00000_P-A Feature FT:source JQ707344_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C9). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccattgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttgggggacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatcttctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatccaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707350_FT00000_P-A Feature FT:source JQ707350_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C16). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctacacttcatgg
gttacgtaattggaagttggggaacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactttcgtttttgccttctgacttctttccttccgtcagagatctcctggacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttccatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggacccggcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccacgcagtggaa
>gnl|hbvnuc|JQ707355_FT00000_P-A Feature FT:source JQ707355_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C25). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatttggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctacacttcatgg
gttacgtaattggaagttggggaacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacctcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactttcgtttttgccttctgacttctttccttccgtcagagatctcctggacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggacccggcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccacgcagtggaa
>gnl|hbvnuc|JQ707360_FT00000_P-A Feature FT:source JQ707360_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C36). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctacacttcatgg
gttacgtaattggaagttggggaacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatacatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatttttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggaattactctcgtttttgccttctgacttctttccttccgtcagagatctcctggacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccatcctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaagactggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggacccggcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccacgcagtggaa
>gnl|hbvnuc|JQ707369_FT00000_P-A Feature FT:source JQ707369_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C48). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctacacttcatgg
gttacgtaattggaagttggggaacattgccacaagatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctagacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcctttttgccctctgacttctttccttccgtcagagatctcctggacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
cggtacttgaatatttggtctctttcggagtgtggattcacactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcttctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtaattaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggacccggcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccacgcagtggaa
>gnl|hbvnuc|JQ707379_FT00000_P-A Feature FT:source JQ707379_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C24-9). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707380_FT00000_P-A Feature FT:source JQ707380_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C27). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatcctgatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggacccggcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccacgcagtggaa
>gnl|hbvnuc|JQ707382_FT00000_P-A Feature FT:source JQ707382_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C3). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtggataataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707385_FT00000_P-A Feature FT:source JQ707385_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C33). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707389_FT00000_P-A Feature FT:source JQ707389_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C38). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707395_FT00000_P-A Feature FT:source JQ707395_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C46). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcctcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgcggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccagataggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707400_FT00000_P-A Feature FT:source JQ707400_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C1). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaaatatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagatgaggtta
aaggtctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttgggccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707403_FT00000_P-A Feature FT:source JQ707403_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C16). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagaataggtta
aaggtctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707413_FT00000_P-A Feature FT:source JQ707413_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C34). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707417_FT00000_P-A Feature FT:source JQ707417_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C44). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctatattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707418_FT00000_P-A Feature FT:source JQ707418_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C47). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggacattgccacaagatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgtttgttttgctcgcagccggtctggagcaaagctcataggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcagaaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatcaagggatctagtagtcaa
ttatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaacttcactgggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctcttactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattctatcctacccacactaaatatttacccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggttcacccctccacacggcggtgttttggggtggagccctcaggctcagggcatgttgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707537_FT00000_P-A Feature FT:source JQ707537_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C15). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtgtgtcctct
acttccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctacgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgtttccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707550_FT00000_P-A Feature FT:source JQ707550_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C3). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgctcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggatcgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707554_FT00000_P-A Feature FT:source JQ707554_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C33). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgtctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctacgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgagaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707607_FT00000_P-A Feature FT:source JQ707607_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C8). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatatcgtattgggggccaagtctgtacagcatcgtgaggccctttatacccctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707608_FT00000_P-A Feature FT:source JQ707608_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C9). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaagggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggggtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcctttagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
tactaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtaaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttccccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagcgggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707630_FT00000_P-A Feature FT:source JQ707630_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C35). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgattggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttggacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaacctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707641_FT00000_P-A Feature FT:source JQ707641_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C17). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707646_FT00000_P-A Feature FT:source JQ707646_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C26). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtattacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccctcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggatcactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707659_FT00000_P-A Feature FT:source JQ707659_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_14). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacatacgaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcctgattggcaaactccttcctttcctaagattca
tttacaagaggacattattgataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaagtatttgcccttagataaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KF214660_FT00000_P-A Feature FT:source KF214660_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2008-9). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaa
cacacaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
gttatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgccgttgtatgcatgtatacaagcgaaacaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaatctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgaggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtccccttctgcgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactcccatcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccatcctcatgcaactttttcacctctgcctaatc
agctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacatcgacccttataa
agaatttggcgctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctacaagatacag
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacatcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggacttagtagtcaa
ttatgttaatactaatatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttacggggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttcttttcctaaaattca
tctacatgaagatattgctaatagatgtcagcaatttgtaggccctctcactgtaaatgaaaaaagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggatcaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggatcactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattgaccacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatacagtggaa
>gnl|hbvnuc|KF922428_FT00000_P-A Feature FT:source KF922428_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4312v3). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaactttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttatatgcatgtatacaagcgaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacctcatcgggactgataattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttcgcgaggtcgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggcaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactgttgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtcttccttggactcataaggtg
ggaaattgtactgggctttattcttctactgtccccatctttaatcctgaatggcaaactccctcttttcctaaaattca
tttacatgaagacatttctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaagagaagactaaaattaa
ttatgcctgctaggttttatcccaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcac
gtagttaatcattactttcagacccgacattatttacatactctttggaaggctgggatcctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccgtcaaagaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KF922433_FT00000_P-A Feature FT:source KF922433_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3658v1). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcgtcctgctggtggctccagttcaggaa
cacacaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaagactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaacgagtacgggaccctgcaaaacctgcacgactcctgctcagaacaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttccctcac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgtttcagaaaacttcct
gtcaatcgtcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
tgagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacttcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
aagatttatgtattaggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggatctactgtggagttactctcatttttgccttctgacttctttccttcagtacgggatctacttgatacag
cttcagctctgtatcgggaagccttagaatctccggagcattgctcccctcaccatacagcactcaggcaagccatttta
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgtcaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttagtctctttcggagtgtggatacgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcctctactgtccctaattttaatcctgaatggcaaactccttcctttcctaaaattca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaagaagattaaaattaa
ttatgcctgctagattttatcctaacagcactaaatatttgcccttagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatnnnnnnnnnnnnnnnnnnnnntcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattccttcccgatcatcagctggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagcccatcaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacattgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KF922434_FT00000_P-A Feature FT:source KF922434_FT00000_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3658v2). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cacacaaccctgttcccaatattgcctctcacatctcgtcaatctcctcgaagactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaacgagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcctttagttatatggatgatgtggtattgggggccaaatctgtacaacaccttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctaaatttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgtttcagaaaacttcct
gtcaatcgtcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
tgagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcgaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacttcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgct