HBVdb

Dataset for nucleotide sequence X of genotype RF

[Download (right click)] [Edit] [Sequences] [Repertoires]

1301 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


KC774246_X_P-RF-CB      atggttgcaagggtgtgctgccaagtggaccattggagggacgtcgggag
KC774461_X_P-RF-DC      atggctgctaggtcgtgttgccaactggatcctgcgcgggacgtcctttt
KC774475_X_P-RF-DC      atggctgctagggtgttttgccaactggatcctgcgggggacgtcctttg
KC774433_X_P-RF-DC      atggctggtaggatgggcggccaactggatcctgcgcgggacgtcctttg
EF464099_X_P-RF-AG      atggcagctaggctgtacggccaactggatccttggagggacgtcggttg
AB933282_X_P-RF-AG      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
AB933283_X_P-RF-AG      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ272887_X_P-RF-GF      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttg
KF219922_X_P-RF-GH      gtggctgctgggctgtgctgccaactggatccttcgcgggacgtcctttg
HE981180_X_P-RF-GF      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttg
EU833890_X_P-RF-GA      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttg
KP274926_X_P-RF-GA      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttg
AB933279_X_P-RF-AG      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttg
AB933280_X_P-RF-AG      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttg
AB933281_X_P-RF-AG      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttg
JQ272886_X_P-RF-GF      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttg
HE981179_X_P-RF-FG      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttg
JQ707474_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
EU833889_X_P-RF-GA      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttg
JQ707445_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707471_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707469_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707468_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707466_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707465_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707463_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707457_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707458_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707460_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707461_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707462_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707464_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707467_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707470_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707472_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707473_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707475_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707456_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707448_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707441_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707430_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707421_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707432_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707450_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707424_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707426_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
JQ707459_X_P-RF-GA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
Y18856_X_P-RF-CB        atggctgctcggctgtgctgccaactggatcctgcgcgggacatcctttg
Y18857_X_P-RF-CB        atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
GQ161806_X_P-RF-EA      atggctgctaggctgtrctgccaactggatycttcgagggacgtcctttg
KJ586803_X_P-RF-AF      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
GQ331048_X_P-RF-AE      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttg
KF214656_X_P-RF-AC      atggctgctcggatgtactgccaactggattcttcgcgggacgtcctttg
AB222708_X_P-RF-AD      atggctgctaggctstgctgccaactggatcctgcgcgtaaattggtctg
AY161140_X_P-RF-AD      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttg
AY161141_X_P-RF-AD      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttg
AY161147_X_P-RF-DA      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttg
JN688717_X_P-RF-DE      atggctgctaggctgtrctgccaactggatcctkcgcgggacgtcctttg
KJ647351_X_P-RF-DE      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
KJ647356_X_P-RF-DE      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
AF297619_X_P-RF-DA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
AF297620_X_P-RF-DA      atggctgctaggttgtactgccaactggatccttcgcgggacgtcctttg
X65259_X_P-RF-DA        atggctgctaggttgtactgccaactggatccttcgcgggacgtcctttg
EF494378_X_P-RF-CA      atggctgctaggttgtactgccaactggatccttcgcgggacgtcctttg
X68292_X_P-RF-DA        atggctgctaggttgtactgccaactggatccttcgcgggacgtcctttg
AB453985_X_P-RF-AC      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
AY236161_X_P-RF-DA      atggctgctaggctgtactgccaactggatccttcgcgggacgtcctttg
AY161145_X_P-RF-AD      atggctgctaggttgtactgccaactggatacttcgcgggacgtcctttg
AY161146_X_P-RF-AD      atggctgctaggttgtactgccaactggatacttcgcgggacgtcctttg
GQ161788_X_P-RF-AE      atggctgctaggctgtgctgccaactggattcttcgcgggacgtcctttg
GQ161767_X_P-RF-AE      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttg
GQ161837_X_P-RF-AE      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttg
HF571060_X_P-RF-AE      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttg
GQ161753_X_P-RF-AE      atggctgctaggctgtactgccaactggattcttcgcgggacgtcctttg
AY233277_X_P-RF-AC      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttg
KJ586810_X_P-RF-AF      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttg
JN688715_X_P-RF-DE      atggctgctaggctgtrctgccaactggatcctkcgcgggacgtcctttg
JN688689_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FN594767_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttg
DQ315780_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AB033558_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
GQ205379_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JN664915_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttg
JN664925_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttg
MK541689_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
DQ315779_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JN664929_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JN664940_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK516279_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK516280_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KC875338_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KC875339_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
GQ205387_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
GQ205386_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
GQ205377_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
GQ205378_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttg
JN664934_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KT366505_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MF618346_X_P-RF-DE      atggctgctaggatgtgctgccaactggatcctacgcgggacgtcctttg
HQ700494_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ349207_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MH481862_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttg
MF618347_X_P-RF-DE      atggctgctaggatgtgctgccaactggatcttacgcgggacgtcctttg
FJ904425_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ904409_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MH481859_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttg
MH481861_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttg
MH481858_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttg
MH481860_X_P-RF-DE      atggctgctaggttgtgctgccaactggatcctgcgcggaacgtcctttg
FJ904398_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FN594770_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ904428_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttg
MT591274_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MT591275_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ904430_X_P-RF-DE      atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttg
DQ991753_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AM494716_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ904397_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ904436_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ904417_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ904416_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ904405_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttg
FJ904404_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ904396_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ904401_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
GU177079_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ904444_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ904442_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttta
FJ904437_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ904408_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ904394_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ904414_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KP288875_X_P-RF-DE      atggctgctaggctgtsctgccaactggatcctgcgcgggacgtcctttg
FJ904447_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ904407_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ904403_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MT591280_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KF192833_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttg
KF192836_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttg
KU668440_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttg
KF192839_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttg
KF192838_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttg
KF192835_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttg
KF192837_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttg
KF192840_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttg
KF192841_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttg
KU711666_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AB188245_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AB048702_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AB048703_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ692536_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KX357641_X_P-RF-DE      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttg
KX357636_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KP168416_X_P-RF-DE      atggctgctaggttgtgctgccaactggatcctacgcgggacgtcctttg
KP168420_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ470892_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ470891_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700579_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700585_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700500_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700533_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700536_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700541_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700535_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700525_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700503_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700497_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700538_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700493_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700492_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AB033559_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700501_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700524_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700534_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700537_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700540_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700581_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700582_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700583_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700584_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ470887_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ470886_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ470888_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ470890_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ470884_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ470897_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ470898_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KU736917_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KU736914_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KU736915_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KX827299_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ904440_X_P-RF-DE      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttg
GQ161754_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FN594769_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FN594771_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KM606750_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KP995112_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ904406_X_P-RF-DE      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
FJ904400_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KM606751_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ904441_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KM606741_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KP168421_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KF170740_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttg
KU736916_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MT426114_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
X80925_X_P-RF-DE        atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JN642160_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AB194949_X_P-RF-AE      atggctgctaggttgtactgccaactggattcttcgcgggacgtcctttg
AB674412_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JN257204_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JN257154_X_P-RF-DE      atggctgctaggctgtgttgccaactggatcctgcgcgggacgtcctttg
HM146131_X_P-RF-AD      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JF754616_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MZ097822_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MZ097838_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcg
JN040803_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KF471643_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttg
JN257206_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctrcgcgggacgtcctttg
JN257207_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctrcgcgggacgtcctttg
JN257174_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctvcgagggacgtcctttg
JN257191_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MZ097687_X_P-RF-DE      atggctgctaggctgtrctgccaactggatcctgcgcgggacgtcctttg
JN664946_X_P-RF-DA      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MZ097680_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MZ097703_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JQ687532_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
EF103282_X_P-RF-AD      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ803771_X_P-RF-DB      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttg
AY341335_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MZ097814_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
EF103283_X_P-RF-AD      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MZ097850_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KM524357_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KR905422_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KT366503_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JF754613_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AB188243_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AB674433_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AB674432_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AB674436_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JN642141_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JN642152_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JN642137_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
EU594406_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JN257189_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AB330368_X_P-RF-DA      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JN257216_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JN257210_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MZ097826_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MZ097652_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JN257164_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MW601230_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MZ097719_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JN642127_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JN642139_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK052957_X_P-RF-DE      atggctgctaggctgtgctgccaactgggtcctgcgcgggacgtcctttg
MK052969_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK052967_X_P-RF-BD      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK052968_X_P-RF-BD      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK052970_X_P-RF-BD      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK052976_X_P-RF-BD      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
DQ464164_X_P-RF-DE      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttg
DQ464165_X_P-RF-DE      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttg
DQ464166_X_P-RF-DE      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttg
DQ464167_X_P-RF-DE      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttg
EU185780_X_P-RF-AD      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttg
KC012653_X_P-RF-AD      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttg
MW601296_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MZ097767_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ349212_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MG877711_X_P-RF-DE      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttg
JF440003_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JF440006_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JF440015_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JF440013_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JF440012_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JF440008_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JF440007_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JF440004_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JF440005_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JF439999_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JF439994_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JF439996_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JF439998_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JF440000_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JF440001_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JF440009_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JF440010_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JF440014_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JF439995_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JF440011_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JF440002_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JF440017_X_P-RF-DA      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MH724240_X_P-RF-DE      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttg
AJ344117_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MF488702_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JN664933_X_P-RF-DA      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MF488705_X_P-RF-AD      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ349221_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JX898698_X_P-RF-DE      atggctgctaggctgtsctgccaactggatcctgcgcgggacgtcctttg
JX898699_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MT426112_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK618440_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK618444_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AJ627221_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JX898687_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JX898688_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MT426113_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MT426111_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MT426110_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JX898696_X_P-RF-DE      atggctgctaggctgtsctgccaactggatcctgcgcgggacgtcctttg
JX898693_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JX898695_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK618442_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK618445_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JX898686_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AB210819_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MF967563_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK618438_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN507835_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
U95551_X_P-RF-DE        atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JX898690_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MZ097667_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KX357627_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KX357631_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KP168417_X_P-RF-DE      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttg
KP168418_X_P-RF-DE      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttg
KX357629_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KU736923_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttg
KX357628_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KX357625_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KX357624_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KX357632_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KX357630_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttg
KX357623_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KX357633_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KX357635_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KX357626_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KX357634_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JN664943_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MW601317_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KU736921_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KU736922_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KC774450_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KF679991_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ586811_X_P-RF-DF      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ647349_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MZ097766_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MH724222_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
GU563560_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AY233293_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MW601284_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttg
MZ097758_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttg
MH685719_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KX827302_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MW601235_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MZ097721_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MH464835_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MH724239_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KM359442_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KM386676_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MW601310_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MZ097777_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MW601260_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MZ097740_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK598656_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JN040798_X_P-RF-DE      atggctgctaggctgtgctgccaactggattctgcgcgggacgtcctttg
AB270538_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MF593359_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
DQ315777_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KM524336_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KM524337_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MH724243_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KT366504_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
EF103284_X_P-RF-AD      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
DQ111987_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AB583679_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MZ097806_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
EU594436_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MW601227_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MZ097716_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KT366492_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AY373430_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KM524359_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK598654_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AJ627217_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK618439_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MW601241_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MZ097724_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK598653_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
EU594435_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK598652_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MW601264_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MZ097745_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KM577666_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MH464846_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MH464852_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AY233295_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN507850_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KM577667_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MF488699_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KM577663_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KM577664_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
GQ183486_X_P-RF-DE      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttg
EF103285_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KM577665_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MH464851_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MT210033_X_P-RF-DE      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MG826150_X_P-RF-BC      atggctgctcgggtgggctgccaactggatcctgcgcgggacgtcctttg
MT426089_X_P-RF-AB      atggctgctagggtgtactgccaactggattcttcgcgggacgtcctttg
KJ803788_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MH368022_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534613_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KY470865_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KY470858_X_P-RF-GC      atggctgttaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KY470871_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KP148586_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KP148450_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KP148441_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KP148442_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KP148447_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KP148449_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ023659_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ023662_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KY470996_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KY471004_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KY471005_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KY470997_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MG826145_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MH746811_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MH746812_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MH746813_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KY471003_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KY471006_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KY470998_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KY471001_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KY470999_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KY471000_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KY471002_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KY471007_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FR714490_X_P-RF-GB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KC172106_X_P-RF-GB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FR714496_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MZ439768_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttc
MZ439798_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttc
FJ562247_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
GQ377592_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
EU939623_X_P-RF-CB      atggttggtaggttgtgctgccaaatggatcctgcgcgggacgtcctttg
GQ377627_X_P-RF-CD      atggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttg
GQ377626_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU522070_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
GQ377573_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
GQ377613_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
KJ173299_X_P-RF-CB      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttg
KJ173300_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ562287_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
FJ562227_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
AB367393_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgagggacgtcctttg
MT645029_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
GQ377544_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
LC279264_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU939589_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
FJ562336_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU939565_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
LC279263_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
LC279265_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
LC279266_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
LC279267_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
GQ377516_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774344_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
GQ377520_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
GQ377534_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
AY206374_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
FJ562328_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
FJ562267_X_P-RF-CB      atggctgctagggtgtgctgccaactggatactgcgcgggacgtcctttg
FJ032337_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ386586_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU939621_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
GQ377560_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963883_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
AF461361_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
GQ377634_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
FJ386581_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
FJ386593_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
AY817512_X_P-RF-DC      atggctgctggggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774447_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AY040627_X_P-RF-CB      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttg
KC774198_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774201_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774307_X_P-RF-CB      atggctgcttgggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774323_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774193_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774291_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774188_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU939551_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU919166_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU919167_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963940_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963938_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963936_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963930_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963931_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963932_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963934_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963935_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963939_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963941_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963942_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963943_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963944_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963933_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
AB195950_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttg
AB195951_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttg
KC774317_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774322_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
GU357843_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttg
GQ377549_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttg
KM875422_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KC774498_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU787435_X_P-RF-DC      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttg
DQ478898_X_P-RF-DC      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774454_X_P-RF-DC      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
MG826149_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KU963990_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttg
KU963991_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttg
KU963993_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttg
KU963994_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttg
KU963995_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttg
KU963998_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttg
KU963999_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttg
KU964001_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttg
KU964003_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttg
KR013816_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttg
GQ377633_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
GQ377607_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
FJ386578_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
FJ386585_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
FJ386649_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EF494376_X_P-RF-CA      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
JQ040146_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
JX661498_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
LC458432_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttg
KF917451_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774324_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
JX026887_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
GQ377548_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KJ173325_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KJ173326_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
FJ386633_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774328_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttg
KC774183_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774186_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MK321265_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MK720627_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MK720628_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MG893561_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774230_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
FJ787446_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
FJ787480_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU916228_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KY470893_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU939581_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
FJ562223_X_P-RF-CD      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttg
FJ562229_X_P-RF-CB      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttg
GQ377539_X_P-RF-CB      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttg
GQ377602_X_P-RF-CB      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttg
JX429896_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
JX661494_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU964351_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
FJ562305_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
AB670303_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
AB014375_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
AF411409_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MW887644_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
GQ377565_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
GQ377596_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
GQ377564_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
GQ377614_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
GQ377581_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
GQ377590_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774294_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
GU385774_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
GQ377604_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KR013806_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
FJ562277_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KJ173329_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KJ173330_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU882006_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MW887645_X_P-RF-CD      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KR013843_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
JN664935_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
EU939668_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774414_X_P-RF-BC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MT645071_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
EU871994_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU871987_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU871988_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU871990_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU871981_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
EU871999_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
EU871989_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU872015_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcggggcgtcctttg
EU871983_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
EU872014_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
EU871995_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU871984_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU871985_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU871991_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU871992_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU871993_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU871996_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU871986_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
KC774466_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU717211_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU939602_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
AB049609_X_P-RF-CB      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttg
EU871997_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
AY123424_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
M38454_X_P-RF-CB        atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
AB367419_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
AY247030_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
AF330110_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
JF828935_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
JF828933_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
JF828936_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
JF828938_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
JF828934_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
MT645070_X_P-RF-DC      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
GQ377522_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KY363272_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
KY363273_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
KY629632_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU939632_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
AB205152_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683640_X_P-RF-DC      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
FJ562294_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MK534585_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
AB367800_X_P-RF-CB      atggctgctcggatgtgctgccaactggatcctgcgagggacgtcctttg
AB367400_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
AB642096_X_P-RF-CB      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttg
JQ801476_X_P-RF-CG      atggctgctaggctgtgctgccaactggatacttcgcgggacgtcctttg
KX765835_X_P-RF-GC      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttg
KJ803772_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534701_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttg
MK534615_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KX774505_X_P-RF-BC      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttg
MK534724_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534700_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534725_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534637_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534668_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AB031265_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MF925392_X_P-RF-DB      atggctgctaggctgttccacagcctggcagctgcgcgggacgtcctttg
MF925360_X_P-RF-DB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MF925381_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MF925370_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MF925402_X_P-RF-BD      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MF925382_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MF925384_X_P-RF-DB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JQ027310_X_P-RF-CB      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttg
KJ173320_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ173322_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ386674_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KC315400_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
HQ684848_X_P-RF-CB      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttg
HQ684849_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MG826146_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MG826147_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
EU939629_X_P-RF-BC      atggctgctaggctgcgctgccaactggatcctgcgcgggacgtcctttg
MK534719_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
GQ377635_X_P-RF-BC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KJ803778_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534587_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
GQ377630_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
EU939631_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ803782_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ173349_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ803791_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
MK534660_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ173350_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KC774178_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KC774364_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ173358_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JF436923_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ803802_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534594_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534712_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534706_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534714_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534715_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534728_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534729_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534734_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534716_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ803803_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534684_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534717_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MT645056_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534577_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AF233236_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
EU660227_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KP148337_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ173279_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ173280_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700519_X_P-RF-CB      atggctgctaggttgtgctgccaactggatactacgcgggacgtcctttg
HQ700521_X_P-RF-CB      atggctgctaggttgtgctgccaactggatcctacgcgggacgtcctttg
KJ803822_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
MK534665_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534675_X_P-RF-BC      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
KF873530_X_P-RF-CB      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ361772_X_P-RF-GC      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534653_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ803804_X_P-RF-CB      atggctgctcggctgtgctgccaactggatcctgcgagggacgtcctttg
KJ803827_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttg
MK534686_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534558_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MF925401_X_P-RF-DB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ803785_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
EU939627_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534681_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MT645015_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ410497_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MZ439673_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534648_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ803753_X_P-RF-CB      atggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttg
JQ801477_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534620_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534713_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534639_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534569_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534630_X_P-RF-BC      atggctgctaggctgtgctgccaactggttactgcgcgggacgtcctttg
MK534689_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534731_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534590_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534566_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534582_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534559_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534617_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534670_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534564_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534589_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534730_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534726_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534625_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534579_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534555_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534561_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534562_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534567_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534580_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534583_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534609_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534610_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534618_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534635_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534646_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534651_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534654_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534655_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534695_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534718_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534556_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534563_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534568_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534607_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534632_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534633_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534663_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534721_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534560_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534598_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ803798_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JN104438_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JN104442_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MF925371_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MF925388_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MF925396_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MF925397_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MF925404_X_P-RF-AC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MF925386_X_P-RF-AC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534662_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534682_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534574_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KJ410506_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AB674504_X_P-RF-DC      atggctgctaggatgtgctgccaactggatcctgcgcggaacgtcctttg
MK534606_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534616_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534623_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534664_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534669_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534685_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534687_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534688_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534641_X_P-RF-BC      atggctgctaggctgtgctgccgactggatcctgcgcgggacgtcctttg
MK534672_X_P-RF-BC      atggctgctaggctgtgctgccgactggatcctgcgcgggacgtcctttg
MK534690_X_P-RF-BC      atggctgctaggctgtgctgccgactggatcctgcgcgggacgtcctttg
MK534736_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
GQ924618_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534722_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534679_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534723_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MK534735_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
X75656_X_P-RF-CB        atggctgctcggctgtgctgccaactggatcctacgagggacgtcctttg
KY881840_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700542_X_P-RF-CB      atggctgctaggttgtgctgccaactggatcctacgcggaacgtcctttg
AB493842_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
FJ882617_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ882610_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ882614_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ023670_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ023666_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ023664_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ023673_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ882613_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ023667_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ023665_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
EU833891_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcatgcgcgggacgtcctttg
FJ023668_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ882611_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ882612_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ882618_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AB241109_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
MG826141_X_P-RF-CB      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttg
MK534584_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KT003704_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
KP148352_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
LC416040_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttg
AP011104_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
AP011105_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700554_X_P-RF-CB      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttg
HQ700520_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700518_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttg
FJ386646_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttg
HQ700557_X_P-RF-CB      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttg
HQ700498_X_P-RF-CB      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttg
HQ700499_X_P-RF-CB      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttg
HQ700560_X_P-RF-CB      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttg
KU695745_X_P-RF-CB      atggctgctcggttgtgctgccaactggatccttcgcrggacgtcctttg
HQ700580_X_P-RF-CB      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttg
HQ700462_X_P-RF-CB      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttg
HQ700485_X_P-RF-CB      atggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttg
FJ562302_X_P-RF-CB      atggctgctcggatgtgctgccaactggatcctgcgctggacgtcctttg
KU679945_X_P-RF-CB      atggctgctcggttgtgctgcgaactggatcctacgcgggacgtccttcg
KF873537_X_P-RF-CB      atggctgctcggttgtgctgcgaactggatcctgcgcgggacgtcctttg
KF873540_X_P-RF-CB      atggctgctcggttgtgctgcraactggatcctacgcgggacgtcctttg
KF873538_X_P-RF-CB      atggctgctcggttgtgctgcgaactggatcctgcgcgggacgtcctttg
KF873542_X_P-RF-CB      atggctgctcggttgtgctgcgaactggatcctacgcgggacgtcctttg
KF873543_X_P-RF-CB      atggctgctcggttgtgctgcgaactggatcctacgcgggacgtcctttg
GQ377595_X_P-RF-BC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU679958_X_P-RF-CB      atggctgctcggttgcgctgccaactggatcctgcgcgggacgtcctttg
KU679941_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
KF873522_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
KF873523_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
KF873524_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
KU679955_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
KU679948_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
KF873519_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
KF873521_X_P-RF-BC      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
KF873518_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
KU679950_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
KF873513_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
KU679953_X_P-RF-BC      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
KF873511_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
KF873515_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
KF873517_X_P-RF-BC      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
KU679946_X_P-RF-BC      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
KU679944_X_P-RF-BC      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
KF873527_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
KU679956_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
KU679943_X_P-RF-BC      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
KU679942_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
KU679954_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
EU787434_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KF214680_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AP011108_X_P-RF-CB      atggctgctaggttgtgctgccaactggatacttcgcgggacgtcctttg
MG826151_X_P-RF-BC      atggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttg
MG826148_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MG826144_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
MN650079_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
GQ358155_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
GQ358156_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
AB493837_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
AB493838_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
AB493847_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
AB493840_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700531_X_P-RF-CB      atggctgctaggttgtgctgccaactggatcctacgcgggacgtcctttg
HQ700532_X_P-RF-CB      atggctgctaggttgtgctgccaactggatcctacgcgggacgtcctttg
AB105172_X_P-RF-CB      atggctgctaggttgtgctgccaactggatactgcgcgggacgtcctttg
KF873535_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgmgggacgtcctttg
KU679939_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgagggacgtcctttg
KU679940_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgagggacgtcctttg
KU695742_X_P-RF-CB      atggctgctcggatgtgctgccaactggatccttcgcgggacgtcctttg
HQ700523_X_P-RF-CB      atggctgctaggttgtgctgccaactggatcctacgcgggacgtcctttg
HQ700530_X_P-RF-CB      atggctgctaggttgtgctgccaactggatcctacgcgggacgtcctttg
HQ700509_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700507_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700508_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU695744_X_P-RF-CB      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttg
KU679952_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
KF873531_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttg
KF873532_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttg
KF873533_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttg
KF873534_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttg
AP011103_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
KU695746_X_P-RF-CB      atggctgctaggttgtgctgccaattggatcctgcgcgggacgtcctttg
HQ700505_X_P-RF-CB      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttg
KU695741_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
KU695743_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700527_X_P-RF-CB      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700528_X_P-RF-CB      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttg
JX504540_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
FJ562271_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
EU835240_X_P-RF-GC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MH094410_X_P-RF-BC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
EU939547_X_P-RF-CB      atggctggtagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KJ598675_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JF436919_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU939620_X_P-RF-CB      atggctgctagggtgtgctgccaactggaccctgcgcgggacgtcctttg
AP011102_X_P-RF-CB      atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttg
MN683655_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KY363262_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KY363263_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774349_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU939630_X_P-RF-CB      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttg
EU939577_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
EU589337_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
FJ032343_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN650085_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700526_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683584_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683679_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HM750150_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683716_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttg
MN650083_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683680_X_P-RF-DC      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
MN683700_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HM750144_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AY057948_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683715_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683712_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683721_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683720_X_P-RF-DC      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttg
MN650076_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KC774485_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683687_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttg
MN683688_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttg
KU964366_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KU964367_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KU964370_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KU964372_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KU964374_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KU964380_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KU964379_X_P-RF-DC      atggctgctgggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ562263_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KT991424_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
AY817511_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KT991427_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683703_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683719_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KX354997_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683724_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683713_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HM750145_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
FJ349241_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683689_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683692_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KX660689_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683711_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KC774482_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KX660686_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683707_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683696_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN650084_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN650080_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN650081_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN650082_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683697_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttg
MN650074_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HM750149_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HM750146_X_P-RF-DC      atggctgctaggctgcgctgccaactggatcctgcgcgggacgtcctttg
DQ478890_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683722_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683725_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN650069_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN650072_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN650073_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN650078_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN650086_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN650077_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683723_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683717_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683690_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683686_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN650087_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN650075_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KP276256_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KP276253_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KX660684_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683695_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683699_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683706_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683718_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HM750147_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HM750142_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KC774456_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HM750143_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
HM750148_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683691_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683693_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683694_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MT645039_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
FJ562317_X_P-RF-CB      atggctgctagggtgtgctgccaactggatactgcgcgggacgtcctttg
MF925389_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KY670781_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774476_X_P-RF-DC      atggctggtagggtgtggtgccaactggatcctgcgcgggacgtcctttg
JF436922_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774222_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
FJ562314_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MG893559_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MT645035_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
JQ707714_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
AY800249_X_P-RF-DC      atggccgctaggttgtgctgccaactggatcctgcgcgggacgtcctttg
KC774420_X_P-RF-DC      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttg
KC774426_X_P-RF-DC      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttg
KC774483_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774430_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774486_X_P-RF-DC      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774495_X_P-RF-DC      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774458_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774474_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KY470853_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
AB270535_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
AB300369_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683730_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KX660682_X_P-RF-DC      atggctgctrgggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774212_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
KY470845_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KY470848_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KY470851_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KY470852_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KT991419_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttg
KT991420_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
FJ562278_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttg
KT991417_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttg
KT991423_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttg
KM213033_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774453_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MG826142_X_P-RF-CB      atggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttg
AY817515_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774457_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KX096713_X_P-RF-CA      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683677_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683620_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683581_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KC774425_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
FJ386643_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU589339_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MT645063_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MT645045_X_P-RF-BC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MT645049_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MT645060_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683676_X_P-RF-DC      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttg
GQ377594_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
KY470844_X_P-RF-DC      atagctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774488_X_P-RF-DC      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
KC774493_X_P-RF-DC      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
KC774479_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774484_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774494_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774499_X_P-RF-DC      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
AY862865_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KY470843_X_P-RF-DC      atggctgctggggtgtgctgccaactggatcctgcgcgggacgtcctttg
KY470846_X_P-RF-DC      atggctgctggggtgtgctgccaactggatcctgcgcgggacgtcctttg
KY470847_X_P-RF-DC      atggctgctggggtgtgctgccaactggatcctgcgcgggacgtcctttg
KY470849_X_P-RF-DC      atggctgctggggtgtgctgccaactggatcctgcgcgggacgtcctttg
KY470850_X_P-RF-DC      atggctgctggggtgtgctgccaactggatcctgcgcgggacgtcctttg
KY470855_X_P-RF-DC      atggctgctggggtgtgctgccaactggatcctgcgcgggacgtcctttg
KY470854_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MT645069_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683582_X_P-RF-DC      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
MN650068_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774472_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774470_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
GQ377611_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU881995_X_P-RF-CB      atggctgctcgggtgtcctgccaactggatcctgcgcgggacgtcctttg
AY817513_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KX660677_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683668_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683642_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683632_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683663_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683714_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774481_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MT645067_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU939606_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
AB195956_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
AB195957_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
AB195939_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
AB195940_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
AB195941_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
AB195955_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
MN683671_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683650_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683649_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683621_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683572_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KT991421_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttg
KC774428_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
GQ377556_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
DQ478892_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
DQ478886_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
FJ562226_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683611_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
AY862866_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683603_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
AY862864_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683639_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683625_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683623_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683622_X_P-RF-DC      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683610_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683597_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683580_X_P-RF-DC      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttg
MN683678_X_P-RF-DC      atggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttg
KC774423_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774471_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683624_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683626_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683627_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683628_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683657_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MT645062_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774449_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttg
MN657317_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MT645066_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683669_X_P-RF-DC      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
MN683660_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774463_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774452_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttg
JF491449_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KP276254_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774424_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MT645048_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683618_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JQ040174_X_P-RF-CB      atggctgctaggrtgtgctgccaactggatcctgcgcgggacgtcctttg
JQ732168_X_P-RF-CB      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttg
KC774422_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
JX661487_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683647_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774431_X_P-RF-DC      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
HQ700547_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN657316_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683574_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683673_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
GQ475335_X_P-RF-CB      atggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttg
MN683607_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774305_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
JN400086_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KJ410520_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU519422_X_P-RF-DC      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
MN683672_X_P-RF-DC      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
KX660685_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683641_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KU963856_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963857_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963858_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963859_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963860_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963861_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963862_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963863_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963864_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963865_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963866_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963867_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963868_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963869_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU963870_X_P-RF-CB      atggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774492_X_P-RF-DC      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
KC774487_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774432_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttg
AB033557_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
FJ386635_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
DQ089798_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
AY817510_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MG893554_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
JX661485_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
JQ040142_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MG893555_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
JQ040148_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
JX661486_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683617_X_P-RF-DC      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcttttg
MN683645_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774497_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttg
MN683619_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774234_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
JQ040175_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
DQ478887_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KX660675_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683666_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN657315_X_P-RF-DC      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
MN683662_X_P-RF-DC      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
MT645065_X_P-RF-DC      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
JF491455_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683635_X_P-RF-DC      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
MN683659_X_P-RF-DC      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
MN683630_X_P-RF-DC      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
MN683634_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774258_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774490_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU916239_X_P-RF-CB      atggctgttagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU916241_X_P-RF-CB      atggctgttagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU916240_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683652_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683613_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683614_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683615_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683579_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774489_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttg
KC774478_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774480_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774448_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774434_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
JX429898_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
HM750133_X_P-RF-CB      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
DQ478889_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774332_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
KC774341_X_P-RF-CB      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
KC774263_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
AY167095_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU787444_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU964308_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
EU916232_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU964005_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU964006_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU964007_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU964008_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU964009_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU964010_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU964303_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU964304_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU964305_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU964306_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU964307_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU964309_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU964310_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU964311_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU964312_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU964313_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU964314_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU964315_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU964316_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU964317_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683684_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
JF491448_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683664_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683590_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KX660674_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KX660680_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683665_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683609_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683651_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774435_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttg
KC774442_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttg
MN683653_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683643_X_P-RF-DC      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
MN683644_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683588_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
JF491451_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683605_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683675_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
AB198084_X_P-RF-CB      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683612_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683616_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683685_X_P-RF-DC      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
MN683656_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683654_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683636_X_P-RF-DC      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
MN683637_X_P-RF-DC      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
MN683638_X_P-RF-DC      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
MN683596_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683586_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KU519423_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683674_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
KC774455_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttg
KC774443_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttg
KC774439_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
DQ478897_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
AY817509_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
MN683587_X_P-RF-DC      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttg
JF491456_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KC774468_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
KP276255_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683571_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683592_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683594_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683658_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683661_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683683_X_P-RF-DC      atggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttg
MN683670_X_P-RF-DC      atggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttg
                         * *  *   **        *    ***    *  *       *      

KC774246_X_P-RF-CB      tttacgtgccgtcggcccggaatcccgcggacgaccggtctcgccgccgt
KC774461_X_P-RF-DC      tctacgtccggtggccgttgtatccggccgacgacccgtgtcggggccgg
KC774475_X_P-RF-DC      tctacgtccggtcgccgttgtatcccgccggtggcccatgtcggggccgg
KC774433_X_P-RF-DC      tttacgtccggtgggcggtgaatcccgcggacgacccttcccgggcccgt
EF464099_X_P-RF-AG      tttatgtcccgtcagcccctaatccagcggacgacccctcccgggcccct
AB933282_X_P-RF-AG      tctacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgc
AB933283_X_P-RF-AG      tctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ272887_X_P-RF-GF      tttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgt
KF219922_X_P-RF-GH      tttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgt
HE981180_X_P-RF-GF      tttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgt
EU833890_X_P-RF-GA      tttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgt
KP274926_X_P-RF-GA      tttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgt
AB933279_X_P-RF-AG      tttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgt
AB933280_X_P-RF-AG      tttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgt
AB933281_X_P-RF-AG      tttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgt
JQ272886_X_P-RF-GF      tttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgt
HE981179_X_P-RF-FG      tttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgt
JQ707474_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
EU833889_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707445_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707471_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707469_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707468_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707466_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccga
JQ707465_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707463_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707457_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707458_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707460_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707461_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707462_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707464_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707467_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707470_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707472_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707473_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707475_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707456_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707448_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707441_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707430_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707421_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707432_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707450_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707424_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707426_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
JQ707459_X_P-RF-GA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
Y18856_X_P-RF-CB        tctacgtccctgcggcgctgaatcccgcggacgacccgtctcggggtcgc
Y18857_X_P-RF-CB        tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
GQ161806_X_P-RF-EA      tctacgtcccgtcagcgctgaatccygcggacgacccctctcggggtcgc
KJ586803_X_P-RF-AF      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
GQ331048_X_P-RF-AE      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggtcgc
KF214656_X_P-RF-AC      tatacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgc
AB222708_X_P-RF-AD      ttaacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
AY161140_X_P-RF-AD      tttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgc
AY161141_X_P-RF-AD      tttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgc
AY161147_X_P-RF-DA      tttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgc
JN688717_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
KJ647351_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgt
KJ647356_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgt
AF297619_X_P-RF-DA      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
AF297620_X_P-RF-DA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
X65259_X_P-RF-DA        tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
EF494378_X_P-RF-CA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
X68292_X_P-RF-DA        tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
AB453985_X_P-RF-AC      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
AY236161_X_P-RF-DA      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
AY161145_X_P-RF-AD      tttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgc
AY161146_X_P-RF-AD      tttacgtcccgtcggcgctgaatcccgcggacgacccctcgcgaggccgc
GQ161788_X_P-RF-AE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
GQ161767_X_P-RF-AE      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
GQ161837_X_P-RF-AE      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
HF571060_X_P-RF-AE      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
GQ161753_X_P-RF-AE      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
AY233277_X_P-RF-AC      tttacgttccgtcggcgctgaatcccgcggacgacccctcgcggggccgc
KJ586810_X_P-RF-AF      tttacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgc
JN688715_X_P-RF-DE      tytacgtcccgtcggcgctgaatcccgcggacgacccytctcggggycgy
JN688689_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggycgc
FN594767_X_P-RF-DE      tctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggtcgc
DQ315780_X_P-RF-DE      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
AB033558_X_P-RF-DE      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
GQ205379_X_P-RF-DE      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
JN664915_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
JN664925_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
MK541689_X_P-RF-DE      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
DQ315779_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
JN664929_X_P-RF-DE      tctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgc
JN664940_X_P-RF-DE      tttacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgc
MK516279_X_P-RF-DE      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
MK516280_X_P-RF-DE      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
KC875338_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
KC875339_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
GQ205387_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacggcccgtctcggggccgc
GQ205386_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
GQ205377_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
GQ205378_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
JN664934_X_P-RF-DE      tttacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgc
KT366505_X_P-RF-DE      tttacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgc
MF618346_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
HQ700494_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggycgc
FJ349207_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
MH481862_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
MF618347_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgt
FJ904425_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
FJ904409_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MH481859_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
MH481861_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
MH481858_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
MH481860_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
FJ904398_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
FN594770_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
FJ904428_X_P-RF-DE      tttacgtcccatcggcgctgaatcctgcggacgacccgtctcggggccgc
MT591274_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
MT591275_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
FJ904430_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
DQ991753_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
AM494716_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
FJ904397_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
FJ904436_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
FJ904417_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
FJ904416_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
FJ904405_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
FJ904404_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
FJ904396_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
FJ904401_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
GU177079_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
FJ904444_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
FJ904442_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
FJ904437_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
FJ904408_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
FJ904394_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
FJ904414_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
KP288875_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
FJ904447_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
FJ904407_X_P-RF-DE      tttacgtcccttcggcgctgaatcctgcggacgacccttctcggggccgc
FJ904403_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggccgc
MT591280_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
KF192833_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KF192836_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KU668440_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KF192839_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KF192838_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KF192835_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KF192837_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KF192840_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KF192841_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KU711666_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
AB188245_X_P-RF-DE      tctacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
AB048702_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
AB048703_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
FJ692536_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
KX357641_X_P-RF-DE      tttacgtcccgtctgcgctgaatcctgcggacgacccttctcggggccga
KX357636_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
KP168416_X_P-RF-DE      tttacgtcccgtcggcgttgaatcctgcggacgacccgtctcggggccgc
KP168420_X_P-RF-DE      tttacgtcccttctgcgctgaatcctgcggacgacccttctcggggccga
KJ470892_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
KJ470891_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
HQ700579_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
HQ700585_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
HQ700500_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
HQ700533_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggccgc
HQ700536_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggccgc
HQ700541_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggccgc
HQ700535_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
HQ700525_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
HQ700503_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
HQ700497_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
HQ700538_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
HQ700493_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
HQ700492_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
AB033559_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
HQ700501_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
HQ700524_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
HQ700534_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
HQ700537_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
HQ700540_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
HQ700581_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
HQ700582_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
HQ700583_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
HQ700584_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
KJ470887_X_P-RF-DE      tttacgtcccatcggcgctgaatcccgcggacgacccttctcggggccgc
KJ470886_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KJ470888_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KJ470890_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KJ470884_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KJ470897_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KJ470898_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KU736917_X_P-RF-DE      tttacgtcccgtctgcgctgaatccggcggacgacccttctcggggccgc
KU736914_X_P-RF-DE      tttacgtcccgtctgcgctgaatccggcggacgacccttctcggggccgc
KU736915_X_P-RF-DE      tttacgtcccgtctgcgctgaatccggcggacgacccttctcggggccgc
KX827299_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
FJ904440_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
GQ161754_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
FN594769_X_P-RF-DE      tttacgtcccgtcggcgatgaatcctgcggacgacccttctcggggccgc
FN594771_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
KM606750_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
KP995112_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
FJ904406_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
FJ904400_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
KM606751_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
FJ904441_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
KM606741_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
KP168421_X_P-RF-DE      tttacgtcccttctgcgctgaatcctgcggacgacccttctcggggccgc
KF170740_X_P-RF-DE      tttacgtcccgtcagcgctgaatcctgcggacgacccttctcggggccgc
KU736916_X_P-RF-DE      tttacgtcccgtcagcgctgaatcctgcggacgacccttctcggggccgc
MT426114_X_P-RF-DE      tttacgtcccttctgcgctgaatcctgcggacgacccttctcggggccgc
X80925_X_P-RF-DE        tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
JN642160_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
AB194949_X_P-RF-AE      tctacgtcccgtcagcgctgaatcccgcggacgacccctctcggggccgt
AB674412_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttcgcggggccgc
JN257204_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
JN257154_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
HM146131_X_P-RF-AD      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
JF754616_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
MZ097822_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
MZ097838_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
JN040803_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
KF471643_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
JN257206_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
JN257207_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
JN257174_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggccgc
JN257191_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggccgc
MZ097687_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
JN664946_X_P-RF-DA      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MZ097680_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MZ097703_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
JQ687532_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
EF103282_X_P-RF-AD      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KJ803771_X_P-RF-DB      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
AY341335_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MZ097814_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
EF103283_X_P-RF-AD      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MZ097850_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KM524357_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KR905422_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KT366503_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
JF754613_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccga
AB188243_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
AB674433_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
AB674432_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
AB674436_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
JN642141_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
JN642152_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
JN642137_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
EU594406_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
JN257189_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
AB330368_X_P-RF-DA      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
JN257216_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
JN257210_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
MZ097826_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
MZ097652_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
JN257164_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
MW601230_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
MZ097719_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JN642127_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
JN642139_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
MK052957_X_P-RF-DE      tttacgtcccgtcagcgctgaatccggcggacgacccgtctcggggccgc
MK052969_X_P-RF-DE      tttacgtcccgtcagcgctgaatccggcggacgacccgtctcggggccgc
MK052967_X_P-RF-BD      tttacgtcccgtcagcgctgaatccggcggacgacccgtctcggggccgc
MK052968_X_P-RF-BD      tttacgtcccgtcagcgctgaatccggcggacgacccgtctcggggccgc
MK052970_X_P-RF-BD      tttacgtcccgtcggcgctgaatccggcggacgacccgtctcggggccgc
MK052976_X_P-RF-BD      tttacgtcccgtcagcgctgaatccggcggacgacccgtctcggggccgc
DQ464164_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
DQ464165_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
DQ464166_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
DQ464167_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
EU185780_X_P-RF-AD      tywwcgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
KC012653_X_P-RF-AD      tywwcgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
MW601296_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
MZ097767_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
FJ349212_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
MG877711_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JF440003_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JF440006_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JF440015_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcagacgacccttctcggggtcgc
JF440013_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JF440012_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JF440008_X_P-RF-DE      cttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JF440007_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JF440004_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JF440005_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JF439999_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JF439994_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JF439996_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JF439998_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JF440000_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JF440001_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JF440009_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JF440010_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JF440014_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JF439995_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JF440011_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JF440002_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JF440017_X_P-RF-DA      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
MH724240_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
AJ344117_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
MF488702_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JN664933_X_P-RF-DA      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
MF488705_X_P-RF-AD      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
FJ349221_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JX898698_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JX898699_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
MT426112_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggtcgc
MK618440_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
MK618444_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
AJ627221_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JX898687_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JX898688_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
MT426113_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcgaggtcgc
MT426111_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
MT426110_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JX898696_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JX898693_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JX898695_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
MK618442_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
MK618445_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JX898686_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
AB210819_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
MF967563_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
MK618438_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
MN507835_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
U95551_X_P-RF-DE        tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
JX898690_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
MZ097667_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
KX357627_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
KX357631_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
KP168417_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggccgc
KP168418_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggccgc
KX357629_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggacgc
KU736923_X_P-RF-DE      tctacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
KX357628_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
KX357625_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
KX357624_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
KX357632_X_P-RF-DE      tttacgtcccgtcgacgctgaatcctgcggacgacccttctcggggccgc
KX357630_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
KX357623_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
KX357633_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
KX357635_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
KX357626_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
KX357634_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
JN664943_X_P-RF-DE      tttacgtcccctcggcgctgaatcccgcggacgacccttctcggggtcgc
MW601317_X_P-RF-DE      tttacgtcccctcggcgctgaaccccgcggacgacccttctcggggtcgc
KU736921_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggacgc
KU736922_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggacgc
KC774450_X_P-RF-DE      tttacgtcccctcggcgctgaatcccgcggacgacccttccaggggccgc
KF679991_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
KJ586811_X_P-RF-DF      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
KJ647349_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
MZ097766_X_P-RF-DE      tttacgtcccctcggcgctgaatcccgcggacgacccttctcggggtcgc
MH724222_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
GU563560_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
AY233293_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
MW601284_X_P-RF-DE      tttacgtcccctcggcgctgaatcccgcggacgacccttctcggggtcgc
MZ097758_X_P-RF-DE      tttacgtcccctcggcgctgaatcccgcggacgacccttctcggggtcgc
MH685719_X_P-RF-DE      tttacgtcccgtcagcgctgaatcctgcggacgacccttctcggggtcgc
KX827302_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
MW601235_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
MZ097721_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
MH464835_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccatctcgaggtcgc
MH724239_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
KM359442_X_P-RF-DE      tctacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
KM386676_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
MW601310_X_P-RF-DE      tttacgtcccctcggcgctgaatcccgcggacgacccttctcggggtcgc
MZ097777_X_P-RF-DE      tttacgtcccctcggcgctgaatcccgcggacgacccttctcggggtcgc
MW601260_X_P-RF-DE      tttacgtcccctcagcgctgaatcccgcggacgacccgtctcggggtcgc
MZ097740_X_P-RF-DE      tttacgtcccctcagcgctgaatcccgcggacgacccgtctcggggtcgc
MK598656_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
JN040798_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
AB270538_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
MF593359_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
DQ315777_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
KM524336_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
KM524337_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
MH724243_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
KT366504_X_P-RF-DE      tttacgtcccctcggcgctgaatcccgcggacgacccttctcggggtcgc
EF103284_X_P-RF-AD      tttacgtcccctcagcgctgaatcccgcggacgacccttctcggggtcgc
DQ111987_X_P-RF-DE      tttacgtcccctcggcgctgaatcccgcggacgacccttctcggggtcgc
AB583679_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
MZ097806_X_P-RF-DE      tttacgtcccctcggcgctgaatcccgcggacgacccttctcggggtcgc
EU594436_X_P-RF-DE      tttacgtcccctcggcgctgaatcccgcggacgacccttctcggggtcgc
MW601227_X_P-RF-DE      tttacgtcccctcggcgctgaatcccgcggacgacccttctcggggtcgc
MZ097716_X_P-RF-DE      tttacgtcccctcggcgctgaatcccgcggacgacccttctcggggtcgc
KT366492_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
AY373430_X_P-RF-DE      tttacgtcccgtcagcgctgaatcccgcggacgacccttctcggggtcgc
KM524359_X_P-RF-DE      tttacgtcccgtcagcgctgaatcccgcggacgacccttctcggggtcgc
MK598654_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
AJ627217_X_P-RF-DE      tttacgtcccctcggcgctgaatcccgcggacgacccttctcggggtcgc
MK618439_X_P-RF-DE      tttacgtcccctcggcgctgaatcccgcggacgacccttctcggggtcgc
MW601241_X_P-RF-DE      tttacgtcccctcggcgctgaatcccgcggacgacccttctcggggtcgc
MZ097724_X_P-RF-DE      tttacgtcccctcggcgctgaatcccgcggacgacccttctcggggtcgc
MK598653_X_P-RF-DE      tttacgtcccctcggcgctgaatcccgcggacgacccttctcggggtcgc
EU594435_X_P-RF-DE      tttacgtcccctcggcgctgaatcccgcggacgacccttctcggggtcgc
MK598652_X_P-RF-DE      tttacgtcccctcggcgctgaatcccgcggacgacccttctcggggtcgc
MW601264_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
MZ097745_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
KM577666_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
MH464846_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcagacgacccctctcggggtcgc
MH464852_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcagacgacccctctcggggtcgc
AY233295_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
MN507850_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
KM577667_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
MF488699_X_P-RF-DE      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggtcgc
KM577663_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
KM577664_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
GQ183486_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
EF103285_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
KM577665_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
MH464851_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
MT210033_X_P-RF-DE      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggtcgc
MG826150_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
MT426089_X_P-RF-AB      tttacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggtcgc
KJ803788_X_P-RF-CB      tttacgtcccgtcagcgctgaatcccgcggacgacccgtcccggggtcgc
MH368022_X_P-RF-GC      tctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
MK534613_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
KY470865_X_P-RF-GC      tctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
KY470858_X_P-RF-GC      tctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
KY470871_X_P-RF-GC      tctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
KP148586_X_P-RF-GC      tctacgtcccgtcggcgctgaatcctgcggacgacccctcccggggccgc
KP148450_X_P-RF-GC      tctacgtcccgtcggcgctgaatcctgcggacgacccctcccggggccgc
KP148441_X_P-RF-GC      tctacgtcccgtcggcgctgaatcctgcggacgacccctcccggggccgc
KP148442_X_P-RF-BC      tctacgtcccgtcggcgctgaatcctgcggacgacccctcccggggccgc
KP148447_X_P-RF-GC      tctacgtcccgtcggcgctgaatcctgcggacgacccctcccggggccgc
KP148449_X_P-RF-GC      tctacgtcccgtcggcgctgaatcctgcggacgacccctcccggggccgc
FJ023659_X_P-RF-BC      tctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
FJ023662_X_P-RF-GC      tctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
KY470996_X_P-RF-GC      tttacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
KY471004_X_P-RF-GC      tttacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
KY471005_X_P-RF-GC      tttacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
KY470997_X_P-RF-GC      tttacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
MG826145_X_P-RF-BC      tttacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
MH746811_X_P-RF-BC      tttacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
MH746812_X_P-RF-BC      tttacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
MH746813_X_P-RF-BC      tttacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
KY471003_X_P-RF-GC      tttacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
KY471006_X_P-RF-GC      tttacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
KY470998_X_P-RF-GC      tttacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
KY471001_X_P-RF-GC      tttacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
KY470999_X_P-RF-GC      tttacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
KY471000_X_P-RF-GC      tttacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
KY471002_X_P-RF-GC      tttacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
KY471007_X_P-RF-GC      tttacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
FR714490_X_P-RF-GB      tttacgtcccgtcagcgctgaatcctgcggacgacccctctcggggccgc
KC172106_X_P-RF-GB      tttacgtcccgtcagcgctgaatcctgcggacgacccctctcggggccgc
FR714496_X_P-RF-CB      tttacgtcccgtcggcgctgaatcctgcagacgacccctctcggggccgc
MZ439768_X_P-RF-GC      tttacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
MZ439798_X_P-RF-GC      tttacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
FJ562247_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgatccgtctcggggccgt
GQ377592_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
EU939623_X_P-RF-CB      tctacgtcccgtcagcgatgaatcccgcggacgacccgtctcggggccgt
GQ377627_X_P-RF-CD      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
GQ377626_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
EU522070_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgt
GQ377573_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacggcccgtctcggggccgc
GQ377613_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
KJ173299_X_P-RF-CB      tctacgtcccgtcggagctgaatcccgcggacgacccgtctcggggccgt
KJ173300_X_P-RF-CB      tctacgtcccgtcggagctgaatcccgcggacgacccgtctcggggccgt
FJ562287_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
FJ562227_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AB367393_X_P-RF-CB      tctacgtcccgtcggccctgaatcccgcggacgacccgtctcggggtcgt
MT645029_X_P-RF-CB      tctacgtcccgtcggcactgaatcccgcggacgacccgtctcgcggccgt
GQ377544_X_P-RF-CB      tctacgtcccgtcggctctgaatcccgcggacgacccgtctcgcggccgt
LC279264_X_P-RF-CB      tctacgtcccgtcggccctgaatcccgcggacgacccgtctcgcggccgt
EU939589_X_P-RF-CB      tctacgtcccgtcggcactgaatcccgcggacgacccgtcccgcggccgt
FJ562336_X_P-RF-CB      tctacgtcccgtcggccctgaatcccgcggacgacccgtctcgcggccgt
EU939565_X_P-RF-CB      tctacgtcccgtcggcactgaatcccgcggacgacccgtcgcgcggccgt
LC279263_X_P-RF-CB      tctacgtcccgtcggccctgaatcccgcggacgacccgtctcgcggccgt
LC279265_X_P-RF-CB      tctacgtcccgtcggccctgaatcccgcggacgacccgtctcgcggccgt
LC279266_X_P-RF-CB      tctacgtcccgtcggccctgaatcccgcggacgacccgtctcgcggccgt
LC279267_X_P-RF-CB      tctacgtcccgtcggccctgaatcccgcggacgacccgtctcgcggccgt
GQ377516_X_P-RF-CB      tctacgtcccgtcggcactgaatcccgcggacgacccgtctcgcggccgt
KC774344_X_P-RF-CB      tctacgtcccgtcggcactgaatcccgcggacgacccgtctcggggccgt
GQ377520_X_P-RF-CB      tctacgtcccgtcggcactgaatcccgcggacgacccgtcgcgcggccgt
GQ377534_X_P-RF-CB      tctacgtcccgtcggcactgaatcccgcggacgacccgtcgcgcggccgt
AY206374_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgt
FJ562328_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
FJ562267_X_P-RF-CB      tctacgtcccgtcggcgatgaatcccgcggacgacccgtctcggggccgt
FJ032337_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
FJ386586_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgt
EU939621_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgt
GQ377560_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgt
KU963883_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AF461361_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
GQ377634_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
FJ386581_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
FJ386593_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AY817512_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774447_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AY040627_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774198_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgc
KC774201_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgc
KC774307_X_P-RF-CB      tctacgtcccgtcagcgctgaatcccgcggacgacccgtctcgcggccgt
KC774323_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgatccgtctcgcggccgt
KC774193_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgt
KC774291_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgt
KC774188_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtcccggggccgt
EU939551_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU919166_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU919167_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963940_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963938_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963936_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963930_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963931_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963932_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963934_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963935_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963939_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963941_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963942_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963943_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963944_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963933_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AB195950_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AB195951_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774317_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774322_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
GU357843_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
GQ377549_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KM875422_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcagacgacccgtctcggggccgt
KC774498_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU787435_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
DQ478898_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774454_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MG826149_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963990_X_P-RF-CB      tttacgtcccgtcggcactgaatcccgcggacgacccgtctcggggccgt
KU963991_X_P-RF-CB      tttacgtcccgtcggcactgaatcccgcggacgacccgtctcggggccgt
KU963993_X_P-RF-CB      tttacgtcccgtcggcactgaatcccgcggacgacccgtctcggggccgt
KU963994_X_P-RF-CB      tttacgtcccgtcggcactgaatcccgcggacgacccgtctcggggccgt
KU963995_X_P-RF-CB      tttacgtcccgtcggcactgaatcccgcggacgacccgtctcggggccgt
KU963998_X_P-RF-CB      tttacgtcccgtcggcactgaatcccgcggacgacccgtctcggggccgt
KU963999_X_P-RF-CB      tttacgtcccgtcggcactgaatcccgcggacgacccgtctcggggccgt
KU964001_X_P-RF-CB      tttacgtcccgtcggcactgaatcccgcggacgacccgtctcggggccgt
KU964003_X_P-RF-CB      tttacgtcccgtcggcactgaatcccgcggacgacccgtctcggggccgt
KR013816_X_P-RF-CB      tctacgtcccgtcgacgctgaatcccgcggacgacccgtctcggggccgt
GQ377633_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
GQ377607_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
FJ386578_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
FJ386585_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
FJ386649_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EF494376_X_P-RF-CA      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggtcgt
JQ040146_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
JX661498_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
LC458432_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KF917451_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774324_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
JX026887_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
GQ377548_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgt
KJ173325_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KJ173326_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
FJ386633_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774328_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774183_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774186_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MK321265_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgt
MK720627_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgt
MK720628_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgt
MG893561_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774230_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
FJ787446_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
FJ787480_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU916228_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KY470893_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU939581_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
FJ562223_X_P-RF-CD      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
FJ562229_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
GQ377539_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
GQ377602_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
JX429896_X_P-RF-CB      tctacgtcccgtcggcgttgaatcccgcggacgacccatctcggggccgt
JX661494_X_P-RF-CB      tctacgtcccgtcggcgttgaatcccgcggacgacccatctcggggccgt
KU964351_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
FJ562305_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgt
AB670303_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AB014375_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AF411409_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MW887644_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
GQ377565_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
GQ377596_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
GQ377564_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
GQ377614_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
GQ377581_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
GQ377590_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774294_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
GU385774_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
GQ377604_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KR013806_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
FJ562277_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KJ173329_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KJ173330_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU882006_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgt
MW887645_X_P-RF-CD      tctacgtcccgtcggagctgaatcccgcggacgacccgtctcggggccgt
KR013843_X_P-RF-CB      tctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgt
JN664935_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgt
EU939668_X_P-RF-CB      tctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgt
KC774414_X_P-RF-BC      tctacgtcccgtcggcgctgaatcctgcggacgacccatctcggggccgt
MT645071_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU871994_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU871987_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU871988_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU871990_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU871981_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU871999_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU871989_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccat
EU872015_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgaggccgt
EU871983_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU872014_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU871995_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU871984_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU871985_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU871991_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU871992_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU871993_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU871996_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU871986_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774466_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU717211_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU939602_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AB049609_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU871997_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AY123424_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
M38454_X_P-RF-CB        tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AB367419_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AY247030_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AF330110_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
JF828935_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
JF828933_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
JF828936_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
JF828938_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
JF828934_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MT645070_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
GQ377522_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KY363272_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KY363273_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KY629632_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU939632_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AB205152_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683640_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
FJ562294_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MK534585_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AB367800_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AB367400_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AB642096_X_P-RF-CB      tctacgtcccttcggcgctgaatcccgcggacgacccgtctcggggccgt
JQ801476_X_P-RF-CG      tttacgtcccgtcagcgctgaatccagcggacgacccctctcggggccgc
KX765835_X_P-RF-GC      tttacgtcccgtcagcgctgaatccagcggacgacccctcccggggccgt
KJ803772_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggtcgc
MK534701_X_P-RF-BC      tctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
MK534615_X_P-RF-BC      tctacgtcccgtcggctctgaatcccgcggacgacccctctcggggccgc
KX774505_X_P-RF-BC      tctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccga
MK534724_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccga
MK534700_X_P-RF-BC      tctacgtcccgtcagcgctgaatcccgcggacgacccctctcggggccgc
MK534725_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
MK534637_X_P-RF-BC      tctacgtcccgtcagcgctgaatcccgcggacgacccctctcggggccgc
MK534668_X_P-RF-BC      tctacgtcccgtcagcgctgaatcccgcggacgacccctctcggggccgc
AB031265_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcagacgacccctcccggggccgc
MF925392_X_P-RF-DB      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
MF925360_X_P-RF-DB      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
MF925381_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
MF925370_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
MF925402_X_P-RF-BD      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
MF925382_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
MF925384_X_P-RF-DB      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
JQ027310_X_P-RF-CB      tctacgtcccgtcagcgctgaatcccgcggacgacccatctcggggccgy
KJ173320_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
KJ173322_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
FJ386674_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
KC315400_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgt
HQ684848_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
HQ684849_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
MG826146_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccga
MG826147_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU939629_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
MK534719_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
GQ377635_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
KJ803778_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
MK534587_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
GQ377630_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
EU939631_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
KJ803782_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
KJ173349_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
KJ803791_X_P-RF-CB      cttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
MK534660_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
KJ173350_X_P-RF-CB      tttacgtcccgtcggcgctgaatcctgcggacgacccctcccggggccgc
KC774178_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
KC774364_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
KJ173358_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
JF436923_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
KJ803802_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
MK534594_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
MK534712_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
MK534706_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
MK534714_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
MK534715_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
MK534728_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
MK534729_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
MK534734_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
MK534716_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
KJ803803_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
MK534684_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
MK534717_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
MT645056_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
MK534577_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
AF233236_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
EU660227_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
KP148337_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
KJ173279_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
KJ173280_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
HQ700519_X_P-RF-CB      tctacgtcccgtcggcgctgaatccagcggacgatccgtctcggggccgc
HQ700521_X_P-RF-CB      tctacgtcccgtcggcgctgaatccggcggacgatccgtctcggggccgc
KJ803822_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgt
MK534665_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggtcgc
MK534675_X_P-RF-BC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggtcgc
KF873530_X_P-RF-CB      tctacgtcccgtcggcgctgaaccccgcggacgacccgtctcggggccgc
FJ361772_X_P-RF-GC      tctacgtcccgtcagcgctgaatcccgcggacgacccctctcggggccgt
MK534653_X_P-RF-BC      tctacgtcccgtcatcgctgaatcccgcggacgacccctctcggggccgc
KJ803804_X_P-RF-CB      tctacgtcccatcggcgctgaatcccgcggacgacccctctcggggccgt
KJ803827_X_P-RF-BC      tctacgtcccgtcagcgctgaatcccgcggacgacccctctcggggccgc
MK534686_X_P-RF-BC      tctacgtcccgtcagcgctgaatcccgcggacgacccctctcggggccgc
MK534558_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccctcccggggccgt
MF925401_X_P-RF-DB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KJ803785_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU939627_X_P-RF-BC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MK534681_X_P-RF-BC      tctacgtcccgtcagcgctgaatcccgcggacgacccctctcggggccgc
MT645015_X_P-RF-CB      tctacgtcccgtcgacgctgaatcccgcggacgacccgtctcggggccgt
KJ410497_X_P-RF-BC      tctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgt
MZ439673_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MK534648_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
KJ803753_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgt
JQ801477_X_P-RF-BC      tctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgt
MK534620_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MK534713_X_P-RF-CB      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534639_X_P-RF-BC      tttacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgt
MK534569_X_P-RF-BC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MK534630_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534689_X_P-RF-BC      tctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgt
MK534731_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MK534590_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MK534566_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MK534582_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MK534559_X_P-RF-BC      tttacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534617_X_P-RF-BC      tttacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534670_X_P-RF-BC      tttacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534564_X_P-RF-BC      tttacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534589_X_P-RF-BC      tttacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534730_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534726_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534625_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534579_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534555_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534561_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534562_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534567_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534580_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534583_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534609_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534610_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534618_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534635_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534646_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534651_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534654_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534655_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534695_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534718_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534556_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534563_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534568_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534607_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534632_X_P-RF-CB      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534633_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534663_X_P-RF-CB      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534721_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534560_X_P-RF-CB      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
MK534598_X_P-RF-BC      tctacgtcccgtcgtcgctgaatcccgcggacgacccgtctcggggccgt
KJ803798_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
JN104438_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
JN104442_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MF925371_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgt
MF925388_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgt
MF925396_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgt
MF925397_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgt
MF925404_X_P-RF-AC      tctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgt
MF925386_X_P-RF-AC      tctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
MK534662_X_P-RF-BC      tctacgtcccgtcggcgctgaatcccgcggacgacccctctcgaggtcgt
MK534682_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccctctcgaggtcgt
MK534574_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtcgcggggccgt
KJ410506_X_P-RF-CB      tctacgtcccgtcagcgctgaatcctgcggacgacccgtctcggggccgt
AB674504_X_P-RF-DC      tctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgt
MK534606_X_P-RF-BC      tctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgt
MK534616_X_P-RF-BC      tctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgt
MK534623_X_P-RF-BC      tctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgt
MK534664_X_P-RF-BC      tctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgt
MK534669_X_P-RF-CB      tctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgt
MK534685_X_P-RF-BC      tctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgt
MK534687_X_P-RF-BC      tctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgt
MK534688_X_P-RF-BC      tctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgt
MK534641_X_P-RF-BC      tctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgt
MK534672_X_P-RF-BC      tctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgt
MK534690_X_P-RF-BC      tctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgt
MK534736_X_P-RF-BC      tctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgt
GQ924618_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgt
MK534722_X_P-RF-BC      tttacgtcccgtcggcgctgaatccagcggacgacccatctcggggccgt
MK534679_X_P-RF-CB      tctacgtcccgtcggcgctgaatccagcggacgacccctctcggggccgt
MK534723_X_P-RF-BC      tctacgtcccgtcggcgctgaatccagcggacgacccatctcggggccgt
MK534735_X_P-RF-CB      tctacgtcccgtcggcgctgaatccagcggacgacccctctcggggccgt
X75656_X_P-RF-CB        tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KY881840_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
HQ700542_X_P-RF-CB      tctacgtcccgtcagcgctgaatcccgcggacgacccgtctcgaggtcgc
AB493842_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
FJ882617_X_P-RF-GC      tctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgt
FJ882610_X_P-RF-GC      tctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgt
FJ882614_X_P-RF-GC      tctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgt
FJ023670_X_P-RF-GC      tctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgt
FJ023666_X_P-RF-GC      tctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgt
FJ023664_X_P-RF-GC      tctacgtcccgtcagcgctgaatcctgcggacgacccctctcggggccgt
FJ023673_X_P-RF-GC      tctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgt
FJ882613_X_P-RF-GC      tctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgt
FJ023667_X_P-RF-GC      tctacgtcccgtcggcgctgaatcctgcggacgacccctcccggggccgt
FJ023665_X_P-RF-GC      tctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgt
EU833891_X_P-RF-GC      tctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgt
FJ023668_X_P-RF-GC      tctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgt
FJ882611_X_P-RF-GC      tctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgt
FJ882612_X_P-RF-GC      tctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgt
FJ882618_X_P-RF-GC      tctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgt
AB241109_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtcgcggggtcgc
MG826141_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MK534584_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgt
KT003704_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KP148352_X_P-RF-CB      tctacgtcccttcggcgctgaatcccgcggacgacccgtctcggggccgt
LC416040_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AP011104_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AP011105_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
HQ700554_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccga
HQ700520_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgatccgtcgcggggccgc
HQ700518_X_P-RF-CB      tctacgttccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
FJ386646_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgc
HQ700557_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
HQ700498_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
HQ700499_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
HQ700560_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
KU695745_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
HQ700580_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgc
HQ700462_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
HQ700485_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
FJ562302_X_P-RF-CB      tctacgtcccgtcagcgctgaatcccgcggacgatccctgtcggggcggt
KU679945_X_P-RF-CB      tctacgtcccgtcggcgctgaaccccgcggacgacccgtctcgcggccgc
KF873537_X_P-RF-CB      tctacgtcccgtcggcgctgaaccccgcggacgacccgtctcgcggccgc
KF873540_X_P-RF-CB      tctacgtcccgtcggcgctgaaccccgcggacgacccgtctcgcggccgc
KF873538_X_P-RF-CB      tctacgtcccgtcggcgctgaaccccgcggacgacccgtctcgcggccgc
KF873542_X_P-RF-CB      tctacgtcccgtcggcgctgaaccccgcggacgacccgtctcgcggccgc
KF873543_X_P-RF-CB      tctacgtcccgtcggcgctgaaccccgcggacgacccgtctcgcggccgc
GQ377595_X_P-RF-BC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU679958_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KU679941_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KF873522_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KF873523_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KF873524_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KU679955_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KU679948_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KF873519_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KF873521_X_P-RF-BC      tctacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KF873518_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KU679950_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KF873513_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KU679953_X_P-RF-BC      tctacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KF873511_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KF873515_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KF873517_X_P-RF-BC      tctacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KU679946_X_P-RF-BC      tctacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KU679944_X_P-RF-BC      tctacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KF873527_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgccgacgacccttctcggggccgc
KU679956_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KU679943_X_P-RF-BC      tctacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KU679942_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KU679954_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
EU787434_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KF214680_X_P-RF-GC      tctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
AP011108_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MG826151_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgt
MG826148_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MG826144_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN650079_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
GQ358155_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
GQ358156_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
AB493837_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccga
AB493838_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgc
AB493847_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgc
AB493840_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
HQ700531_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtcgcggggccgc
HQ700532_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtcgcggggccgc
AB105172_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
KF873535_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgc
KU679939_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgc
KU679940_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgc
KU695742_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtcgcggggccgc
HQ700523_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtcgcggggccga
HQ700530_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtcgcggggccgc
HQ700509_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgc
HQ700507_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgc
HQ700508_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgc
KU695744_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgatccgtcgcggggccgt
KU679952_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtcycgcggccgc
KF873531_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgc
KF873532_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgc
KF873533_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgc
KF873534_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgc
AP011103_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgc
KU695746_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgccgacgacccgtctcggggccgc
HQ700505_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtcgcggggccgc
KU695741_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
KU695743_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
HQ700527_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
HQ700528_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
JX504540_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
FJ562271_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgt
EU835240_X_P-RF-GC      tctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgc
MH094410_X_P-RF-BC      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU939547_X_P-RF-CB      tctacgtcccgtcggcgatgaatcccgcggacgacccgtctcggggccgt
KJ598675_X_P-RF-CB      tctacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggccgt
JF436919_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU939620_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgatccgtttcggggccgt
AP011102_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
MN683655_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KY363262_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtcgcggggccgt
KY363263_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtcgcggggccgt
KC774349_X_P-RF-CB      tttacgtcccgtcagcgttgaatcccgcggacgacccgtctcggggccgt
EU939630_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU939577_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU589337_X_P-RF-CB      tttacgtcccctcggcgctgaatcccgcggacgacccgtctcggggccgt
FJ032343_X_P-RF-CB      tttacgtcccctcggcgctgaatcccgcggacgacccgtctcggggccgt
MN650085_X_P-RF-DC      tttacgtcccgtcagcgctgaatcccgcggacgacccttctcggggccgc
HQ700526_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
MN683584_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
MN683679_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
HM750150_X_P-RF-DC      tttatgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN683716_X_P-RF-DC      tctacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
MN650083_X_P-RF-DC      tttacgtcccgtcagcgctgaatcccgcggacgacccttctcggggccgc
MN683680_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN683700_X_P-RF-DC      tttacgtcccgtcagcgctgaatcccgcggacgacccttctcggggccgc
HM750144_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
AY057948_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN683715_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN683712_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
MN683721_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN683720_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN650076_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KC774485_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN683687_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN683688_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KU964366_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KU964367_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KU964370_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KU964372_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KU964374_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KU964380_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KU964379_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
FJ562263_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KT991424_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
AY817511_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KT991427_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN683703_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN683719_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KX354997_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN683724_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN683713_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
HM750145_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
FJ349241_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN683689_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN683692_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KX660689_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN683711_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KC774482_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KX660686_X_P-RF-DC      tttacgtcccgtcagcgctgaatcccgcggacgacccttctcggggccgc
MN683707_X_P-RF-DC      tttacgtcccgtcagcgctgaatcccgcggacgacccttctcggggccgc
MN683696_X_P-RF-DC      tttacgtcccgtcagcgctgaatcccgcggacgacccttctcggggccgc
MN650084_X_P-RF-DC      tctacgtcccgtcagcgctgaatcccgcggacgacccttctcggggccgc
MN650080_X_P-RF-DC      tctacgtcccgtcagcgctgaatcccgcggacgacccttctcggggccgc
MN650081_X_P-RF-DC      tctacgtcccgtcagcgctgaatcccgcggacgacccttctcggggccgc
MN650082_X_P-RF-DC      tttacgtcccgtcagcgctgaatcccgcggacgacccttctcggggccgc
MN683697_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN650074_X_P-RF-DC      tttacgtcccgtcagcgctgaatcccgcggacgacccttctcggggccgc
HM750149_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgc
HM750146_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
DQ478890_X_P-RF-DC      tttacgtcccgtcggcgctgaatcctgcggacgacccttctcggggccgc
MN683722_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN683725_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN650069_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN650072_X_P-RF-DC      tttacgtcccgtcagcgctgaatcccgcggacgacccttctcggggccgc
MN650073_X_P-RF-DC      tttacgtcccgtcagcgctgaatcccgcggacgacccttctcggggccgc
MN650078_X_P-RF-DC      tttacgtcccgtcagcgctgaatcccgcggacgacccttctcggggccgc
MN650086_X_P-RF-DC      tttacgtcccgtcagcgctgaatcccgcggacgacccttctcggggccgc
MN650077_X_P-RF-DC      tttacgtcccgtcagcgctgaatcccgcggacgacccttctcggggccgc
MN683723_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN683717_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN683690_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN683686_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN650087_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN650075_X_P-RF-DC      tttacgtcccgtcagcgctgaatcccgcggacgacccttctcggggccgc
KP276256_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KP276253_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KX660684_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN683695_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN683699_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN683706_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN683718_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
HM750147_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
HM750142_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
KC774456_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
HM750143_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
HM750148_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN683691_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN683693_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MN683694_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccttctcggggccgc
MT645039_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
FJ562317_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgatccgtctcggggccgt
MF925389_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KY670781_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774476_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
JF436922_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774222_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtcgcggggccgt
FJ562314_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
MG893559_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
MT645035_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
JQ707714_X_P-RF-CB      tctacgtcccctcggcgctgaatcccgcggacgacccgtctcggggccgt
AY800249_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774420_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774426_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774483_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774430_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774486_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774495_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774458_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774474_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KY470853_X_P-RF-DC      tctacgtcccgtcgacgctgaatcccgcggacgacccgtctcggggccgt
AB270535_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
AB300369_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683730_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KX660682_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccrtctcggggccgt
KC774212_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggtcgt
KY470845_X_P-RF-DC      tctacgtcccttcggcgctgaatcccgcggacgacccgtctcgaggccgt
KY470848_X_P-RF-DC      tctacgtcccttcggcgctgaatcccgcggacgacccgtctcgaggccgt
KY470851_X_P-RF-DC      tctacgtcccttcggcgctgaatcccgcggacgacccgtctcgaggccgt
KY470852_X_P-RF-DC      tctacgtcccttcggcgctgaatcccgcggacgacccgtctcgaggccgt
KT991419_X_P-RF-DC      tctacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggtcgt
KT991420_X_P-RF-DC      tctacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggtcgt
FJ562278_X_P-RF-DC      tctacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggtcgt
KT991417_X_P-RF-DC      tctacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggtcgt
KT991423_X_P-RF-DC      tctacgtcccgtcggcgctgaatcctgcggacgacccgtctcggggtcgt
KM213033_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774453_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MG826142_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
AY817515_X_P-RF-DC      tctacgtcccatcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774457_X_P-RF-DC      tctacgtcccatcggcgctgaatcccgcggacgacccgtctcggggccgt
KX096713_X_P-RF-CA      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683677_X_P-RF-DC      tctacgtcccgtcggcgctgaatccagcggacgacccgtctcggggccgt
MN683620_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgt
MN683581_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774425_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
FJ386643_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU589339_X_P-RF-CB      tctacgtcccctcggcgctgaatcccgcggacgacccgtctcggggccgt
MT645063_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtcgcggggccgt
MT645045_X_P-RF-BC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtcgcggggccgt
MT645049_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtcgcggggccgt
MT645060_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtcgcggggccgt
MN683676_X_P-RF-DC      tctacgtcccgtcggcgctgaatccagcggacgacccgtctcggggccgt
GQ377594_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KY470844_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774488_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcagacgacccgtctcggggccgt
KC774493_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774479_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774484_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774494_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774499_X_P-RF-DC      tctacgtcccatcggcgctgaatcccgcggacgacccgtctcggggccgt
AY862865_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KY470843_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KY470846_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KY470847_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KY470849_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KY470850_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KY470855_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KY470854_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MT645069_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683582_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN650068_X_P-RF-DC      tctacatcccgtcggcgctgaatcccgcggacgacccatctcggggccgc
KC774472_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774470_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
GQ377611_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU881995_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AY817513_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KX660677_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683668_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683642_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683632_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683663_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683714_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774481_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtcccggggccgt
MT645067_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU939606_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AB195956_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AB195957_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AB195939_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AB195940_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AB195941_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AB195955_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683671_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683650_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683649_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683621_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683572_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgt
KT991421_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggtcgt
KC774428_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
GQ377556_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
DQ478892_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
DQ478886_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
FJ562226_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683611_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AY862866_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683603_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AY862864_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683639_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683625_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683623_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683622_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683610_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683597_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683580_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683678_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774423_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774471_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683624_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683626_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683627_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683628_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683657_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MT645062_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774449_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN657317_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MT645066_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683669_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683660_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774463_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774452_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
JF491449_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KP276254_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774424_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MT645048_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683618_X_P-RF-DC      tctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgt
JQ040174_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcrgacgacccgtctcggggccgt
JQ732168_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774422_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
JX661487_X_P-RF-CB      tttacgtcccgtcgacgctgaatcccgcggacgacccatctcggggccgt
MN683647_X_P-RF-DC      tttacgtcccgtcggcggtgaatcccgcggacgacccgtctcggggccgt
KC774431_X_P-RF-DC      tctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgt
HQ700547_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgc
MN657316_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggtcgt
MN683574_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683673_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
GQ475335_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
MN683607_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccatcacggggccgt
KC774305_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
JN400086_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KJ410520_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU519422_X_P-RF-DC      tctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgt
MN683672_X_P-RF-DC      tctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgt
KX660685_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683641_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963856_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963857_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963858_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963859_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963860_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963861_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963862_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963863_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963864_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963865_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963866_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963867_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963868_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963869_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU963870_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774492_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774487_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774432_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggtcgt
AB033557_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
FJ386635_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
DQ089798_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AY817510_X_P-RF-DC      tctacgtcccgtcggcgttgaatcccgcggacgacccgtctcggggccgt
MG893554_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
JX661485_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
JQ040142_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MG893555_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
JQ040148_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
JX661486_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683617_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683645_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774497_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgt
MN683619_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgaggccgt
KC774234_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
JQ040175_X_P-RF-CB      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
DQ478887_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KX660675_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccatcacggggccgt
MN683666_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccatcacggggccgt
MN657315_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683662_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MT645065_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
JF491455_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683635_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683659_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683630_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683634_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774258_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774490_X_P-RF-DC      cctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgt
EU916239_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU916241_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU916240_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683652_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683613_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccgtcacggggccgt
MN683614_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccgtcacggggccgt
MN683615_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccgtcacggggccgt
MN683579_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774489_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774478_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774480_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774448_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774434_X_P-RF-DC      tttacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
JX429898_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
HM750133_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
DQ478889_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774332_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774341_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774263_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AY167095_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU787444_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU964308_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
EU916232_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU964005_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU964006_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU964007_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU964008_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU964009_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU964010_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU964303_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU964304_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU964305_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU964306_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU964307_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU964309_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU964310_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU964311_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU964312_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU964313_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU964314_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU964315_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU964316_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU964317_X_P-RF-CB      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683684_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
JF491448_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgt
MN683664_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgc
MN683590_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgt
KX660674_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgt
KX660680_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgt
MN683665_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgt
MN683609_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccatctcggggccgt
MN683651_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774435_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774442_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683653_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683643_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683644_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683588_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgcggccgt
JF491451_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683605_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683675_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AB198084_X_P-RF-CB      tctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgt
MN683612_X_P-RF-DC      tctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgt
MN683616_X_P-RF-DC      tctacgtcccgtcagcgctgaatcccgcggacgacccgtctcggggccgt
MN683685_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgc
MN683656_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683654_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683636_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683637_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683638_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683596_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683586_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KU519423_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683674_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774455_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774443_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774439_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
DQ478897_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
AY817509_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683587_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
JF491456_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KC774468_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
KP276255_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683571_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683592_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683594_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683658_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683661_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683683_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
MN683670_X_P-RF-DC      tctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
                              * *            * ** ** *  *  *  *   *       

KC774246_X_P-RF-CB      ggggccgtttgcggtccccttgttcctttgccgttccggcggaccacggg
KC774461_X_P-RF-DC      atgggtcttttcggtcccgtttgtgttttgccgttcccgctgctcatggg
KC774475_X_P-RF-DC      ttgggtcttttcggtccccttcttcttttgccgttcccgccaaccatggg
KC774433_X_P-RF-DC      ttgggtttctccgttccccttcttcatcggccgttccgcccgacccgggg
EF464099_X_P-RF-AG      gggggggtctgtggcccccttctccgtttgccgttcctgccgaccacggg
AB933282_X_P-RF-AG      ttgggcctatctcgtccccttctccgtctgccgttccagccgaccacggg
AB933283_X_P-RF-AG      ttgggactctctcgtccccttctccgtctgccgttccakccgaccacggg
JQ272887_X_P-RF-GF      ttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggg
KF219922_X_P-RF-GH      ttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggg
HE981180_X_P-RF-GF      ttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacgag
EU833890_X_P-RF-GA      ttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggg
KP274926_X_P-RF-GA      ttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggg
AB933279_X_P-RF-AG      ttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggg
AB933280_X_P-RF-AG      ttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggg
AB933281_X_P-RF-AG      ttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggg
JQ272886_X_P-RF-GF      ttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggg
HE981179_X_P-RF-FG      ttggggctctgtcgcccccttctccgtctgccgttcctgccgaccacggg
JQ707474_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
EU833889_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707445_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707471_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707469_X_P-RF-GA      ttgggactctctcgtccccttttccgtctgccgttccagccgaccacggg
JQ707468_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707466_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707465_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707463_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707457_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707458_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707460_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707461_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707462_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707464_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707467_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707470_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707472_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707473_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707475_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707456_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707448_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707441_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707430_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707421_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707432_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707450_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707424_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707426_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
JQ707459_X_P-RF-GA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
Y18856_X_P-RF-CB        ttggggatctaccgtccccttctccgtc---cgttccggccgaccacggg
Y18857_X_P-RF-CB        ttgggcctctatcgtcccctgctttctc---cgttccggccgaccacggg
GQ161806_X_P-RF-EA      ttggggatctatcgtccccttctccgtctgccgtwccaaccgaccacggg
KJ586803_X_P-RF-AF      ttgggactctctcgtccccttctccgtctgccgttccggccgaccacggg
GQ331048_X_P-RF-AE      ttgggactctatcgtccccttctccgtctgccgttccagccgaccacggg
KF214656_X_P-RF-AC      ttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccacggg
AB222708_X_P-RF-AD      ttgggactctatcgtccccttctccgtctgccgttccagccgaccacggg
AY161140_X_P-RF-AD      ttggggctgtatcgtcgggttctccgtctgccgtaccggtcgaccacggg
AY161141_X_P-RF-AD      ttggggctgtatcgtcgggttctccgtctgccgtaccggtcgaccacggg
AY161147_X_P-RF-DA      ttggggctgtatcgtccccttctccgtctgccgtacagtacgaccacggg
JN688717_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccaaccgaccacggg
KJ647351_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
KJ647356_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
AF297619_X_P-RF-DA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
AF297620_X_P-RF-DA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
X65259_X_P-RF-DA        ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
EF494378_X_P-RF-CA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
X68292_X_P-RF-DA        ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
AB453985_X_P-RF-AC      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
AY236161_X_P-RF-DA      ttgggactctctcgtccccttctccgtctgccgttccagccgaccacggg
AY161145_X_P-RF-AD      ttgggactgtatcgtccccttctccgtctgccgtacccgccgaccacggg
AY161146_X_P-RF-AD      ttgggactgtatcgtccccttctccgtctgccataccgtccgaccacggg
GQ161788_X_P-RF-AE      ttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggg
GQ161767_X_P-RF-AE      ttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggg
GQ161837_X_P-RF-AE      ttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggg
HF571060_X_P-RF-AE      ttgggactctatcgtccccttctccgtctgccgtaccgaccgaccacggg
GQ161753_X_P-RF-AE      ttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggg
AY233277_X_P-RF-AC      ttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggg
KJ586810_X_P-RF-AF      ttgggactctatcgtccccttctccgtctgccgtaccgtccgaccacggg
JN688715_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccrrccgaccacggg
JN688689_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
FN594767_X_P-RF-DE      ttgggggtctatcgtccccttctccgtctgccgttccggccaaccacggg
DQ315780_X_P-RF-DE      ttgggtctctgtcgtcctctcctccgtctgccgttccgaccgaccacggg
AB033558_X_P-RF-DE      ttgggtctctgtcgtcctcttctccgtctgccgttccgaccgaccacggg
GQ205379_X_P-RF-DE      ctgggtctctgtcgtcctctcctccgtctgccgtaccgaccgaccacggg
JN664915_X_P-RF-DE      ttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacggg
JN664925_X_P-RF-DE      ttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacggg
MK541689_X_P-RF-DE      ttgggtctcggtcgtcctctcatccgtctgccgttccgaccgaccacggg
DQ315779_X_P-RF-DE      ttaggtctctgtcgtcctctcctccgtctgccgttccgaccgaccacggg
JN664929_X_P-RF-DE      ttgggtctctgtcgtcctctcctccgtctgccgttccgaccgaccacggg
JN664940_X_P-RF-DE      ctgggtctctgtcgtcctctcctccgtctgccgttccgaccgaccacggg
MK516279_X_P-RF-DE      ttgggtctctgtcgtcctctcctccgtctgccgttccgaccgaccacggg
MK516280_X_P-RF-DE      ttgggtctctgtcgtcctctcctccgtctgccgttccgaccgaccacggg
KC875338_X_P-RF-DE      ttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacggg
KC875339_X_P-RF-DE      ttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacggg
GQ205387_X_P-RF-DE      ttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacggg
GQ205386_X_P-RF-DE      ttgggtctctgtcgtcctctcctccgtctgccgttccgaccgaccacggg
GQ205377_X_P-RF-DE      ttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacggg
GQ205378_X_P-RF-DE      ttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacggg
JN664934_X_P-RF-DE      ttgggtctctgtcgtcctctcctccgtctgccgttccaaccgaccacggg
KT366505_X_P-RF-DE      ttgggtctctgtcgtcctctcctccgtctgccgttccgaccgaccacggg
MF618346_X_P-RF-DE      ttgggaccctatcgtccccttcttcatctgccgttccgaccgaccacggg
HQ700494_X_P-RF-DE      ttggggmcctgtcgtccccttctctgcctgccgttccggccgaccacggg
FJ349207_X_P-RF-DE      ttggggatctaccgtccccttctccgcctgccgttccgaccgaccacggg
MH481862_X_P-RF-DE      ttggggccctgtcgtcctcttctctgcctgccgttccggccgaccacggg
MF618347_X_P-RF-DE      ttgggaccctgtcgtcctcttcttcatctgccgttccggccgaccacggg
FJ904425_X_P-RF-DE      ttggggatctatcgtccccttctctgcctgtcgttccgaccgaccacggg
FJ904409_X_P-RF-DE      ttggggatctctcgtcctcttctctgcctgccgttccggccgaccacggg
MH481859_X_P-RF-DE      ttggggccctgtcgtcctcttctctgcctgccgttccggccgaccacggg
MH481861_X_P-RF-DE      ttggggccctgtcgtcctcttctctgcctgccgttccggccgaccacggg
MH481858_X_P-RF-DE      ttggggccctgtcgtcctcttctctgcctgccgttccggccgaccacggg
MH481860_X_P-RF-DE      ttggggccctgtcgtcctcttctctgcctgccgttccggccgaccacggg
FJ904398_X_P-RF-DE      ttggggatctatcgtcctcttctctgtctgccgttccgaccgaccacggg
FN594770_X_P-RF-DE      ttggggatctctcgtcccctcctctgcctgccgttccggccgaccacggg
FJ904428_X_P-RF-DE      ttggggatctctcgtcctcttctctgcctgctgttccggccgaccacggg
MT591274_X_P-RF-DE      ttggggatctaccgtcctcttctctgcctgccgttccggccgaccacggg
MT591275_X_P-RF-DE      ttggggatctaccgtcctcttctctgcctgccgttccggccgaccacggg
FJ904430_X_P-RF-DE      ttggggatctctcgtcctcttctctgcctgccgttccggccgaccacggg
DQ991753_X_P-RF-DE      ttggggatctatcgtcctcttctccgcctgccgttccgaccgaccacggg
AM494716_X_P-RF-DE      ttggggatctatcgtcctcttctccgcctgccgttccgaccaaccacggg
FJ904397_X_P-RF-DE      ttggggatctatcgtcctcttctcygcctgccgttccggccgaccacggg
FJ904436_X_P-RF-DE      ttggggatctatcgtcctcttctctgcctgccgttccggccgaccacggg
FJ904417_X_P-RF-DE      ttggggatctatcgtcctcttctctgcctgccgttccggccgaccacggg
FJ904416_X_P-RF-DE      ttggggatctatcgtcctcttctctgcctgccgttccggccgaccacggg
FJ904405_X_P-RF-DE      ttggggatctttcgtcctcttctctgcctgccgttccggccaaccacggg
FJ904404_X_P-RF-DE      ttggggatctctcgtcctcttctctgcctgccgttccggccgaccacggg
FJ904396_X_P-RF-DE      ttggggatctatcgtcctcttctctgcctgccgttccggccgaccacggg
FJ904401_X_P-RF-DE      ttggggatctatcgtcctcttctctgcctgccgttccggccgaccacggg
GU177079_X_P-RF-DE      ttggggatctatcgtcctcttctccgcctgccgttccgaccgaccacggg
FJ904444_X_P-RF-DE      ttggggatctatcgtccccttctctgcctgccgttccggccgaccacggg
FJ904442_X_P-RF-DE      ttggggatctatcgtcctcttctctgcctgccgttccggccgaccacggg
FJ904437_X_P-RF-DE      ttggggatctatcgtcctcttctccgcctgccgttccggccgaccacggg
FJ904408_X_P-RF-DE      ttggggatctatcgtcctcttctctgcctgccgttccggccgaccacggg
FJ904394_X_P-RF-DE      ttggggatctatcgtcctcttctctgcctgccgttccggccgaccacggg
FJ904414_X_P-RF-DE      ttggggatctatcgtcctcttctctgcctgccgttccggccgaccacggg
KP288875_X_P-RF-DE      ttggggatctatcgtcctcttctctgcctgccgttccggccgaccacggg
FJ904447_X_P-RF-DE      ttggggatctatcgtcctcttctctgcctgccgttccggccgaccacggg
FJ904407_X_P-RF-DE      ttggggatctatcgtcctcttctctgcctgccgttccggccgaccacggg
FJ904403_X_P-RF-DE      ttggggatctatcgtcctcttctctgcctgccgttccggccgaccacggg
MT591280_X_P-RF-DE      ttggggatctatcgtcctcttctctgcctgccgttccggccgaccacggg
KF192833_X_P-RF-DE      ttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccacggg
KF192836_X_P-RF-DE      ttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccacggg
KU668440_X_P-RF-DE      ttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccacggg
KF192839_X_P-RF-DE      ttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccacggg
KF192838_X_P-RF-DE      ttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccacggg
KF192835_X_P-RF-DE      ttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccacggg
KF192837_X_P-RF-DE      ttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccacggg
KF192840_X_P-RF-DE      ttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccacggg
KF192841_X_P-RF-DE      ttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccacggg
KU711666_X_P-RF-DE      ttggggatctatcgtccccttctctgcctgccgtttcgaccgaccacggg
AB188245_X_P-RF-DE      ttggggatctctcgtccccttctctgtctgccgttccgaccgaccacggg
AB048702_X_P-RF-DE      ttggggccctgtcgtcctcttctccgcctgccgttccgaccgaccacggg
AB048703_X_P-RF-DE      ttggggccctgtcgtcctcttctccgcctgccgttccgaccgaccacggg
FJ692536_X_P-RF-DE      ttggggccctgtcgtcctcttctctgcctgccgttccgaccgaccacggg
KX357641_X_P-RF-DE      ttggggatctaccgtccccttctccgcctgccgttccgaccgaccacggg
KX357636_X_P-RF-DE      ttgggactttctcgtccccttctctgcctgccgttccgcccgaccacggg
KP168416_X_P-RF-DE      ttggggctttctcgtccccttctctgcctgccgttccgaccgaccacggg
KP168420_X_P-RF-DE      ttggggatctatcgtccccttctctgcctgccgttccgaccgaccacggg
KJ470892_X_P-RF-DE      ttgggactctatcgtccccttctctgcctgccgttccggccgaccacggg
KJ470891_X_P-RF-DE      ttgggaccctgtcgtccccttctctgcctgccgttccgaccgaccacggg
HQ700579_X_P-RF-DE      ttggggccctgtcgtccccttctctgcctgccgttccggccgaccacggg
HQ700585_X_P-RF-DE      ttggggccctgtcgtccccttctctgcctgccgttccggccgaccacggg
HQ700500_X_P-RF-DE      ttggggccctgtcgtccccttctctgcctgccgttccggccgaccacggg
HQ700533_X_P-RF-DE      ttggggccctgtcgtccccttctctgcctgccgttccggccgaccacggg
HQ700536_X_P-RF-DE      ttggggccctgtcgtccccttctctgcctgccgttccggccgaccacggg
HQ700541_X_P-RF-DE      ttggggccctgtcgtccccttctctgcctgccgttccggccgaccacggg
HQ700535_X_P-RF-DE      ttggggccctgtcgtccccttctctgcctgccgttccggccgaccacggg
HQ700525_X_P-RF-DE      ttggggccctgtcgtccccttctctgcctgccgttccggccgwccacggg
HQ700503_X_P-RF-DE      ttggggccctgtcgtccccttctctgcctgccgttccggccgaccacggg
HQ700497_X_P-RF-DE      ttggggccctgtcgtccccttctctgcctgccgttccggccgaccacggg
HQ700538_X_P-RF-DE      ttggggccctgtcgtccccttctctgcctgccgttccggccgaccacggg
HQ700493_X_P-RF-DE      ttggggccctgtcgtccccttctctgcctgccgttccggccaaccacggg
HQ700492_X_P-RF-DE      ttggggccctgtcgtccccttctctgcctgccgttccggccgaccacggg
AB033559_X_P-RF-DE      ttggggccctgtcgtccccttctctgcctgccgttccggccgaccacggg
HQ700501_X_P-RF-DE      ttggggccctgtcgtccccttctctgcctgccgttccggccgaccacggg
HQ700524_X_P-RF-DE      ttggggccctgtcgtccccttctctgcctgccgttccggccgaccacggg
HQ700534_X_P-RF-DE      ttggggccctgtcgtccccttctctgcctgccgttccggccgaccacggg
HQ700537_X_P-RF-DE      ttggggccctgtcgtccccttctctgcctgccgttccggccgaccacggg
HQ700540_X_P-RF-DE      ttggggccctgtcgtccccttctctgcctgccgttccggccgaccacggg
HQ700581_X_P-RF-DE      ttggggccctgtcgtccccttctctgcctgccgttccggccgaccacggg
HQ700582_X_P-RF-DE      ttggggccctgtcgtccccttctctgcctgccgttccggccgaccacggg
HQ700583_X_P-RF-DE      ttggggccctgtcgtccccttctctgcctgccgttccggccgaccacggg
HQ700584_X_P-RF-DE      ttggggccctgtcgtccccttctctgcctgccgttccggccgaccacggg
KJ470887_X_P-RF-DE      ttgggaccctgtcgtccccttctctgcctgccgttccggccgaccacggg
KJ470886_X_P-RF-DE      ttgggaccctgtcgtccccttctctgcctgccgttccggccgaccacggg
KJ470888_X_P-RF-DE      ttgggactctatcgtccccttctctgcctgccgttccggccgaccacggg
KJ470890_X_P-RF-DE      ttgggactctatcgtccccttctctgcctgccgttccggccgaccacggg
KJ470884_X_P-RF-DE      ttgggtccctgtcgtccccttctctgcctgccgttccggccgaccacggg
KJ470897_X_P-RF-DE      ttgggaccctgtcgtccccttctctgcctgccgttccggccgaccacggg
KJ470898_X_P-RF-DE      ttgggaccctgtcgtccccttctctgcctgccgttccggccgaccacggg
KU736917_X_P-RF-DE      ttggggatctaccgtccccttctctgcctgccgttccgaccgaccacggg
KU736914_X_P-RF-DE      ttggggatctaccgtcctcttctctgcctgccgttccgaccgaccacggg
KU736915_X_P-RF-DE      ttggggatctaccgtcctcttctctgcctgccgttccgaccgaccacggg
KX827299_X_P-RF-DE      ttggggatctatcgtccccttctctgcctgccgttccgaccgaccacggg
FJ904440_X_P-RF-DE      ttggggatctatcgtccccttctctgcctgccgttccgaccgaccacggg
GQ161754_X_P-RF-DE      ttggggatctatcgtccccttctctgcctgccgttccgaccgaccacggg
FN594769_X_P-RF-DE      ttggggatctaccgtccccttctctgcctgccgttccgaccgaccacggg
FN594771_X_P-RF-DE      ttggggatctatcgtccccttctctgtctgccgttccgaccgaccacggg
KM606750_X_P-RF-DE      ttggggatctctcgtccccttctctgcctgccgttccgaccgaccacggg
KP995112_X_P-RF-DE      ttggggatctatcgtccccttctctgcctgccgttccgaccgaccacggg
FJ904406_X_P-RF-DE      ttggggatatatcgtccccttctctgcctgccgttccgaccgaccacggg
FJ904400_X_P-RF-DE      ttggggatctatcgtccccttctctgcctgccgttccgaccgaccacggg
KM606751_X_P-RF-DE      ttggggatctatcgtccccttctctgcctgccgttccgaccgaccacggg
FJ904441_X_P-RF-DE      ttggggatctatcgtccccttctctgcctgccgttccgaccgaccacggg
KM606741_X_P-RF-DE      ttggggatctatcgtccccttctctgcctgccgttccgaccgaccacggg
KP168421_X_P-RF-DE      ttggggatctatcgtccccttctctgcctgccgttccgaccgaccacggg
KF170740_X_P-RF-DE      ctggggatctatcgtccccttctctgcctgccgttccgaccgaccacggg
KU736916_X_P-RF-DE      ttggggatctatcgtccccttctctgcctgccgttccagccgaccacggg
MT426114_X_P-RF-DE      ttggggatctatcgtccccttctctgcctgccgtttcgaccgaccacggg
X80925_X_P-RF-DE        ttggggatctttcgtccccttctccgtctgccgtttcgtccgaccacggg
JN642160_X_P-RF-DE      ttggggatctcacgtccccttctccgtctgccgtttcgaccgaccacggg
AB194949_X_P-RF-AE      ttgggactctatcgtccccttctccgtctgccgttccgaccgaccacggg
AB674412_X_P-RF-DE      ttgggactctctcgtccccttctctgtctgccgtttcgaccgaccacggg
JN257204_X_P-RF-DE      ttgggactctcacgtccccttctccgtctgccgtttcgaccgaccacggg
JN257154_X_P-RF-DE      ttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacggg
HM146131_X_P-RF-AD      ttgggactctctcgtccccttctccgcctgccgtttcgtccgaccacggg
JF754616_X_P-RF-DE      ttgggcctctatcgtccccttctccgtctgccgtttcgaccgaccacggg
MZ097822_X_P-RF-DE      ttgggactctttcgtccccttctccgtctgccgtttcgaccgaccacggg
MZ097838_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
JN040803_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
KF471643_X_P-RF-DE      ttgggactgtctcgtccccttctccgtctgccgtttcgaccgaccacggg
JN257206_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
JN257207_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
JN257174_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
JN257191_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
MZ097687_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
JN664946_X_P-RF-DA      ttggggctctctcgtccccttctccgtctgccgtttcgtccgaccacggg
MZ097680_X_P-RF-DE      ttggggctctctcgtccccttctccgtctgccgtttcgtccgaccacggg
MZ097703_X_P-RF-DE      ttggggctctctcgtccccttctccgtctgccgtttcgtccgaccacggg
JQ687532_X_P-RF-DE      ttggggatctttcgtccccttctccgtctgccgtttcgtccgaccacggg
EF103282_X_P-RF-AD      ttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggg
KJ803771_X_P-RF-DB      ttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggg
AY341335_X_P-RF-DE      ttggggatctgtcgtccccttctccgtctgccgtttcgtccgaccacggg
MZ097814_X_P-RF-DE      ttggggatctttcgtccccttctccgtctgccgtttcgtccgaccacggg
EF103283_X_P-RF-AD      ttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggg
MZ097850_X_P-RF-DE      ttggggatctttcgtccccttctccgtctgccgtttcgtccgaccacggg
KM524357_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggg
KR905422_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggg
KT366503_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacggg
JF754613_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
AB188243_X_P-RF-DE      ttgggactctatcgtccccttctccgtctgccgttccgaccgaccacggg
AB674433_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
AB674432_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
AB674436_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
JN642141_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
JN642152_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
JN642137_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
EU594406_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
JN257189_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
AB330368_X_P-RF-DA      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
JN257216_X_P-RF-DE      ttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacggg
JN257210_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
MZ097826_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
MZ097652_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
JN257164_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
MW601230_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
MZ097719_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
JN642127_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
JN642139_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
MK052957_X_P-RF-DE      ttgggactctatcgtccccttatccgtctgccgttccgcccgaccacggg
MK052969_X_P-RF-DE      ttgggactctatcgtccccttctccgtctgccgttccgcccgaccacggg
MK052967_X_P-RF-BD      ttgggactctctcgtccccttatccgtctgccgttccgcccgaccacggg
MK052968_X_P-RF-BD      ttgggactctctcgtccccttatccgtctgccgttccgcccgaccacggg
MK052970_X_P-RF-BD      ttgggactctctcgtccccttctccgtctgccgttccgcccgaccacggg
MK052976_X_P-RF-BD      ttgggtctctctcgtccccttctccgtctgccgttccgcccgaccacggg
DQ464164_X_P-RF-DE      ttggggctctatcgcccccttctccgtctgccgttccgaccgaccacggg
DQ464165_X_P-RF-DE      ttggggctctatcgcccccttctccgtctgccgttccgaccgaccacggg
DQ464166_X_P-RF-DE      ttggggctctatcgcccccttctccgtctgccgttccgaccgaccacggg
DQ464167_X_P-RF-DE      ttggggctctatcgcccccttctccgtctgccgttccgaccgaccacggg
EU185780_X_P-RF-AD      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
KC012653_X_P-RF-AD      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
MW601296_X_P-RF-DE      ttggggctctctcggccccttctccgtctgccgttccgaccgaccacggg
MZ097767_X_P-RF-DE      ttggggctctctcggccccttctccgtctgccgttccgaccgaccacggg
FJ349212_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
MG877711_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcaaccgaccacggg
JF440003_X_P-RF-DE      ttgggactctttcgtccccttctccgtctgccgttccgaccgaccacggg
JF440006_X_P-RF-DE      ttgggactctttcgtccccttctccgtctgccgttccgaccgaccacggg
JF440015_X_P-RF-DE      ttgggactctttcgtccccttctccgtctgccgttccgaccgaccacggg
JF440013_X_P-RF-DE      ttgggactctttcgtccccttcttcgtctgccgttccgaccgaccacggg
JF440012_X_P-RF-DE      ttgggactctttcgtccccttctccgtctgccgttccgaccgaccacggg
JF440008_X_P-RF-DE      ttgggactctttcgtccccttctccgtctgccgttccgaccgaccacggg
JF440007_X_P-RF-DE      ttgggactctttcgtccccttctccatctgccgttccgaccgaccacggg
JF440004_X_P-RF-DE      ttgggactctttcgtccccttctccgtctgccgttccgaccgaccacggg
JF440005_X_P-RF-DE      ttgggactctttcgtccccttctccgtctgccgttccgaccgaccacggg
JF439999_X_P-RF-DE      ttgggactctttcgtccccttctccgtctgccgttccgaccgaccacggg
JF439994_X_P-RF-DE      ttgggactctttcgtccccttctccgtctgccgttccgaccgaccacggg
JF439996_X_P-RF-DE      ttgggactctttcgtccccttctccgtctgccgttccgaccgaccacggg
JF439998_X_P-RF-DE      ttgggactctttcgtccccttctccgtctgccgttccgaccgaccacggg
JF440000_X_P-RF-DE      ttgggactctttcgtccccttctccgtctgccgttccgaccgaccacggg
JF440001_X_P-RF-DE      ttgggactctttcgtccccttctccgtctgccgttccgaccgaccacggg
JF440009_X_P-RF-DE      ttgggactctttcgtccccttctccgtctgccgttccgaccgaccacggg
JF440010_X_P-RF-DE      ttgggactctttcgtccccttctccgtctgccgttccgaccgaccacggg
JF440014_X_P-RF-DE      ttgggactctttcgtccccttctccgtctgccgttccgaccgaccacggg
JF439995_X_P-RF-DE      ttgggactctttcgtccccttctccgtctgccgttccgaccgaccacggg
JF440011_X_P-RF-DE      ttgggactctttcgtccccttctccgtctgccgttccgaccgaccacggg
JF440002_X_P-RF-DE      ttgggactctttcgtccccttctccgtctgccgttccgaccgaccacggg
JF440017_X_P-RF-DA      ttgggactctttcgtccccttctccgtctgccgttccgaccgaccacggg
MH724240_X_P-RF-DE      ttgggactctatcgtccccttctccgtctgtcgttccgaccgaccacggg
AJ344117_X_P-RF-DE      ttgggactctctcgtcctcttctccgtctgccgttccgaccgaccacggg
MF488702_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
JN664933_X_P-RF-DA      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
MF488705_X_P-RF-AD      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
FJ349221_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
JX898698_X_P-RF-DE      ttgggactccttcgtccccttctccgtctgccgttccgaccgaccacggg
JX898699_X_P-RF-DE      ttgggactccttcgtccccttctccgtctgccgttccgaccgaccacggg
MT426112_X_P-RF-DE      ttgggaccctcgcgtccccttctccgtctgccgttccgaccgaccacggg
MK618440_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
MK618444_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
AJ627221_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccaaccgaccacggg
JX898687_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
JX898688_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
MT426113_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
MT426111_X_P-RF-DE      ttgggactctatcgtccccttctccgtctgccgttccgaccgaccacggg
MT426110_X_P-RF-DE      ttgggactctttcgtccccttctccgtctgccgttccgaccgaccacggg
JX898696_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgcccacggg
JX898693_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgcccacggg
JX898695_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgcccacggg
MK618442_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgcccacggg
MK618445_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgcccacggg
JX898686_X_P-RF-DE      ttgggactctatcgtccccttctccgtctgccgttccgaccgaccacggg
AB210819_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
MF967563_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
MK618438_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
MN507835_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
U95551_X_P-RF-DE        ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
JX898690_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
MZ097667_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
KX357627_X_P-RF-DE      ttgggactctatcgtccccttctctgcctgccgttccgcccaaccacggg
KX357631_X_P-RF-DE      ttgggactctatcgtccccttctctgcctgccgttccgcccgacgacggg
KP168417_X_P-RF-DE      ttgggactctatcgtccccttctctgcctgccgttccgcccgaccacggg
KP168418_X_P-RF-DE      ttgggactctatcgtccccttctctgcctgccgttccgcccgaccacggg
KX357629_X_P-RF-DE      ttgggactctatcgtccccttctctgcctgccgttccgcccgaccacggg
KU736923_X_P-RF-DE      ttgggactctatcgtccccttctctgcctgccgttccgcccgaccacggg
KX357628_X_P-RF-DE      ttgggactctatcgtccccttctctgcctgccgttccgcccgaccacggg
KX357625_X_P-RF-DE      ttgggactctatcgtccccttctctgcctgccgttccgcccaaccacggg
KX357624_X_P-RF-DE      ttgggactctatcgtccccttctctgcctgccgttccgcccgaccacggg
KX357632_X_P-RF-DE      ttgggactctatcgtccccttctctgcctgccgttccgcccgaccacggg
KX357630_X_P-RF-DE      ttgggactctatcgtccccttctctgcctgccgttccgcccgaccacggg
KX357623_X_P-RF-DE      ttgggactctatcgtccccttctctgcctgccgttccgcccgaccacggg
KX357633_X_P-RF-DE      ttgggactctatcgtccccttctctgcctgccgttccgcccgaccacggg
KX357635_X_P-RF-DE      ttgggactctatcgtccccttctctgcctgccgttccgcccgaccacggg
KX357626_X_P-RF-DE      ttgggactctatcgtccccttctctgcctgccgttccgcccgactacggg
KX357634_X_P-RF-DE      ttgggactctatcgtccccttctctgcctgccgttccgcccgaccacggg
JN664943_X_P-RF-DE      ttgggactctctcgtccccttatccgtctgccgttccgaccgaccacggg
MW601317_X_P-RF-DE      ttgggactctaccgtccccttctccgtctgccgttccgaccgaccacggg
KU736921_X_P-RF-DE      ttgggactctaccgtccccttctctgcttgccgttccgcccaaccacggg
KU736922_X_P-RF-DE      ttgggactctaccgtccccttctctgcttgccgttccgcccaaccacggg
KC774450_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
KF679991_X_P-RF-DE      ttgggactctcacgtccccttctccgtctgccgttccgaccgaccacggg
KJ586811_X_P-RF-DF      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
KJ647349_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccraccgaccacggg
MZ097766_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttycgaccgaccacggg
MH724222_X_P-RF-DE      ttgggactttctcgtccccttctccgtctgccgttccgaccgaccacggg
GU563560_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
AY233293_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgtccgaccacggg
MW601284_X_P-RF-DE      ttgggactctatcgtcctcttctccgtctgccgttccgaccgaccacggg
MZ097758_X_P-RF-DE      ttgggactctatcgtcctcttctccgtctgccgttccgaccgaccacggg
MH685719_X_P-RF-DE      ttgggactttatcgtccccttctctgcctgccgttccgaccgaccacggg
KX827302_X_P-RF-DE      ttgggactctatcgtccccttctccgtctgccgttccgaccgaccacggg
MW601235_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgcccgaccacggg
MZ097721_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgcccgaccacggg
MH464835_X_P-RF-DE      ttgggactctatcgtccccttctccgtctgccgttccgaccgaccacggg
MH724239_X_P-RF-DE      ttgggactctatcgtccccttctccgtctgccgttccgaccgaccacggg
KM359442_X_P-RF-DE      ttgggactctaccgtccccttctccgtctgccgttccgaccgaccacggg
KM386676_X_P-RF-DE      ttgggactctaccgtccccttctccgtctgccgttccgaccgaccacggg
MW601310_X_P-RF-DE      ttgggactctatcgtcccctactccgtctgccgttccgaccgaccacggg
MZ097777_X_P-RF-DE      ttgggactctatcgtcccctactccgtctgccgttccgaccgaccacggg
MW601260_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
MZ097740_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
MK598656_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
JN040798_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
AB270538_X_P-RF-DE      ttgggactctcgcgtccccttctccgtctgccgttccgcccgaccacggg
MF593359_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
DQ315777_X_P-RF-DE      ttgggactctcacgtccccttctccgtctgccgtttcgaccgaccacggg
KM524336_X_P-RF-DE      ttgggactctcacgtccccttctccgtctgccgtttcgaccgaccacggg
KM524337_X_P-RF-DE      ttgggactctcacgtccccttctccgtctgccgtttcgaccgaccacggg
MH724243_X_P-RF-DE      ttgggactctatcgtccccttctccgtctgccgttccgaccgaccacggg
KT366504_X_P-RF-DE      ttgggactctttcgtccccttctccgtctgccgttccgaccgaccacggg
EF103284_X_P-RF-AD      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
DQ111987_X_P-RF-DE      ttgggactctatcgtccccttctccgtctgccgttccgaccgaccacggg
AB583679_X_P-RF-DE      ttgggactgtcacgtccccttctccgtctgccgtttcgaccgaccacggg
MZ097806_X_P-RF-DE      ttgggactctatcgtccccttctccgtctgccgttccgaccgaccacggg
EU594436_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
MW601227_X_P-RF-DE      ttgggactctatcgtccccttctccgtctgccgttccgaccgaccacggg
MZ097716_X_P-RF-DE      ttgggactctatcgtccccttctccgtctgccgttccgaccgaccacggg
KT366492_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
AY373430_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
KM524359_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggg
MK598654_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
AJ627217_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
MK618439_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
MW601241_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
MZ097724_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
MK598653_X_P-RF-DE      ttgggactttctcgtccccttctccgtctgccgttccgaccgaccacggg
EU594435_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
MK598652_X_P-RF-DE      ttgggactttctcgtccccttctccgtctgccgttccgaccgaccacggg
MW601264_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
MZ097745_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
KM577666_X_P-RF-DE      ttggggatctctcgtccccttctccgtctgccgttccgaccgaccacggg
MH464846_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
MH464852_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
AY233295_X_P-RF-DE      ttgggtctctctcgtccccttctccgtctgccgtaccgaccgaccacggg
MN507850_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
KM577667_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
MF488699_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
KM577663_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
KM577664_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
GQ183486_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
EF103285_X_P-RF-DE      ttgggactctcacgtccccttctccgtctgccgttccgaccgaccacggg
KM577665_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
MH464851_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
MT210033_X_P-RF-DE      ttgggactctctcgtccccttctccgtctgccgttccgaccgaccacggg
MG826150_X_P-RF-BC      ttgggactctaccgtccccttcttcgcctgccgttccggccgaccacggg
MT426089_X_P-RF-AB      ttgggactctatcgtccccttctccgtctgccgtaccgtccgcccacggg
KJ803788_X_P-RF-CB      ttggggctctaccggccgcttcttcgtctgccgtatcgaccgaccacggg
MH368022_X_P-RF-GC      ttggggatctaccgtcctcttcttcatctgccgttccgaccgtccacggg
MK534613_X_P-RF-CB      ttggggatctaccgtcctcttcttcatctgccgtaccgaccgtccacggg
KY470865_X_P-RF-GC      ttgggggtctaccgtcctcttcttcatctgccgtaccgaccgtccacggg
KY470858_X_P-RF-GC      ttggggatctaccgtcctcttcttcatctgccgtaccgaccgtccacggg
KY470871_X_P-RF-GC      ttggggatctaccgtcctcttcttcatctgccgtaccgaccgtccacggg
KP148586_X_P-RF-GC      ttgaggatctaccgtcctcttcttcatctgccgtaccgtccgtccacggg
KP148450_X_P-RF-GC      ttggggatctaccgtcctcttcttcatctgccgtaccgtccgtccacggg
KP148441_X_P-RF-GC      ttggggatctaccgtcctcttcttcatctgccgtaccgtccgtccacggg
KP148442_X_P-RF-BC      ttggggatctaccgtcctcttcttcatctgccgtaccgtccgtccacggg
KP148447_X_P-RF-GC      ttggggatctaccgtcctcttcttcatctgccgtaccgtccgtccacggg
KP148449_X_P-RF-GC      ttggggatctaccgtcctcttcttcatctgccgtaccgtccgtccacggg
FJ023659_X_P-RF-BC      ttggggatctaccgtcctcttcttcatctgccgtaccggccgtccacggg
FJ023662_X_P-RF-GC      ttggggatctaccgtcctcttcttcatctgccgtaccaaccgtccacggg
KY470996_X_P-RF-GC      ttggggatctaccgtcctcttcttcatctgccgtaccgaccgtccacggg
KY471004_X_P-RF-GC      ttggggatctaccgtcctcttcttcatctgccgtaccgaccgtccacggg
KY471005_X_P-RF-GC      ttggggatctaccgtcctcttcttcatctgccgtaccgaccgtccacggg
KY470997_X_P-RF-GC      ttggggatctaccgtcctcttcttcatctgccgtaccgaccgtccacggg
MG826145_X_P-RF-BC      ttggggatctaccgtcctcttcttcatctgccgtaccgaccgtccacggg
MH746811_X_P-RF-BC      ttggggatctaccgtcctcttcttcatctgccgtaccgaccgtccacggg
MH746812_X_P-RF-BC      ttggggatctaccgtcctcttcttcatctgccgtaccgaccgtccacggg
MH746813_X_P-RF-BC      ttggggatctaccgtcctcttcttcatctgccgtaccgaccgtccacggg
KY471003_X_P-RF-GC      ttggggatctaccgtcctcttcttcatctgccgtaccgaccgtccacggg
KY471006_X_P-RF-GC      ttggggatctaccgtcctcttcttcatctgccgtaccgaccgtccacggg
KY470998_X_P-RF-GC      ctggggatctaccgtcctcttcttcatctgccgtaccgaccgtccacggg
KY471001_X_P-RF-GC      ctggggatctaccgtcctcttcttcatctgccgtaccgaccgtccacggg
KY470999_X_P-RF-GC      ttggggatctaccgtcctcttcttcatctgccgtaccgaccgtccacggg
KY471000_X_P-RF-GC      ttggggatctaccgtcctcttcttcatctgccgtaccgaccgtccacggg
KY471002_X_P-RF-GC      ttggggatctaccgtcctcttcttcatctgccgtaccgaccgtccacggg
KY471007_X_P-RF-GC      ttggggatctaccgtcctcttcttcatctgccgtaccgaccgtccacggg
FR714490_X_P-RF-GB      ttggggatctaccgtcctcttcttcatctgccgtaccgcccgtccacggg
KC172106_X_P-RF-GB      ttggggatctaccgtcctcttcttcatctgccgtaccgcccgtccacggg
FR714496_X_P-RF-CB      ttggggatctatcgtcctcttctgcgtctgccgtaccgcccgtccacggg
MZ439768_X_P-RF-GC      ttggggatctatcgtcctcttctgcgtctgccgtaccgcccgtccacggg
MZ439798_X_P-RF-GC      ttggggatctatcgtcctcttctgcgtctgccgtaccgcccgtccacggg
FJ562247_X_P-RF-CB      ctgggactctaccgtccccttcttcatctgccgttccggccgaccacggg
GQ377592_X_P-RF-CB      ttgggactctaccgcccgcttctccttctgttgttccgaccgaccacggg
EU939623_X_P-RF-CB      ttgggtctctaccgtccccttgttagtccgccgttccggccgaccacggg
GQ377627_X_P-RF-CD      ttgggactctatcgtccccttcttcttctgccgttccggccgaccacggg
GQ377626_X_P-RF-CB      ttgggactctatcgtccccttcttcgtctgccgttccgaccgaccacggg
EU522070_X_P-RF-CB      ttgggcctctatcgtccccttctgtctctgccgttccggccaaccacggg
GQ377573_X_P-RF-CB      ttggggctctaccgtccccttcttcatctgccgttccggccgaccacggg
GQ377613_X_P-RF-CB      ttgggactctaccgtccccttcttcatctgccgttccggccgaccacggg
KJ173299_X_P-RF-CB      ttgggcctctaccgtccccttcttcatctgccgttccggccgactacggg
KJ173300_X_P-RF-CB      ttgggcctctaccgtccccttcttcatctgccgttccggccgactacggg
FJ562287_X_P-RF-CB      ttgggactctaccgtccccttcttcatctgccgttccggccgactacggg
FJ562227_X_P-RF-CB      ttggggctctaccgtccccttcttcatctgccgttccggccgaccacggg
AB367393_X_P-RF-CB      ttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggg
MT645029_X_P-RF-CB      ttgggactctaccgtccccttctgcatctgccgttccggccgaccacggg
GQ377544_X_P-RF-CB      ttgggactctaccgtccccttctgcttctgccgttccggccgcccacggg
LC279264_X_P-RF-CB      ttgggactctaccgtccccttctgcatctgccgttccggccgaccacggg
EU939589_X_P-RF-CB      ttgggactctaccgtccccttctgactctgccgttccggccgcccacggg
FJ562336_X_P-RF-CB      ttgggactctaccgtccccttctgcatctgccgttccggccgaccacggg
EU939565_X_P-RF-CB      ttgggactctaccgtccccttctgcgtctgccgttccggccgaccacggg
LC279263_X_P-RF-CB      ttgggactctaccgtccccttctgcatctgccgttccggccgaccacggg
LC279265_X_P-RF-CB      ttgggactctaccgtccccttctgcatctgccgttccggccgaccacggg
LC279266_X_P-RF-CB      ttgggactctaccgtccccttctgcatctgccgttccggccgaccacggg
LC279267_X_P-RF-CB      ttgggactctaccgtccccttctgcatctgccgttccggccgaccacggg
GQ377516_X_P-RF-CB      ttgggactctaccgtccccttctgcatctgccgttccggccgaccacggg
KC774344_X_P-RF-CB      ttgggactctaccgtccccttctgcatctgccgttccggccgaccacggg
GQ377520_X_P-RF-CB      ttgggactctaccgtccccttctgcatctgccgttccggccgaccacggg
GQ377534_X_P-RF-CB      ttgggactctaccgtccccttctgcatctgccgttccggccgaccacggg
AY206374_X_P-RF-CB      ttggggatctaccgtccccttctccgtctgccgttccggccgaccacggg
FJ562328_X_P-RF-CB      ttgggcctctaccgtccccttcttcgtctgccgttccggccgaccacggg
FJ562267_X_P-RF-CB      ttgggactctaccgtccccttcttcatctgccgttccggccgaccacggg
FJ032337_X_P-RF-CB      ttggggatctaccgtccccttcttcgtctgccgttccggccgaccacggg
FJ386586_X_P-RF-CB      ttgggcctctatcgtccccttcttcttctgccgttccggccgaccacggg
EU939621_X_P-RF-CB      ttgggactctaccgtccccttcttcatctgccgttccggccgaccacggg
GQ377560_X_P-RF-CB      ttgggactctaccgtccccttctccgtctgccgttccggccgaccacggg
KU963883_X_P-RF-CB      ttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggg
AF461361_X_P-RF-CB      ttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggg
GQ377634_X_P-RF-CB      ttgggtctttaccgtccccttcttcgtctgccgttccggccgaccacggg
FJ386581_X_P-RF-CB      ttgggtctctaccgtccccttcttcatctgccgttccacccgaccacggg
FJ386593_X_P-RF-CB      ttggggctctaccgtccccttcttcatctgccgttccggccgaccacggg
AY817512_X_P-RF-DC      ttgggtctctaccgtccccttcttgctctgccgttccggcccaccacggg
KC774447_X_P-RF-DC      ttgggtctctaccgtccccttcttcatctgccgttccggcccacctcggg
AY040627_X_P-RF-CB      ttgggcctctaccgtccccttctttctctgccgttccgaccgcccacggg
KC774198_X_P-RF-CB      ttgggactctaccgtccccttctccgtctgccgttccgaccgaccacggg
KC774201_X_P-RF-CB      ttgggactctaccgtccccttctccgtctgccgttccgaccgaccacggg
KC774307_X_P-RF-CB      ttgggtctctaccgtccccttctccgtctgccgttccggccgaccacggg
KC774323_X_P-RF-CB      ttgggactctaccgtccccttctccgtctgccgttccggccgaccacggg
KC774193_X_P-RF-CB      ttgggactctaccgtccccttctccgtctgccgttccggccgaccacggg
KC774291_X_P-RF-CB      ttgggactctaccgtccccttctccgtctgccgttccggccgaccacggg
KC774188_X_P-RF-CB      ttgggtctctaccgtccccttcttcgtctgccgttccggccgcccacggg
EU939551_X_P-RF-CB      ttgggactctatcgtccccttcttcttctgccgttccggccaaccacggg
EU919166_X_P-RF-CB      ttgggcctctaccgtcctcttcttcgtctgccgttccggccgaccacggg
EU919167_X_P-RF-CB      ttgggcctctaccgtcctcttcttcgtctgccgttccggccgaccacggg
KU963940_X_P-RF-CB      ttgggtctctaccgtccacttcttcatctgccgttccggccgaccacggg
KU963938_X_P-RF-CB      ttgggtctctaccgtccacttcttcatctgccgttccggccgaccacggg
KU963936_X_P-RF-CB      ttgggtctctaccgtccacttcttcatctgccgttccggccgaccacggg
KU963930_X_P-RF-CB      ttgggtctctaccgtccacttcttcatctgccgttccggccgaccacggg
KU963931_X_P-RF-CB      ttgggtctctaccgtccacttcttcatctgccgttccggccgaccacggg
KU963932_X_P-RF-CB      ttgggtctctaccgtccacttcttcatctgccgttccggccgaccacggg
KU963934_X_P-RF-CB      ttgggtctctaccgtccacttcttcatctgccgttccggccgaccacggg
KU963935_X_P-RF-CB      ttgggtctctaccgtccacttcttcatctgccgttccggccgaccacggg
KU963939_X_P-RF-CB      ttgggtctctaccgtccacttcttcatctgccgttccggccgaccacggg
KU963941_X_P-RF-CB      ttgggtctctaccgtccacttcttcatctgccgttccggccgaccacggg
KU963942_X_P-RF-CB      ttgggtctctaccgtccacttcttcatctgccgttccggccgaccacggg
KU963943_X_P-RF-CB      ttgggtctctaccgtccacttcttcatctgccgttccggccgaccacggg
KU963944_X_P-RF-CB      ttgggtctctaccgtccacttcttcatctgccgttccggccgaccacggg
KU963933_X_P-RF-CB      ttgggtctctaccgtccacttcttcatctgccgttccggccgaccacggg
AB195950_X_P-RF-CB      ttgggactctaccgtccccttcttcatctgccgttccggcctaccacggg
AB195951_X_P-RF-CB      ttgggactctaccgtccccttcttcatctgccgttccggcctaccacggg
KC774317_X_P-RF-CB      ttgggactctaccgtccccttcttcgtctgccgttccggccaaccacggg
KC774322_X_P-RF-CB      ttgggactctaccgtccccttcttcgtctgccgttccggccaaccacggg
GU357843_X_P-RF-CB      ttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggg
GQ377549_X_P-RF-CB      ttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggg
KM875422_X_P-RF-CB      ttgggactctaccgtccccttctttctctgccgttccggccgaccacggg
KC774498_X_P-RF-DC      ttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggg
EU787435_X_P-RF-DC      ttgggtctctaccgtccccttctgcatctgccgttccggccgaccacggg
DQ478898_X_P-RF-DC      ttgggtctctaccgtccccttctgcatctgccgttccggccgaccacggg
KC774454_X_P-RF-DC      ttgggtctctaccgtccccttctgcatctgccgttccggccgaccacggg
MG826149_X_P-RF-CB      ttgggactctaccgtccccttcttcatctgccgttccggccgaccacggg
KU963990_X_P-RF-CB      ttgggactctaccgtccccttcttcatctgccgttccggccgaccacggg
KU963991_X_P-RF-CB      ttgggactctaccgtccccttcttcatctgccgttccggccgaccacggg
KU963993_X_P-RF-CB      ttgggactctaccgtccccttcttcatctgccgttccggccgaccacggg
KU963994_X_P-RF-CB      ttgggactctaccgtccccttcttcatctgccgttccggccgaccacggg
KU963995_X_P-RF-CB      ttgggactctaccgtccccttcttcatctgccgttccggccgaccacggg
KU963998_X_P-RF-CB      ttgggactctaccgtccccttcttcatctgccgttccggccgaccacggg
KU963999_X_P-RF-CB      ttgggactctaccgtccccttcttcatctgccgttccggccgaccacggg
KU964001_X_P-RF-CB      ttgggactctaccgtccc