HBVdb

Dataset for nucleotide sequence SP of genotype RF

[Download (right click)] [Edit] [Sequences] [Repertoires]

1450 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


MF488699_SP_P-RF-DE      atgcccctatcttatcaacacttcctgagacttgtgttgataaag-----
FN594767_SP_P-RF-DE      atgcccctatcttatcaacacttccggagaatactgttgttagac-----
GQ161806_SP_P-RF-EA      atgcccctatcttatcaacacttccggaractactgttgttagac-----
KX357641_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttcttagac-----
AY341335_SP_P-RF-DE      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF440017_SP_P-RF-DA      atgcccctatcttatcaacacttcctcaaactactgttgttagac-----
JF440013_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440001_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgcgttgttagac-----
JF440006_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF439994_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF439995_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF439996_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF439998_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF439999_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440000_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440002_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440003_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440007_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440008_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440009_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440010_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440011_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440012_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440014_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440015_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440004_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
JF440005_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttgttagac-----
AJ627221_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttattagac-----
MF925396_SP_P-RF-DC      atgcccctatcttatcaatacttccggagacttctgttgttagac-----
KJ803771_SP_P-RF-DB      atgcccctatcttatcaacgcttccggagactactgttattagat-----
MZ097814_SP_P-RF-DE      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JN688717_SP_P-RF-DE      atgcccctatcttatcaactcttccggagactactgttgttagac-----
JN257204_SP_P-RF-DE      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MF925402_SP_P-RF-BD      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MN507835_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MF925360_SP_P-RF-DB      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MF925388_SP_P-RF-DC      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KM524357_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KR905422_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MF925371_SP_P-RF-DC      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MF925392_SP_P-RF-DB      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MF925401_SP_P-RF-DB      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KT366503_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN664946_SP_P-RF-DA      atgcccctatcttatcaacacttccggaaactactgttgttagatgtcga
EU594406_SP_P-RF-DE      atgcccctatcttatcaacacttccggagacttgtgttgttagac-----
JN642160_SP_P-RF-DE      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
X80925_SP_P-RF-DE        atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JQ687532_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MZ097850_SP_P-RF-DE      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426112_SP_P-RF-DE      atgcccctatcctatcaacacttccggaagctactgttattagac-----
JN664925_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN664935_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU668440_SP_P-RF-DE      atgcccctatcttatcaacacttccggagacttgtgttgttagac-----
JN664934_SP_P-RF-DE      atgcccctatcttatcaacacttccggagacttgtgttgttagac-----
MK541689_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
GQ205379_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttattagaa-----
JN664933_SP_P-RF-DA      atgcccctatcttatcaacacttccggaaactactgttgttagatgtcga
JN664929_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
DQ315780_SP_P-RF-DE      atgcccctatcttatctacacttccggagactactgttgttagac-----
DQ315779_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN664940_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KT366505_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MK516279_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MK516280_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KC875339_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN664915_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
AB033558_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
GQ205377_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
GQ205378_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
GQ205386_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
GQ205387_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KC875338_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KJ586811_SP_P-RF-DF      atgcccctatcctatcaacacttccggagactactgttgttagac-----
MG877711_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
FJ349212_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaacttgtgttattagac-----
MW601260_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttattagac-----
MZ097740_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttattagac-----
JX898693_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
JX898695_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
JX898696_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
JX898690_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
MF967563_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
AB210819_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
MT426110_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
MT426111_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
U95551_SP_P-RF-DE        atgcccctatcctatcaacacttccggaaactactgttgttagac-----
MZ097667_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
AJ344117_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
JX898686_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
JX898687_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
JX898688_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
MT426113_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
JX898698_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
JX898699_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
MW601296_SP_P-RF-DE      atgcccctatcctatcaacacttccggagacttgtgttgttagac-----
MZ097767_SP_P-RF-DE      atgcccctatcctatcaacacttccggagacttgtgttgttagac-----
KT366504_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
MK618442_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
MK618440_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
MK618438_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
MK618444_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
MK618445_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
AB674412_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttattagac-----
MW601264_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttattagac-----
MZ097745_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttrttagac-----
X68292_SP_P-RF-DA        atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JN257154_SP_P-RF-DE      atgcccctatcttatcaacacttccggagacttctgttattagac-----
MZ097680_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MZ097703_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
X65259_SP_P-RF-DA        atgcccctatcctatcaacacttccggagactactgttgttacac-----
AB674434_SP_P-RF-DE      atgcccctatcttatcaacacttccggagtctactgttgttagac-----
JF754613_SP_P-RF-DE      atgcccctatcttatcaacacttccggagacttgtgttattagac-----
JN040803_SP_P-RF-DE      atgcccctatcttatcaacacttccggagacttctgttattagac-----
MZ097806_SP_P-RF-DE      atgcccctatcttatcaacacttccggagacttgtgttattagac-----
MW601317_SP_P-RF-DE      atgcccctatcttatcaacacttccggagacttgtgttgttagac-----
MZ097822_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MF925397_SP_P-RF-DC      atgcccctatcttatcaacacttccggagactgctgttgttagac-----
MF925384_SP_P-RF-DB      atgcccctatcttatcaacacttccggagacttctgttgttagac-----
KM577666_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttattagac-----
MK052957_SP_P-RF-DE      atgcccctatcttatcaacacttccggagattgctgttgttagag-----
AB674436_SP_P-RF-DE      atgcccctatcttatcaacacttccggagacttgtgttgttagac-----
AB330368_SP_P-RF-DA      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK052969_SP_P-RF-DE      atgcccctatcttatcaacacttccggagattgctgttgttagag-----
JN688689_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
MZ097652_SP_P-RF-DE      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JN688715_SP_P-RF-DE      atgcccctatcctatcaatccttccggagactactgttgttagac-----
FJ349221_SP_P-RF-DE      atgcccctatcctatcaacacttccggagacttgtgttgttagac-----
DQ464167_SP_P-RF-DE      atgcccctatcctatccacacttccggagactactgttgttagac-----
DQ464166_SP_P-RF-DE      atgcccctatcctatccacacttccggagactactgttgttagac-----
DQ464164_SP_P-RF-DE      atgcccctatcctatccacacttccggagactactgttgttagac-----
DQ464165_SP_P-RF-DE      atgcccctatcctatccacacttccggagactactgttgttagac-----
MW601241_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MZ097724_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MZ097826_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttattagat-----
JN642137_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttattagac-----
JN040798_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KF679991_SP_P-RF-DE      atgcccctatcttatcaacacttccggagtgtactgttgttagac-----
JN257216_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MZ097838_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MZ097766_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KJ647351_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JN642139_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MW601310_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttattagac-----
MZ097777_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttattagac-----
MH464850_SP_P-RF-DA      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB270538_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MH724240_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
KM524337_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
DQ315777_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KM524336_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KJ647349_SP_P-RF-DE      atgcccctatcctatcaacacttccggagacttgtgttattagac-----
MH464835_SP_P-RF-DE      atgcccctatcctatcaacacttccggagacttgtgttgttagac-----
MW601235_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
MZ097721_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
MH724243_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
MF488702_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX827302_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
KM359442_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttattagac-----
JN664943_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN642127_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagag-----
JN257210_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
AY233295_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
AB188243_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttattagac-----
MH724239_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagag-----
GU563560_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
AY233293_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
MH464851_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
MT210033_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
KM386676_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
MH724222_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
MH464846_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
MH464852_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
KM577667_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN257191_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MW601230_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MZ097719_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KF471643_SP_P-RF-DE      atgcccctatcttatcaacacttccggagacttctgttgttagac-----
JN257206_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN257207_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN257189_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JF754616_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
AB674432_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MZ097687_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
AB674433_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN257164_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN257174_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN642152_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MK598652_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
MK598653_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
EU594436_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
DQ111987_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
EU594435_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MK598654_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MK618439_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MW601284_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagaa-----
MZ097758_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagas-----
MW601227_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MZ097716_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MK598656_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KM577664_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KM577663_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KC774450_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
JN642141_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KM577665_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
EF103285_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
AB188245_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
AB583679_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
AJ627217_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
GQ183486_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MN507850_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
AY373430_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KM524359_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KT366492_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KJ647356_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FN594770_SP_P-RF-DE      atgcccctatcctatcaacacttccggagaatactgttgttagac-----
AM494716_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ904444_SP_P-RF-DE      atgcccctatcttatcaacacttccggagacttctgttattagac-----
FJ904405_SP_P-RF-DE      atgcccctatcttatcaacacttccggagacttctgttattagac-----
KP288875_SP_P-RF-DE      atgcccctatcttatcaatacttccggagactactgttgttagac-----
FJ349207_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ904430_SP_P-RF-DE      atgcccctatcttatcaacacttccggagacttgtgttattagac-----
FJ904442_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ904416_SP_P-RF-DE      atgcccctatcttatcaacacttccggagacttctgttgttagac-----
FJ904417_SP_P-RF-DE      atgcccctatcttatcaacacttccggagacttctgttgttagac-----
FJ904414_SP_P-RF-DE      atgcccctatcttatcaacacttccggagacttctgttcttagac-----
FJ904400_SP_P-RF-DE      atgcccctatcttatcaatccttccggagactactgttgttagac-----
FN594769_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
GQ161754_SP_P-RF-DE      atgcccctatcctatcaacacttccggagaatactgttgttagac-----
KM606751_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FN594771_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ904437_SP_P-RF-DE      atgcccctatcttatcaacaattccggagacttgtgttgttagac-----
DQ991753_SP_P-RF-DE      atgcccctatcttatcatcacttccggagacttgtgttgttagac-----
KX357628_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KU736916_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KU711666_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KF170740_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
GU177079_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ904447_SP_P-RF-DE      atgcccctatcttatcaacacttccggagacttgtgttgttagac-----
FJ904404_SP_P-RF-DE      atgcccctatcttatcaacacttccggagacttgtgttgttagac-----
FJ904397_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MT591274_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MT591275_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX357632_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactgctgttgttagac-----
KX357631_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX357626_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagag-----
KU736922_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KP168421_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttattagac-----
KM606741_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ904436_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttattagac-----
FJ904398_SP_P-RF-DE      atgcccctatcttatcaacacttccggagacttctgttgttagac-----
KX357636_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ904441_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX357627_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ904406_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttattagac-----
FJ904428_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ904396_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ904401_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MT426114_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MH685719_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX827299_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX357630_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX357629_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX357625_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX357624_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX357623_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX357633_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX357634_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KX357635_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KU736915_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KU736914_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KU736917_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KP995112_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KP168420_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ904407_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ904403_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ904394_SP_P-RF-DE      atgcccctatcttatcaacacttccggagmctactgttgttagac-----
FJ904440_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KM606750_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KP168416_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KP168417_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KP168418_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KU736921_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KU736923_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MT591280_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ904408_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttattagac-----
FJ904409_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
FJ904425_SP_P-RF-DE      atgcccctatcttatcaacacttccggagattactgttgttagac-----
KY470845_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactattgttagac-----
KY470848_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactattgttagac-----
KY470851_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactattgttagac-----
KY470852_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactattgttagac-----
KY470853_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactattgttagac-----
MK052976_SP_P-RF-BD      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MF618346_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KJ470898_SP_P-RF-DE      atgcccctatcttatcaacacttccggagacttgtgttattagac-----
KY470844_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactattgttagac-----
KY470854_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactattgttagac-----
KY470843_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactattgttagac-----
KY470846_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactattgttagac-----
KY470847_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactattgttagac-----
KY470849_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactattgttagac-----
KY470850_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactattgttagac-----
KY470855_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactattgttagac-----
KY470856_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactattgttagac-----
KX660685_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683641_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683662_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683620_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaaatactgttgttagac-----
KF917451_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgctagac-----
MN683588_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT645062_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774431_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactgctgttgttagac-----
MT645070_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683657_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactagtgttgttagac-----
MN683634_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY670781_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KX660680_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774442_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF491455_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY862865_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683626_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774449_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683655_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683627_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttattagac-----
MN683624_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683625_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683643_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683644_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683645_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683647_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683649_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683609_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683592_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683594_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683590_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KP276254_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KP276255_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774463_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JX429898_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774434_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774472_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774489_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774497_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774499_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683597_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683630_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683632_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683635_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683651_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683652_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683653_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683654_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683659_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683660_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683661_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683663_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683683_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT645065_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN657317_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT645067_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683656_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683611_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683581_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KX660682_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774488_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttattagac-----
KC774493_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttattagac-----
KC774481_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774458_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774447_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774452_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF491451_SP_P-RF-DC      atgcccctatcttatccacacttccggaaactactgttgttagac-----
DQ478886_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY862866_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY862864_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB270535_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY800249_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY817515_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU787434_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF491449_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774420_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774422_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774426_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774435_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774439_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774443_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774453_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774455_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774457_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774470_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774474_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774475_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774476_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774483_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774484_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774495_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774498_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KX660674_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KX660675_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683574_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683579_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683603_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683605_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683607_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683610_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683613_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683614_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683615_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683619_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683623_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683639_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683650_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683664_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683665_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683666_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700494_SP_P-RF-DE      atgcccctatcctatcaacacttccggagacttgtgttattagac-----
HQ700493_SP_P-RF-DE      atgcccctatcctatcaacacttccggagacttgtgttgttagac-----
J02202_SP_P-RF-DE        atgcccctatcctatcaacgcttccggagactactgttgttagac-----
HQ700536_SP_P-RF-DE      atgcccctatcctatcaacacttccggagacttgtgttgttagac-----
HQ700579_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700585_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700541_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
MH481859_SP_P-RF-DE      acgcccctatcctatcaacacttccggagactactgttgctagac-----
HQ700582_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700535_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700534_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700533_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700503_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700492_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
AB033559_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700497_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700500_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700501_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700524_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700525_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700537_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700538_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700539_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700581_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700583_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700584_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
HQ700540_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
FJ692536_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
KF779353_SP_P-RF-DA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
MH481860_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
AB048702_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
AB048703_SP_P-RF-DE      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
MH481858_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
MH481861_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
MH481862_SP_P-RF-DE      atgcccctatcctatcaacacttccggagactactgttgttagac-----
KJ470897_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttattagac-----
KU964366_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964370_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964372_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964374_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964379_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964380_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964367_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683712_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttattagac-----
MN683618_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttattagac-----
KF192841_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MF618347_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KF192833_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KF192835_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KF192836_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KF192837_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KF192838_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KF192839_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KF192840_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KJ470887_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KJ470884_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KJ470886_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KJ470888_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KJ470890_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KJ470891_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KJ470892_SP_P-RF-DE      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MN683722_SP_P-RF-DC      atgcccctatcttatcgacacttccggaaactactgttgttagac-----
MN683675_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774487_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY817509_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KX660689_SP_P-RF-DC      atgcccctgtcttatcaagacttccggaaactactgttgttagac-----
MN683711_SP_P-RF-DC      atgcccctgtcttatcaagacttccggaaactactgttgttagac-----
KC774478_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774480_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683730_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttattagac-----
FJ562263_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttattagac-----
KT991424_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttattagac-----
KT991427_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttattagac-----
MN683718_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683673_SP_P-RF-DC      atgcccctatcttatcgacacttccggaaactactgttgttagac-----
MN683622_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KX660686_SP_P-RF-DC      atgcccttatcttatcaacacttccggaaactactgttgttagac-----
MN683707_SP_P-RF-DC      atgcccttatcttatcaacacttccggaaactactgttgttagac-----
KX660684_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttggtagac-----
MN683706_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttggtagac-----
KT991421_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774454_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
DQ478889_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY817513_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN650079_SP_P-RF-DC      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MN683700_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683582_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HM750144_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN650069_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683612_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774468_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774430_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactgctgttgttagac-----
EU787435_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY817512_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
DQ478898_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774428_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774492_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774494_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683616_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683725_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683721_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683699_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683703_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683688_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683680_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683697_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683677_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683628_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683571_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN650087_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683687_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN650083_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN650076_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN650072_SP_P-RF-DC      atgcccctatcttatctacacttccggaaactactgttgttagac-----
MN650073_SP_P-RF-DC      atgcccctatcttatctacacttccggaaactactgttgttagac-----
MN650074_SP_P-RF-DC      atgcccctatcttatctacacttccggaaactactgttgttagac-----
MN650075_SP_P-RF-DC      atgcccctatcttatctacacttccggaaactactgttgttagac-----
MN650077_SP_P-RF-DC      atgcccctatcttatctacacttccggaaactactgttgttagac-----
MN650078_SP_P-RF-DC      atgcccctatcttatctacacttccggaaactactgttgttagac-----
MN650085_SP_P-RF-DC      atgcccctatcttatctacacttccggaaactactgttgttagac-----
MN650086_SP_P-RF-DC      atgcccctatcttatctacacttccggaaactactgttgttagac-----
MN683723_SP_P-RF-DC      atgcccctatcttatctacacttccggaaactactgttgttagac-----
MN650068_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY629632_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KP276253_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774486_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774485_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774482_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774448_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF491456_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF491448_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HM750147_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HM750148_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683694_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562278_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774466_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774479_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KT991417_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KT991420_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KT991423_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683621_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ349241_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683686_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683693_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683724_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
DQ478890_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY817510_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB674504_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
DQ478887_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
DQ478892_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
DQ478897_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774423_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774424_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774425_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774432_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774433_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774461_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774471_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774490_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KT991419_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU519422_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU519423_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KX660677_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN657315_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN657316_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683572_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683584_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683586_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683596_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683617_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683636_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683637_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683638_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683640_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683642_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683658_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683668_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683669_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683670_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683671_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683672_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683674_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683679_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683684_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683685_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683713_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683714_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683717_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT645049_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT645060_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT645063_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT645066_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY057948_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY817511_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HM750142_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HM750143_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HM750145_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HM750146_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HM750149_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HM750150_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774456_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KP276256_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KX354997_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN650080_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN650081_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN650082_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN650084_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683580_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683587_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683676_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683678_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683689_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683690_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683691_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683692_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683695_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683696_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683715_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683716_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683719_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MN683720_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB031265_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JQ040175_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ717800_SP_P-RF-CB      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KJ803791_SP_P-RF-CB      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KU679952_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttrttagac-----
KU679940_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873535_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873530_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU679958_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU679954_SP_P-RF-CB      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
KU679939_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU679956_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU679943_SP_P-RF-BC      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
KF873527_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU679942_SP_P-RF-CB      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
KF873521_SP_P-RF-BC      atgcccctatcttatccacacttccggagactactgttgttagac-----
KU679955_SP_P-RF-CB      atgcccctatcttatccacacttccggaaactactgttgttagac-----
KU679950_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU679948_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU679946_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873523_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873522_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU679941_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873524_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU679953_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873511_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873513_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873515_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873517_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873518_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873519_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU679944_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873534_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873531_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873532_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873533_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873537_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU679945_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873538_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873542_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873543_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF873540_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ586803_SP_P-RF-AF      atgcccctatcttatcaacacttccggagactactgttgttagac-----
GQ161788_SP_P-RF-AE      atgcccctatcttatcaacacttccggagtgtactgttgttagac-----
GQ161753_SP_P-RF-AE      atgcccctatcttatcaacacttccggagaatactgttgttagac-----
GQ161837_SP_P-RF-AE      atgcccctatcttatcaacacttccggagaatactgttgttagac-----
GQ161838_SP_P-RF-AE      atgcccctatcttatcaacacttccggagaatactgttgttagac-----
GQ161767_SP_P-RF-AE      atgcccctatcttatcaacacttccggagaatactgttgttagac-----
HF571060_SP_P-RF-AE      atgcccctatcttatcaacacttccggagaatactgttgttagac-----
MG826151_SP_P-RF-BC      atgcccctatcgtatcaacacttccggaaactactgttgttagac-----
MK534665_SP_P-RF-CB      atgcccctatcttatccacacttccggagacttgtgttgttagac-----
HQ684849_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF053188_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactgctgttgttagac-----
KJ803782_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactgctgttgttagac-----
KF053186_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ803778_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ717814_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ803802_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT645045_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KX096713_SP_P-RF-CA      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB241109_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534615_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534725_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534713_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534632_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534706_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ717815_SP_P-RF-CB      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
KJ803803_SP_P-RF-CB      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
MK534735_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ717816_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534613_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534724_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534717_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK052970_SP_P-RF-BD      atgcccctatcttatcaacacttccgaaaactactgttgttagac-----
MH746811_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MG826145_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MH746812_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MH746813_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534590_SP_P-RF-BC      atgcccctatcttatcaatgcttccggaaactactgttattagac-----
MK534700_SP_P-RF-BC      atgcccctatcctatcaacacttccggaaactactgttattagac-----
KC315400_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MG826150_SP_P-RF-BC      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
EU882006_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534730_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534701_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ410497_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377595_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534716_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534695_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534630_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534681_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534722_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534721_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534686_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534668_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttattagac-----
MK534641_SP_P-RF-BC      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
MK534635_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534620_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534714_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534637_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534653_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534734_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534718_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534587_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377635_SP_P-RF-BC      atgcccctatcttatcaacgcttccggaaactactgttgttagac-----
EU939631_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534594_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534728_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaattactgttgttagag-----
MK534715_SP_P-RF-BC      atgcccctatcttatcaacacttccggaagttactgttgttagag-----
MK534583_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534582_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU660227_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534607_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534609_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534616_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534684_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534648_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534566_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KX774505_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534726_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactaccgttgttagac-----
MK534589_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377630_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534561_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534577_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534610_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT645056_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939629_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774178_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774364_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MH094410_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534559_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JQ801477_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534606_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534729_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactaccgttgttagac-----
MK534712_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534690_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534660_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534646_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534617_SP_P-RF-BC      atgcccctatcttatcaacacttccggaagctactgttgttagac-----
MK534618_SP_P-RF-BC      atgcccctatcttatcaacacttccggaagctactgttgttagac-----
MK534568_SP_P-RF-BC      atgcccctatcttatcaacacttccggaagctactgttgttagac-----
MK534563_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactaccgttgttagac-----
MK534555_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagag-----
MK052968_SP_P-RF-BD      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK052967_SP_P-RF-BD      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KP148337_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534562_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534584_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534623_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534654_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534655_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534662_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534664_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534670_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534672_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534675_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534687_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534688_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534689_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534723_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534736_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939627_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534556_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534558_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534564_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534567_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534569_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534579_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534580_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534598_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534625_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534633_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534639_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534651_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534685_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534731_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774414_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY470865_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttattagac-----
KY470858_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttattagag-----
KY470871_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttattagag-----
MZ439768_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaattactgttgttagac-----
MZ439798_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaattactgttgttagac-----
EU835240_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MH368022_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagat-----
KP148442_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ882612_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagat-----
FJ882618_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagat-----
FJ882617_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagat-----
FJ882611_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagat-----
FJ882613_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ023665_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttattagac-----
KF214680_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ882610_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ882614_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU833891_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ023664_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ023667_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ023668_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ023670_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ023673_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ023666_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY470996_SP_P-RF-GC      atgcccctatcttatcaacaatttcggaaactactgttgttagac-----
KY470999_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactgctgttgttagac-----
KY471000_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactgctgttgttagac-----
KY471002_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactgctgttgttagac-----
KY470998_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY471001_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY470997_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY471004_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FR714490_SP_P-RF-GB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ023662_SP_P-RF-GC      atgcccctatcttatcaacaattccggaaactactgttgttagac-----
FJ023659_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC172106_SP_P-RF-GB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY471003_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY471005_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY471006_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY471007_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KP148441_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KP148449_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KP148586_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KP148447_SP_P-RF-GC      atgcccctatcttatcaacaattccggaaactactgttgttagac-----
KP148450_SP_P-RF-GC      atgcccctatcttatcaacaattccggaaactactgttgttagac-----
KX765835_SP_P-RF-GC      atgcccctatcttatcaacacttccggaaactactgttattagac-----
JF440021_SP_P-RF-AG      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU833890_SP_P-RF-GA      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KF219922_SP_P-RF-GH      atgcccctatcctatcaacacttccggagactactgttgttagac-----
EU833889_SP_P-RF-GA      atgcacctatcctatcaacacttccggagactactgttgttagac-----
EF464099_SP_P-RF-AG      atgcccctatcctatcaacacttccggagactactgttgttagac-----
KP274926_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
AB933279_SP_P-RF-AG      atgcccctatcctatcaacacttccggagactactgttgttagac-----
AB933280_SP_P-RF-AG      atgcccctatcctatcaacacttccggagactactgttgttagac-----
AB933281_SP_P-RF-AG      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707463_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707465_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707426_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707459_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707474_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707468_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707456_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707457_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707458_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707460_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707461_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707462_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707464_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707466_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707469_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707470_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707471_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707472_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707432_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707421_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707430_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707441_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707445_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707448_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707450_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707467_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707473_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707475_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
JQ707424_SP_P-RF-GA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
FJ361772_SP_P-RF-GC      atgcccctatcttatccacacttccggaaactactgttgttagac-----
JQ272886_SP_P-RF-GF      atgcccctatcttatccacacttccggaaactactgttgttagac-----
JQ272887_SP_P-RF-GF      atgcccctatcttatccacacttccggaaactactgttgttagac-----
HE981179_SP_P-RF-FG      atgcccctatcctatccacacttccggaaactactgttgttagac-----
HE981180_SP_P-RF-GF      atgcccctatcctatccacacttccggaaactactgttgttagac-----
MK534663_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534669_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AF297620_SP_P-RF-DA      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EF103284_SP_P-RF-AD      atgcccctatcctatcaacacttccggagactactgttgttagac-----
AY236161_SP_P-RF-DA      atgcccctatcctatcaacacttccggagactactgttgttagac-----
AB194949_SP_P-RF-AE      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF439776_SP_P-RF-AG      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU185780_SP_P-RF-AD      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
KC012653_SP_P-RF-AD      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
AF297619_SP_P-RF-DA      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB933283_SP_P-RF-AG      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF440019_SP_P-RF-AG      atgcccctatcctatcaacacttccggagactactgttgttagac-----
AB222708_SP_P-RF-AD      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF440022_SP_P-RF-AG      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MF925386_SP_P-RF-AC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB453985_SP_P-RF-AC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB933282_SP_P-RF-AG      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ331048_SP_P-RF-AE      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY161140_SP_P-RF-AD      atgcccctatcttatcaacacttccggagactactgttgttagat-----
AY161141_SP_P-RF-AD      atgcccctatcttatcaacacttccggagactactgttgttagat-----
HM146131_SP_P-RF-AD      atgccactatcttatcaacacttccggaaactactgttgttagac-----
AY161147_SP_P-RF-DA      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EF103283_SP_P-RF-AD      atgcccctatcttatcaacacttccggagactactgttgttagac-----
AY161145_SP_P-RF-AD      atgcccctatcttatcaacacttccggagactactgttgttagac-----
AY161146_SP_P-RF-AD      atgcccctatcttatcaacacttccggagactactgttgttagac-----
EF103282_SP_P-RF-AD      atgcccctatcttatcaacacttccggagactactgttgttagac-----
KF214656_SP_P-RF-AC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ586810_SP_P-RF-AF      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY233277_SP_P-RF-AC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MF925404_SP_P-RF-AC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MF488705_SP_P-RF-AD      atgcccctatcttatcaacacttccggaaactactgttattagac-----
MT426089_SP_P-RF-AB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF053166_SP_P-RF-BC      atgcccctatcttatccacacttcctgagacttctgttgttagag-----
KJ803827_SP_P-RF-BC      atgcccctatcttatccacacttcctgagacttctgttgttagag-----
KC774323_SP_P-RF-CB      atgcccctatcttatcatcacttcgggaaactactgtggactcac-----
EF494378_SP_P-RF-CA      atgcccctatcttatcaatacttccggaaactactgttattagac-----
KJ803822_SP_P-RF-CB      atgcccctatcttatcaatgcttccggaaactgctgttgttagac-----
HQ700518_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700520_SP_P-RF-CB      atgcccctatcttatcaacacttccggagactactgttattagac-----
GQ377592_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttattagag-----
HQ700580_SP_P-RF-CB      atgcccctatcttatcaacgcttccggagactactgttattagac-----
JF436919_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU787444_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ386643_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU916228_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU717211_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JQ040146_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU589337_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562227_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagat-----
DQ089798_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MG826144_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963862_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KR013843_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ173350_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ173325_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377604_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939632_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939577_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AF411409_SP_P-RF-CB      atgcccctatcttatcaacacttccggaagctactgttgttagac-----
MT645039_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963930_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963931_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963932_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963933_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963934_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963935_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963936_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963938_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963939_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963940_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963941_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963942_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963943_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963944_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377556_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
Y18856_SP_P-RF-CB        atgcccctctcttatcaacacttccggaaactactgttgttagac-----
GQ377539_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF828938_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF828933_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF828934_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF828936_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF828935_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426455_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JX661486_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JQ732168_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF436922_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GU357843_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562302_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562277_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939565_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AP011108_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HM750133_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939606_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ173320_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ173322_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU919166_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU919167_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JQ040142_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JQ040148_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JX661485_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MG893554_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MG893555_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377548_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EF494376_SP_P-RF-CA      atgcccctatcttatcaacacttctggaaactactgttgttagac-----
FJ386635_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MG893561_SP_P-RF-CB      atgcccctatcttatcaacacttcggaaaactactgttgttagac-----
MT645069_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT645048_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426524_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK321265_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK720627_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK720628_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426456_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426467_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426485_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426527_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426541_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426557_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
LC458432_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964313_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KR013806_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KM875422_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ173329_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ173330_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ173299_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ173300_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774344_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774317_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774322_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774305_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774234_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774183_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774186_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774230_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JX661487_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GU385774_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377522_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774222_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377520_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377534_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ715345_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ715346_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ715347_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562336_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562287_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562247_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ386593_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ386578_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939630_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939551_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU872014_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY040627_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AF461361_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB670303_SP_P-RF-CB      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
AB198084_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU916232_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964005_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964006_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964007_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964008_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964009_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964010_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964303_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964304_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964305_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964306_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964307_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964308_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964309_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964310_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964311_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964312_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964314_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964315_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964316_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964317_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871997_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU872015_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ386581_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ386585_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562305_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562314_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ715385_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ715387_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ715411_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ715412_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ715413_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ715414_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377516_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377544_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JQ040130_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JX026887_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774263_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774294_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774332_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774341_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ173326_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ173349_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963883_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963990_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963991_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963993_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963994_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963995_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963998_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963999_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964001_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964003_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY470893_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY881840_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
LC279263_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
LC279264_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
LC279265_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
LC279266_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
LC279267_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MG893559_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT645029_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT645035_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU916239_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU916240_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU916241_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774246_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963856_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963857_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963858_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963859_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963860_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963861_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963863_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963864_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963865_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963866_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963867_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963868_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963869_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU963870_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562223_SP_P-RF-CD      atgcccctatcttatcatcacttccggaaattactgttgttagac-----
FR714496_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JX504540_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MF925382_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactgctgttattagac-----
MK534719_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactgctgttgttagac-----
FJ386674_SP_P-RF-BC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY363272_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY363273_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ803785_SP_P-RF-CB      atgcccctatcttatcaacacttccggagactactgttgttagac-----
GQ377627_SP_P-RF-CD      atgcccctatcttatcaacacttccggagactactgttgttagac-----
EU881995_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ717794_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ803788_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MF925389_SP_P-RF-DC      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ803798_SP_P-RF-CB      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
HQ684848_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB367393_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700527_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700528_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB493842_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AP011102_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB493840_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AP011103_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB493838_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB493847_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB105172_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB493837_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ358155_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ358156_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700554_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttattagac-----
EU939547_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactattgttagac-----
EU589339_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU695741_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU695743_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700505_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU695744_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU695746_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562317_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactattgttagac-----
FJ386586_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700519_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700521_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KY363262_SP_P-RF-CB      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
KY363263_SP_P-RF-CB      atgcccctatcctatcaacacttccggaaactactgttgttagac-----
MT426471_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426546_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426544_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426540_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426539_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426491_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgtcagac-----
MT426463_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426547_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426563_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426504_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426489_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426488_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426496_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426549_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426572_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426483_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426481_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426478_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426473_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426469_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426464_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426462_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426461_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426470_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426475_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426476_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426477_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426492_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426503_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426510_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426535_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426457_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426459_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426479_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426486_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426487_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426507_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426460_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426562_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426553_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426550_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426545_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426537_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426573_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426533_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426531_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426534_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426526_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426523_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426522_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426509_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426501_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaaccactgttgttagac-----
MT426500_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426543_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426559_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426494_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttggac-----
MT426480_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426472_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426468_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426465_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426532_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426466_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426482_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426484_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426490_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426493_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426495_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426497_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426498_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426502_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426505_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426506_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426508_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426511_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426512_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426513_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426514_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426515_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426517_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426518_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426519_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426520_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426521_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426525_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426528_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426529_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426530_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426536_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426538_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426542_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426551_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426554_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426555_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426556_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426558_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426560_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426561_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426564_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426565_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426566_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426567_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426568_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426569_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426570_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426571_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426574_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426575_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT426576_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700530_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700523_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700531_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700532_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ598675_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttattagac-----
MG826148_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MG826146_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MG826147_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700507_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700508_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700509_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700515_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
X75656_SP_P-RF-CB        atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU695745_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700542_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700560_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700557_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700485_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700462_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700498_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700499_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MG826141_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KT003704_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KR013948_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JQ027310_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JF436923_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ032343_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttattagac-----
EU939620_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY206374_SP_P-RF-CB      atgcccctatcttatcaacacttccggagactactgttgttagac-----
HQ700526_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562294_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939668_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939623_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttattagac-----
AB033557_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AF233236_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534560_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534574_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB367400_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774212_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
Y18857_SP_P-RF-CB        atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MW887645_SP_P-RF-CD      atgcccctatcttatcaacacttccggagactactgttgttagac-----
MT426499_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MG826149_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MG826142_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MF925381_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttattagac-----
LC416040_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU695742_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KP148352_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ717832_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ410520_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KF053179_SP_P-RF-BC      atgcccctatcttatcaacacttccggagactactgttattagag-----
KJ803772_SP_P-RF-BC      atgcccctatcttatcaacacttccggagactactgttattagag-----
KF053160_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ803753_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774349_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttattagac-----
KC774188_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JQ040174_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ475335_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaattactgttgttagac-----
GQ377607_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377573_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562328_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562271_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562226_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ386649_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ787446_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ787480_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939621_SP_P-RF-CB      atgcccctatcttatcaacgcttccggaaactactgttgttagac-----
AP011104_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AP011105_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB205152_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB049609_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377602_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB367800_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB367419_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ386633_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562267_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT645071_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939581_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871999_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871995_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871994_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AF330110_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB642096_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871981_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871983_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871984_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871985_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871986_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871987_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871988_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871989_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871990_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871991_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871992_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871993_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU871996_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939589_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ715384_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
M38454_SP_P-RF-CB        atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB300369_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774198_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774201_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377560_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774193_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774291_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774307_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB195956_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB195957_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB195939_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB195940_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB195941_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KM213033_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ032337_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB014375_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JN400086_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB195955_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY167095_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534679_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttattagac-----
MZ439673_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttattagac-----
GQ377581_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377564_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactacagttgttagac-----
GQ377565_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377590_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377596_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377614_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB195950_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AB195951_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
HQ700547_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KU964351_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KR013816_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774324_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JQ801476_SP_P-RF-CG      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ924618_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ410506_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ803804_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MF925370_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534682_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MT645015_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377633_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377626_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377549_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JX661498_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU939602_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ386646_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
EU522070_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY123424_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MW887644_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
AY247030_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JQ707714_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774258_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KC774328_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
MK534585_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactaccgttgttagac-----
KJ173358_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ173279_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377613_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377611_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
FJ562229_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377594_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
GQ377634_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JX429896_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
JX661494_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
KJ173280_SP_P-RF-CB      atgcccctatcttatcaacacttccggaaactactgttgttagac-----
                         * **   * ** ****     **    *        *      *      

MF488699_SP_P-RF-DE      -ga------c------gag------gcaggaccaataaaataccatctcc
FN594767_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ161806_SP_P-RF-EA      -ga------m------gag------gcaggtcccctagaagaagaactcc
KX357641_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
AY341335_SP_P-RF-DE      -ga------c------gag------gcaggacccctagaagaagaactcc
JF440017_SP_P-RF-DA      -gacgggacc------gag------gcaggtcccctagaagaagaactcc
JF440013_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440001_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440006_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF439994_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF439995_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF439996_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF439998_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF439999_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440000_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440002_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440003_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440007_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440008_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440009_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440010_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440011_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440012_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440014_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440015_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440004_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440005_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AJ627221_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF925396_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ803771_SP_P-RF-DB      -gc------c------gag------gcaggtcccctagaagaagaactcc
MZ097814_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaggaagaactcc
JN688717_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN257204_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF925402_SP_P-RF-BD      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN507835_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF925360_SP_P-RF-DB      -ca------c------gag------gcaggtcccctagaagaagaactcc
MF925388_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KM524357_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KR905422_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF925371_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF925392_SP_P-RF-DB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF925401_SP_P-RF-DB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KT366503_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN664946_SP_P-RF-DA      ggg------c------gag------gcaggtcccctagaagaagaactcc
EU594406_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN642160_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
X80925_SP_P-RF-DE        -ga------c------gag------gcaggtcccctagaagaagaactcc
JQ687532_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MZ097850_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426112_SP_P-RF-DE      -aa------c------gag------gcaggtcccttagaagaagaactcc
JN664925_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN664935_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU668440_SP_P-RF-DE      -ga------c------gag------gcaggtcacctagaagaagaactcc
JN664934_SP_P-RF-DE      -ga------a------gag------gcaggtcccct---agaagaactcc
MK541689_SP_P-RF-DE      -ga------c------gag------gcaggacccctagaagaagaactcc
GQ205379_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN664933_SP_P-RF-DA      ggg------c------gag------gcaggtcccctagaagaagaactcc
JN664929_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
DQ315780_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
DQ315779_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN664940_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KT366505_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK516279_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK516280_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC875339_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN664915_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB033558_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ205377_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ205378_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ205386_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ205387_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC875338_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ586811_SP_P-RF-DF      -ga------c------gag------gcaggtcccctagaagaactccccc
MG877711_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ349212_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MW601260_SP_P-RF-DE      -aa------c------gac------gcaggtcccctagaagaagaactcc
MZ097740_SP_P-RF-DE      -aa------c------gac------gcaggtcccctagaagaagaactcc
JX898693_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX898695_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX898696_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX898690_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF967563_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB210819_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426110_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426111_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
U95551_SP_P-RF-DE        -ga------c------gag------gcaggtcccctagaagaagaactcc
MZ097667_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AJ344117_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX898686_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX898687_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX898688_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426113_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX898698_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX898699_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MW601296_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MZ097767_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KT366504_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK618442_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK618440_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK618438_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK618444_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK618445_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB674412_SP_P-RF-DE      -aa------c------gaa------gcaggccccctagaagaagaactcc
MW601264_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MZ097745_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
X68292_SP_P-RF-DA        -ga------c------ggg------acaggtcccctagaagaagaactcc
JN257154_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MZ097680_SP_P-RF-DE      -ca------c------gag------gcaggtcccttagaagaagaactcc
MZ097703_SP_P-RF-DE      -ca------c------gag------gcaggtcctctagaagaagaactcc
X65259_SP_P-RF-DA        -ga------c------gag------gcaggtcccctagaagaagaactcc
AB674434_SP_P-RF-DE      -ga------c------gat------gcaggtcccctagaagaagaactcc
JF754613_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN040803_SP_P-RF-DE      -aa------c------gag------gcaggtcccctagaagaagaactcc
MZ097806_SP_P-RF-DE      -aa------c------gag------gcagggcccctagaagaagaactcc
MW601317_SP_P-RF-DE      -aa------c------gag------gcaggtccactagaagaagaactcc
MZ097822_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF925397_SP_P-RF-DC      -ga------c------gag------gcaggtcctctagaagaagaactcc
MF925384_SP_P-RF-DB      -aa------c------gag------gcaggtcccttagaagaagaactcc
KM577666_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK052957_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB674436_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB330368_SP_P-RF-DA      -ga------c------gggaccgaggcaggtcccctagaagaagaactcc
MK052969_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN688689_SP_P-RF-DE      -aa------c------aag------gcaggtcccctagaagaagaactcc
MZ097652_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN688715_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ349221_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
DQ464167_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
DQ464166_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
DQ464164_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
DQ464165_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MW601241_SP_P-RF-DE      -ga------c------gag------gcgggacccctagaagaagaactcc
MZ097724_SP_P-RF-DE      -ga------c------gag------gcgggacccctagaagaagaactcc
MZ097826_SP_P-RF-DE      -gt------c------gag------gcaggtcccctagaagaagaactcc
JN642137_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN040798_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF679991_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN257216_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MZ097838_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MZ097766_SP_P-RF-DE      -ga------c------gag------gcrggtcccctagaagaagaactcc
KJ647351_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN642139_SP_P-RF-DE      -ga------c------gag------tcaggtcccctagaagaagaactcc
MW601310_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
MZ097777_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
MH464850_SP_P-RF-DA      -ga------c------gagnnnnnngcaggtcccctagaagaagaactcc
AB270538_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MH724240_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KM524337_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
DQ315777_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KM524336_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ647349_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MH464835_SP_P-RF-DE      -ga------c------gagnnnnnngcaggtcccctagaagaagaactcc
MW601235_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
MZ097721_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
MH724243_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaagtcc
MF488702_SP_P-RF-DE      -ga------c------gag------gcaggtcccctaaaagaagaactcc
KX827302_SP_P-RF-DE      -ga------c------gat------gcaggtcccctagaagaagaactcc
KM359442_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN664943_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN642127_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN257210_SP_P-RF-DE      -ga------c------gat------gcaggwcccctagaagaagaactcc
AY233295_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB188243_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MH724239_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
GU563560_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY233293_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MH464851_SP_P-RF-DE      -ga------c------gagnnnnnngcaggtcccctagaagaagaactcc
MT210033_SP_P-RF-DE      -ga------c------gaggcannnnnnggtcccctagaagaagaactcc
KM386676_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MH724222_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MH464846_SP_P-RF-DE      -ga------c------gagnnnnnngcaggtcccctagaagaagaactcc
MH464852_SP_P-RF-DE      -ga------c------gagnnnnnngcaggtcccctagaagaagaactcc
KM577667_SP_P-RF-DE      -ga------c------gat------gcaggtcccctagaagaagaactcc
JN257191_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MW601230_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MZ097719_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF471643_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN257206_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN257207_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN257189_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF754616_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB674432_SP_P-RF-DE      -ga------c------gag------gcaggacccctagaagaagaactcc
MZ097687_SP_P-RF-DE      -ga------c------gag------gcaggacccctagaagaagaactcc
AB674433_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN257164_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN257174_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN642152_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK598652_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK598653_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU594436_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
DQ111987_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU594435_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK598654_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK618439_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MW601284_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MZ097758_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MW601227_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MZ097716_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK598656_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KM577664_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KM577663_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774450_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN642141_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KM577665_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
EF103285_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB188245_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB583679_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AJ627217_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ183486_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN507850_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY373430_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KM524359_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KT366492_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ647356_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
FN594770_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
AM494716_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904444_SP_P-RF-DE      -ga------a------gag------gcaggacccctagaagaagaactcc
FJ904405_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KP288875_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ349207_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagacgaactcc
FJ904430_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagacgaactcc
FJ904442_SP_P-RF-DE      -ga------a------gag------gcaggtcccctaaaggaagaactcc
FJ904416_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904417_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904414_SP_P-RF-DE      -ga------a------gat------gcaggtcccctagaagaagaactcc
FJ904400_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaggaagaactcc
FN594769_SP_P-RF-DE      -ga------a------gag------gcaggtcccctggaagaagaactcc
GQ161754_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KM606751_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FN594771_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904437_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
DQ991753_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX357628_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KU736916_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KU711666_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KF170740_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
GU177079_SP_P-RF-DE      -ga------agggaccgag------gcaggtcccctagaagaagaactcc
FJ904447_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904404_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904397_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
MT591274_SP_P-RF-DE      -aa------a------gag------gcaggtcctctagaagaagaactcc
MT591275_SP_P-RF-DE      -aa------a------gag------gcaggtcctctagaagaagaactcc
KX357632_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX357631_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX357626_SP_P-RF-DE      -ga------a------gag------gcaggtcccttagaagaagaactcc
KU736922_SP_P-RF-DE      -ga------a------rag------gcaggtcccctagaagaagaactcc
KP168421_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KM606741_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904436_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904398_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX357636_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904441_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX357627_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904406_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904428_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904396_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904401_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
MT426114_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
MH685719_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX827299_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX357630_SP_P-RF-DE      -ga------a------gat------gcaggtcccctagaagaagaactcc
KX357629_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX357625_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX357624_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX357623_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX357633_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX357634_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KX357635_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KU736915_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KU736914_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KU736917_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KP995112_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KP168420_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904407_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904403_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904394_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904440_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KM606750_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KP168416_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KP168417_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KP168418_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KU736921_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KU736923_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
MT591280_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904408_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904409_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ904425_SP_P-RF-DE      -ga------a------gag------gcaggtcccctagaagaagaactcc
KY470845_SP_P-RF-DC      -ga------c------aag------gcaggtcccctagaagaagaactcc
KY470848_SP_P-RF-DC      -ga------c------aag------gcaggtcccctagaagaagaactcc
KY470851_SP_P-RF-DC      -ga------c------aag------gcaggtcccctagaagaagaactcc
KY470852_SP_P-RF-DC      -ga------c------aag------gcaggtcccctagaagaagaactcc
KY470853_SP_P-RF-DC      -ga------c------gag------gcaggtcacctagaagaagaactcc
MK052976_SP_P-RF-BD      -ga------a------gag------gcaggtcccctagaagaagaactcc
MF618346_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ470898_SP_P-RF-DE      -aa------c------gag------gcaggccccctagaagaagaactcc
KY470844_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY470854_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY470843_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY470846_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY470847_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY470849_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY470850_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY470855_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY470856_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KX660685_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683641_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683662_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683620_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF917451_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683588_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT645062_SP_P-RF-DC      -ga------c------gat------gcaggtcccctagaagaagaactcc
KC774431_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT645070_SP_P-RF-DC      -ga------c------gag------gcaggacccctagaagaagaactcc
MN683657_SP_P-RF-DC      -ga------c------gag------gcaggtccactagaagaagaactcc
MN683634_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY670781_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KX660680_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaaytcc
KC774442_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF491455_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY862865_SP_P-RF-DC      -ga------c------gag------gcaggtcccttagaagaagaactcc
MN683626_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774449_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683655_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683627_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683624_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683625_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683643_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683644_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683645_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683647_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683649_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683609_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683592_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683594_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683590_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KP276254_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KP276255_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774463_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX429898_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774434_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774472_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774489_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774497_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774499_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683597_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683630_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683632_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683635_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683651_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683652_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683653_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683654_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683659_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683660_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683661_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683663_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683683_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT645065_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN657317_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT645067_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683656_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683611_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683581_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KX660682_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774488_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774493_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774481_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774458_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774447_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774452_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF491451_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
DQ478886_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY862866_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY862864_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB270535_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY800249_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY817515_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU787434_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF491449_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774420_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774422_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774426_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774435_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774439_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774443_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774453_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774455_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774457_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774470_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774474_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774475_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774476_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774483_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774484_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774495_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774498_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KX660674_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KX660675_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683574_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683579_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683603_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683605_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683607_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683610_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683613_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683614_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683615_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683619_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683623_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683639_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683650_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683664_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683665_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683666_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700494_SP_P-RF-DE      -aa------c------gag------gcaggacccctagaagaagaactcc
HQ700493_SP_P-RF-DE      -aa------c------gag------gcaggtccactagaagaagaactcc
J02202_SP_P-RF-DE        -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700536_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700579_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700585_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700541_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MH481859_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700582_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700535_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700534_SP_P-RF-DE      -ga------c------gag------tcaggtcccctagaagaagaactcc
HQ700533_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700503_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700492_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB033559_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700497_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700500_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700501_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700524_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700525_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700537_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700538_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700539_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700581_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700583_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700584_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700540_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ692536_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF779353_SP_P-RF-DA      -ga------c------gag------gcaggtcccctagaagaagaactcc
MH481860_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaaggactcc
AB048702_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB048703_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MH481858_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MH481861_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MH481862_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ470897_SP_P-RF-DE      -ga------c------gag------gcaggacccctagaagaagaactcc
KU964366_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
KU964370_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
KU964372_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
KU964374_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
KU964379_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
KU964380_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
KU964367_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683712_SP_P-RF-DC      -aa------c------gac------gcaggtcccctagaagacgaactcc
MN683618_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF192841_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF618347_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF192833_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF192835_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF192836_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF192837_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF192838_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF192839_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF192840_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ470887_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ470884_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ470886_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ470888_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ470890_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ470891_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ470892_SP_P-RF-DE      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683722_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683675_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774487_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY817509_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagatgaagaactct
KX660689_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683711_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
KC774478_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774480_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683730_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ562263_SP_P-RF-DC      -ga------c------aat------gcaggtcccctagaagacgaactcc
KT991424_SP_P-RF-DC      -ga------c------aat------gcaggtcccctagaagacgaactcc
KT991427_SP_P-RF-DC      -ga------c------aat------gcaggtcccctagaagacgaactcc
MN683718_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgtactcc
MN683673_SP_P-RF-DC      -ga------c------gag------gcaggacccctagaagaagaactcc
MN683622_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KX660686_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683707_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
KX660684_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683706_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
KT991421_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774454_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
DQ478889_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY817513_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN650079_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683700_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683582_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
HM750144_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN650069_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683612_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774468_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774430_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU787435_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY817512_SP_P-RF-DC      -ga------c------gag------gctggtcccctagaagaagaactcc
DQ478898_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774428_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774492_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774494_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683616_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683725_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683721_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683699_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683703_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683688_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683680_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683697_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683677_SP_P-RF-DC      -ga------c------gag------gcaggacccctagaagacgaactcc
MN683628_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683571_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN650087_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683687_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN650083_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN650076_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN650072_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN650073_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN650074_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN650075_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN650077_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN650078_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN650085_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN650086_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683723_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN650068_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
KY629632_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KP276253_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
KC774486_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774485_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
KC774482_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
KC774448_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF491456_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF491448_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
HM750147_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
HM750148_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683694_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
FJ562278_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774466_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774479_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KT991417_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KT991420_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KT991423_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683621_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ349241_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683686_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683693_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683724_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
DQ478890_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
AY817510_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB674504_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
DQ478887_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
DQ478892_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
DQ478897_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774423_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774424_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774425_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774432_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774433_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774461_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774471_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774490_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KT991419_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU519422_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU519423_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KX660677_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN657315_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN657316_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683572_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683584_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683586_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683596_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683617_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683636_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683637_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683638_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683640_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683642_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683658_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683668_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683669_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683670_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683671_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683672_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683674_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683679_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683684_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683685_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683713_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683714_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MN683717_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT645049_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT645060_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT645063_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT645066_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY057948_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
AY817511_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
HM750142_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
HM750143_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
HM750145_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
HM750146_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
HM750149_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
HM750150_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
KC774456_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
KP276256_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
KX354997_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN650080_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN650081_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN650082_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN650084_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683580_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683587_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683676_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683678_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683689_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683690_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683691_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683692_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683695_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683696_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683715_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683716_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683719_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
MN683720_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagacgaactcc
AB031265_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JQ040175_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ717800_SP_P-RF-CB      -ga------a------gag------gcaggtcccctggaagaagaactcc
KJ803791_SP_P-RF-CB      -ga------a------gag------gcaggtcccctggaagaagaactcc
KU679952_SP_P-RF-CB      -aa------c------gag------gcaggwccyctaraagaagaactcc
KU679940_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873535_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873530_SP_P-RF-CB      -aa------c------gag------gcaggacccctagaagaagaactcc
KU679958_SP_P-RF-CB      -aa------c------gag------gcaggtccactagaagaagaactcc
KU679954_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaaraagaactcc
KU679939_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU679956_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU679943_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873527_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU679942_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873521_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU679955_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU679950_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU679948_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU679946_SP_P-RF-BC      -ga------c------gag------gcaggtcccctaraagaagaactcc
KF873523_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873522_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU679941_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873524_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU679953_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873511_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873513_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873515_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873517_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873518_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873519_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU679944_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873534_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873531_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873532_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873533_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF873537_SP_P-RF-CB      -ga------m------gag------gcaggtcccctagaagaagaactcc
KU679945_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KF873538_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KF873542_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KF873543_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KF873540_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KJ586803_SP_P-RF-AF      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ161788_SP_P-RF-AE      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ161753_SP_P-RF-AE      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ161837_SP_P-RF-AE      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ161838_SP_P-RF-AE      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ161767_SP_P-RF-AE      -ga------a------gag------gcaggtcccctagaagaagaactcc
HF571060_SP_P-RF-AE      -ga------a------gag------gcaggtcccctagaagaagaactcc
MG826151_SP_P-RF-BC      -ga------c------gag------gcaggtcccctcgaagaagaactcc
MK534665_SP_P-RF-CB      -aa------c------ggg------gcaggacccctagaagaagaactcc
HQ684849_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF053188_SP_P-RF-CB      -ga------a------gat------gcaggtcccctagaagaagaactcc
KJ803782_SP_P-RF-CB      -ga------a------gat------gcaggtcccctagaagaagaactcc
KF053186_SP_P-RF-BC      -ga------c------gag------gcaggtccactagaagaagaactcc
KJ803778_SP_P-RF-BC      -ga------c------gag------gcaggtccactagaagaagaactcc
KJ717814_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KJ803802_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
MT645045_SP_P-RF-BC      -ga------a------gga------gcaggtcccctagaagaagaactcc
KX096713_SP_P-RF-CA      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB241109_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534615_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534725_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534713_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534632_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534706_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KJ717815_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KJ803803_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534735_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ717816_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534613_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534724_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534717_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK052970_SP_P-RF-BD      -ga------a------gag------gcaggtcccctagaagaagaactcc
MH746811_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MG826145_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaaaaagaactcc
MH746812_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MH746813_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaaaaagaactcc
MK534590_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534700_SP_P-RF-BC      -ga------c------gag------gcaggacccctagaagaagaactcc
KC315400_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
MG826150_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
EU882006_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534730_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534701_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ410497_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ377595_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534716_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534695_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534630_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534681_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534722_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534721_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534686_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534668_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534641_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534635_SP_P-RF-BC      -ga------c------gat------gcaggtcccctagaagaagaactcc
MK534620_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534714_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534637_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534653_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534734_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534718_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534587_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377635_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU939631_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534594_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534728_SP_P-RF-BC      -ga------a------ggc------gcaggtcccctagaagaagaactcc
MK534715_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534583_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534582_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU660227_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534607_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534609_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534616_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534684_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534648_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534566_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KX774505_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534726_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534589_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377630_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534561_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534577_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534610_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT645056_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU939629_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774178_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774364_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MH094410_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534559_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
JQ801477_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534606_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534729_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534712_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534690_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534660_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534646_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534617_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534618_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534568_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534563_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534555_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK052968_SP_P-RF-BD      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK052967_SP_P-RF-BD      -ga------a------gag------gcaggtcccctagaagaagaactcc
KP148337_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534562_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534584_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534623_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534654_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534655_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534662_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534664_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534670_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534672_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534675_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534687_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534688_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534689_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534723_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534736_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
EU939627_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534556_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534558_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534564_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534567_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534569_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534579_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534580_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534598_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534625_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534633_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534639_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534651_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534685_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534731_SP_P-RF-BC      -ga------a------gag------gcaggtcccctagaagaagaactcc
KC774414_SP_P-RF-BC      -ga------a------aag------gcaggtcccctagaagaagaactcc
KY470865_SP_P-RF-GC      -aa------c------gag------gcaggtgccctggaagaagaactcc
KY470858_SP_P-RF-GC      -ga------c------gag------gcaggtgccctggaagaagaactcc
KY470871_SP_P-RF-GC      -ga------c------gag------gcaggtgccctggaagaagaactcc
MZ439768_SP_P-RF-GC      -ca------c------gag------gcaggtcccctagaagaagaactcc
MZ439798_SP_P-RF-GC      -ca------c------gag------gcaggtcccctagaagaagaactcc
EU835240_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
MH368022_SP_P-RF-GC      -gt------c------gag------gcaggtcccctagaagaagaactcc
KP148442_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ882612_SP_P-RF-GC      -ca------c------gag------gcaggtcccttagaagaagaactcc
FJ882618_SP_P-RF-GC      -ca------c------gag------gcaggtcccttagaagaagaactcc
FJ882617_SP_P-RF-GC      -ca------c------gag------gcaggtcccytagaagaagaactcc
FJ882611_SP_P-RF-GC      -gc------c------gag------gcaggtcccctagaagaagaactcc
FJ882613_SP_P-RF-GC      -ca------c------gag------gcaggtcctctagaagaagaactcc
FJ023665_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF214680_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ882610_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ882614_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU833891_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ023664_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ023667_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ023668_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ023670_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ023673_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ023666_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY470996_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY470999_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY471000_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY471002_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY470998_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY471001_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY470997_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY471004_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FR714490_SP_P-RF-GB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ023662_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ023659_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC172106_SP_P-RF-GB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY471003_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY471005_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY471006_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY471007_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KP148441_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KP148449_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KP148586_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KP148447_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KP148450_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KX765835_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF440021_SP_P-RF-AG      -gacgggacc------gag------gcaggtcccctagaagaagaactcc
EU833890_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
KF219922_SP_P-RF-GH      -ra------m------gag------gcaggkcccctmgaagaagaactcc
EU833889_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
EF464099_SP_P-RF-AG      -ga------a------gag------gcaggtcccctcgaagaagaactcc
KP274926_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
AB933279_SP_P-RF-AG      -ga------a------gag------gcaggtcccctcgaagaagaactcc
AB933280_SP_P-RF-AG      -ga------a------gag------gcaggtcccctcgaagaagaactcc
AB933281_SP_P-RF-AG      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707463_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707465_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707426_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707459_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707474_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707468_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcggagaagaactcc
JQ707456_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707457_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707458_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707460_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707461_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707462_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707464_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707466_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707469_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707470_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707471_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707472_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707432_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707421_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707430_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707441_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707445_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707448_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707450_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707467_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707473_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707475_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
JQ707424_SP_P-RF-GA      -ga------a------gag------gcaggtcccctcgaagaagaactcc
FJ361772_SP_P-RF-GC      -ga------c------gag------gcaggtcccctagaagaagaactcc
JQ272886_SP_P-RF-GF      -ga------c------gag------gcaggtcccctcgaagaagaactcc
JQ272887_SP_P-RF-GF      -ga------c------gag------gcaggtcccctcgaagaagaactcc
HE981179_SP_P-RF-FG      -ga------c------gag------gcaggtcccctagaagaagaactcc
HE981180_SP_P-RF-GF      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534663_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534669_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AF297620_SP_P-RF-DA      -gacgggacc------gag------gcaggtcccctagaagaagaactcc
EF103284_SP_P-RF-AD      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY236161_SP_P-RF-DA      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB194949_SP_P-RF-AE      -gacgggacc------gag------gcaggtcccctagaagaagaactcc
JF439776_SP_P-RF-AG      -gacgggacc------gag------gcaggtcccctcgaagaagaactcc
EU185780_SP_P-RF-AD      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC012653_SP_P-RF-AD      -ga------c------gag------gcaggtcccctagaagaagaactcc
AF297619_SP_P-RF-DA      -gacgggacc------gag------gcaggtcccctagaagaagaactcc
AB933283_SP_P-RF-AG      -gacsggacc------gas------gcaggtcccctagaagaagaactcc
JF440019_SP_P-RF-AG      -ga------a------gag------gcaggtcccctagaagaagaactcc
AB222708_SP_P-RF-AD      -gacgggacc------gag------gcaggtcccctagaagaagaactcc
JF440022_SP_P-RF-AG      -gacgggacc------gag------gcaggtcccctagaagaagaactcc
MF925386_SP_P-RF-AC      -gacgggacc------gag------tcaggtcccctagaagaagaactcc
AB453985_SP_P-RF-AC      -gacgggacc------gag------gcaggtcccctagaagaagaactcc
AB933282_SP_P-RF-AG      -gacgggacc------gag------gcaggtcccctagaagaagaactcc
GQ331048_SP_P-RF-AE      -gaagggacc------gag------gtaggtcccctagaagaagaactcc
AY161140_SP_P-RF-AD      -gtcgagacc------gag------gcaggttccctagaagaagaactcc
AY161141_SP_P-RF-AD      -gtcgagacc------gag------gcaggttccctagaagaagaactcc
HM146131_SP_P-RF-AD      -gacgaggcc------gag------gtaggtcccctagaaggagaactcc
AY161147_SP_P-RF-DA      -gacgagacc------gag------gcaggtcccctagaagaagaactcc
EF103283_SP_P-RF-AD      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY161145_SP_P-RF-AD      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY161146_SP_P-RF-AD      -ga------c------gag------gcaggtcccctagaagaagaactcc
EF103282_SP_P-RF-AD      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF214656_SP_P-RF-AC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ586810_SP_P-RF-AF      -gacgagacc------gag------gcaggtcccctagaagaagaactcc
AY233277_SP_P-RF-AC      -gacgagacc------gag------gcaggtcccctagaagaagaactcc
MF925404_SP_P-RF-AC      -gacgagacc------gag------gcaggtcccctagaagaagaactcc
MF488705_SP_P-RF-AD      -gacgagacc------gag------gtaggtcccctagaagaagaactcc
MT426089_SP_P-RF-AB      -gacgagacc------gag------gtaggtcccctagaagaagaactcc
KF053166_SP_P-RF-BC      -ca------c------gga------gcaggacccctagaagaagaactcc
KJ803827_SP_P-RF-BC      -ca------c------gga------gcaggacccctagaagaagaactcc
KC774323_SP_P-RF-CB      -ga------c------gag------gcaggtcccataggcgcgttactcc
EF494378_SP_P-RF-CA      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ803822_SP_P-RF-CB      -ga------c------gag------gcaggacccctagaagaagaactcc
HQ700518_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700520_SP_P-RF-CB      -aa------c------gag------gcaggtcctctagaagaagaactcc
GQ377592_SP_P-RF-CB      -ga------a------ggg------gcaggtcccctagaagaagaactcc
HQ700580_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF436919_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU787444_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ386643_SP_P-RF-CB      -ga------c------gag------gcaggacccctagaagaagaactcc
EU916228_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU717211_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JQ040146_SP_P-RF-CB      -ga------c------gag------gcaggacccctagaagaagaactcc
EU589337_SP_P-RF-CB      -ac------c------ggg------gcaggacccctagaagaagaactcc
FJ562227_SP_P-RF-CB      -gt------c------gag------gcaggtccgctagaagaagaactcc
DQ089798_SP_P-RF-CB      -aa------c------gag------gcaggtcccctagaagaagaactcc
MG826144_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963862_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KR013843_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ173350_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ173325_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377604_SP_P-RF-CB      -aa------a------gat------gcaggcaccctagaagaagaactcc
EU939632_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
EU939577_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaataactcc
AF411409_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT645039_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KU963930_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963931_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963932_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963933_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963934_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963935_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963936_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963938_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963939_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963940_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963941_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963942_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963943_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963944_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377556_SP_P-RF-CB      -ga------a------gga------gcaggtcccctagaagaagaactcc
Y18856_SP_P-RF-CB        -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377539_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF828938_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF828933_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF828934_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF828936_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF828935_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426455_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX661486_SP_P-RF-CB      -ga------c------gag------gcaggacccctagaagaagaactcc
JQ732168_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JF436922_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GU357843_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ562302_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ562277_SP_P-RF-CB      -ga------c------gat------gcaggtcccctagaagaagaactcc
EU939565_SP_P-RF-CB      -ga------c------gat------gcaggtcccctagaagaagaactcc
AP011108_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HM750133_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU939606_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ173320_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ173322_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU919166_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU919167_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JQ040142_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JQ040148_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX661485_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MG893554_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MG893555_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377548_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EF494376_SP_P-RF-CA      -gacgggacc------gag------gcaggtcccctagaagaagaactcc
FJ386635_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MG893561_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT645069_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT645048_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426524_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK321265_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK720627_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK720628_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426456_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426467_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426485_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426527_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426541_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426557_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
LC458432_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964313_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KR013806_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KM875422_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ173329_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ173330_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ173299_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ173300_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774344_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774317_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774322_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774305_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774234_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774183_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774186_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774230_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX661487_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GU385774_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377522_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774222_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377520_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377534_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ715345_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ715346_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ715347_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ562336_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ562287_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ562247_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ386593_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ386578_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU939630_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
EU939551_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU872014_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY040627_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AF461361_SP_P-RF-CB      -ga------c------gag------gcaggacccctagaagaagaactcc
AB670303_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB198084_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU916232_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964005_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964006_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964007_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964008_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964009_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964010_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964303_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964304_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964305_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964306_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964307_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964308_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964309_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964310_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964311_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964312_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964314_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964315_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964316_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964317_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871997_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU872015_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ386581_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ386585_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ562305_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ562314_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ715385_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ715387_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ715411_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ715412_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ715413_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ715414_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377516_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377544_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JQ040130_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JX026887_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774263_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774294_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774332_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774341_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ173326_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ173349_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963883_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963990_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963991_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963993_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963994_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963995_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963998_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963999_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964001_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964003_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY470893_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY881840_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
LC279263_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
LC279264_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
LC279265_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
LC279266_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
LC279267_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MG893559_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT645029_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT645035_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU916239_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU916240_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU916241_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774246_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963856_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963857_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963858_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963859_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963860_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963861_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963863_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963864_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963865_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963866_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963867_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963868_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963869_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU963870_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ562223_SP_P-RF-CD      -ga------c------gag------gcaggtcccctagaagaagaactcc
FR714496_SP_P-RF-CB      -ga------c------gag------gcaggacccctagaagaagaactcc
JX504540_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF925382_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534719_SP_P-RF-CB      -ca------c------gag------gcaggtcccctagaagaagaactcc
FJ386674_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY363272_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY363273_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ803785_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377627_SP_P-RF-CD      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU881995_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ717794_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ803788_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF925389_SP_P-RF-DC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ803798_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ684848_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
AB367393_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700527_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700528_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB493842_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AP011102_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB493840_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AP011103_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB493838_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB493847_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB105172_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB493837_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ358155_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ358156_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700554_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU939547_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU589339_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU695741_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU695743_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700505_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KU695744_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KU695746_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ562317_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ386586_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700519_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700521_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY363262_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KY363263_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426471_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426546_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426544_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426540_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426539_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426491_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426463_SP_P-RF-CB      -ga------c------gcg------gcaggtcccctagaagaagaactcc
MT426547_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426563_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426504_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426489_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426488_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426496_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426549_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426572_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426483_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426481_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426478_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426473_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426469_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426464_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426462_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426461_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426470_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426475_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426476_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426477_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426492_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426503_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426510_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426535_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426457_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426459_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426479_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426486_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426487_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426507_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426460_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426562_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426553_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426550_SP_P-RF-CB      -aa------c------gag------gcaggtcccctagaagaagaactcc
MT426545_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426537_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426573_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426533_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426531_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426534_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426526_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426523_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426522_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426509_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426501_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426500_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426543_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426559_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426494_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426480_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426472_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426468_SP_P-RF-CB      -ga------c------gag------gcaggtcctctagaagaagaactcc
MT426465_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426532_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426466_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426482_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426484_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426490_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426493_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426495_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426497_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426498_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426502_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426505_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426506_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426508_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426511_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426512_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426513_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426514_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426515_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426517_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426518_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426519_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426520_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426521_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426525_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426528_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426529_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426530_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426536_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426538_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426542_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426551_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426554_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426555_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426556_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426558_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426560_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426561_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426564_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426565_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426566_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426567_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426568_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426569_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426570_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426571_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426574_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426575_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT426576_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700530_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
HQ700523_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700531_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700532_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ598675_SP_P-RF-CB      -aa------c------gac------gcaggtcccctagaagaagaactcc
MG826148_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MG826146_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
MG826147_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
HQ700507_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
HQ700508_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
HQ700509_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
HQ700515_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
X75656_SP_P-RF-CB        -gt------c------gag------gcaggtcccctagaagaagaactcc
KU695745_SP_P-RF-CB      -aa------c------gag------gcaggtaccctagaagaagaactcc
HQ700542_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700560_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700557_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
HQ700485_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700462_SP_P-RF-CB      -ga------c------gag------gcaggwcccctagaagaagaactcc
HQ700498_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700499_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MG826141_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KT003704_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KR013948_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JQ027310_SP_P-RF-CB      -ga------m------gag------gcaggtcccctagaagaagaactcc
JF436923_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ032343_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
EU939620_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
AY206374_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700526_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ562294_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU939668_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU939623_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
AB033557_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AF233236_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534560_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
MK534574_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
AB367400_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774212_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
Y18857_SP_P-RF-CB        -ga------c------gag------gcaggtcccctagaagaagaactcc
MW887645_SP_P-RF-CD      -ga------c------gag------gcaggtccactagaagaagaactcc
MT426499_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MG826149_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MG826142_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
MF925381_SP_P-RF-CB      -aa------c------gag------gcaggtcccctagaagaagaactcc
LC416040_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU695742_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KP148352_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ717832_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ410520_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF053179_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ803772_SP_P-RF-BC      -ga------c------gag------gcaggtcccctagaagaagaactcc
KF053160_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ803753_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774349_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774188_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JQ040174_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ475335_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377607_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377573_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ562328_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ562271_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ562226_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ386649_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ787446_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ787480_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU939621_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
AP011104_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AP011105_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB205152_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
AB049609_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377602_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
AB367800_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB367419_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ386633_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ562267_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT645071_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU939581_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871999_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871995_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871994_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AF330110_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB642096_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871981_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871983_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871984_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871985_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871986_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871987_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871988_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871989_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871990_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871991_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871992_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871993_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU871996_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU939589_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ715384_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
M38454_SP_P-RF-CB        -gannnnnnc------gag------gcaggtcccctagaagaagaactcc
AB300369_SP_P-RF-CB      -ga------c------gag------gtaggtcccctagaagaagaactcc
KC774198_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774201_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377560_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774193_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774291_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774307_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB195956_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB195957_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB195939_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB195940_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB195941_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KM213033_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ032337_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
AB014375_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JN400086_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB195955_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY167095_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534679_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MZ439673_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377581_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377564_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ377565_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ377590_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ377596_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ377614_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
AB195950_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AB195951_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
HQ700547_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KU964351_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KR013816_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774324_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JQ801476_SP_P-RF-CG      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ924618_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ410506_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KJ803804_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MF925370_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534682_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MT645015_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377633_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
GQ377626_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ377549_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
JX661498_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
EU939602_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
FJ386646_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
EU522070_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY123424_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MW887644_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
AY247030_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
JQ707714_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774258_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
KC774328_SP_P-RF-CB      -ga------c------gag------gcaggtcccctagaagaagaactcc
MK534585_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KJ173358_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KJ173279_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ377613_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ377611_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
FJ562229_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ377594_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
GQ377634_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
JX429896_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
JX661494_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
KJ173280_SP_P-RF-CB      -ga------a------gag------gcaggtcccctagaagaagaactcc
                                                     **     *            * 

MF488699_SP_P-RF-DE      ctcgaatcgcagactaacgtctcactcgccgcatcacataagatcacaat
FN594767_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
GQ161806_SP_P-RF-EA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KX357641_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY341335_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
JF440017_SP_P-RF-DA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
JF440013_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440001_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440006_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF439994_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF439995_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF439996_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF439998_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF439999_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440000_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440002_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440003_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440007_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440008_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440009_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440010_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440011_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440012_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440014_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440015_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440004_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440005_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AJ627221_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
MF925396_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ803771_SP_P-RF-DB      ctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctaaat
MZ097814_SP_P-RF-DE      ctcgcctcgcagacgaagatctmaatcgccgcgtcgcagaagatctcaat
JN688717_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
JN257204_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MF925402_SP_P-RF-BD      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN507835_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MF925360_SP_P-RF-DB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
MF925388_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KM524357_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KR905422_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MF925371_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MF925392_SP_P-RF-DB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MF925401_SP_P-RF-DB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KT366503_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN664946_SP_P-RF-DA      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU594406_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
JN642160_SP_P-RF-DE      ctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
X80925_SP_P-RF-DE        ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
JQ687532_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MZ097850_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MT426112_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN664925_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN664935_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaat
KU668440_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN664934_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK541689_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ205379_SP_P-RF-DE      ctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN664933_SP_P-RF-DA      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN664929_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaat
DQ315780_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
DQ315779_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN664940_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KT366505_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK516279_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK516280_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC875339_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN664915_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB033558_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ205377_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ205378_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ205386_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ205387_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC875338_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ586811_SP_P-RF-DF      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MG877711_SP_P-RF-DE      ctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaat
FJ349212_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MW601260_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MZ097740_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX898693_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX898695_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX898696_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX898690_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MF967563_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB210819_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
MT426110_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT426111_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
U95551_SP_P-RF-DE        ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MZ097667_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AJ344117_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX898686_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX898687_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX898688_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT426113_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX898698_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX898699_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MW601296_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MZ097767_SP_P-RF-DE      ctcgcctcgcagacgaaggtctmaatcgccgcgtcgcagaagatctcaat
KT366504_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK618442_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK618440_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK618438_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK618444_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK618445_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB674412_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MW601264_SP_P-RF-DE      ctcacctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaat
MZ097745_SP_P-RF-DE      ctcacctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaat
X68292_SP_P-RF-DA        ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN257154_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MZ097680_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MZ097703_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
X65259_SP_P-RF-DA        ctcgcctgccagaccaaggtctcaatcgccgcgtcgcagaagatctcaat
AB674434_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF754613_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN040803_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MZ097806_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MW601317_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MZ097822_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MF925397_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MF925384_SP_P-RF-DB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KM577666_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK052957_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB674436_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
AB330368_SP_P-RF-DA      ctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaat
MK052969_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN688689_SP_P-RF-DE      ctcgcctcgcagaccagggtctaaatcgccgcgtcgcagaagatctcaat
MZ097652_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
JN688715_SP_P-RF-DE      ctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ349221_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
DQ464167_SP_P-RF-DE      ctcgcctcccagacgaagatctcaatcgccgcgtcccagaagatctaaat
DQ464166_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaat
DQ464164_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgaagaagatctaaat
DQ464165_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaat
MW601241_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
MZ097724_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
MZ097826_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
JN642137_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaat
JN040798_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF679991_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN257216_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MZ097838_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MZ097766_SP_P-RF-DE      ctcgcctcgcagacgaagrtctcaatcgccgcgtcgccgaagatctcaat
KJ647351_SP_P-RF-DE      ctcgcctcgcagaccaaggtctaaatcgccgcgtcgcagaagatctaaat
JN642139_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MW601310_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctaaat
MZ097777_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctaaat
MH464850_SP_P-RF-DA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
AB270538_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MH724240_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KM524337_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
DQ315777_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KM524336_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ647349_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MH464835_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MW601235_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MZ097721_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MH724243_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatctccgcgtcgcagaagatctcaat
MF488702_SP_P-RF-DE      ctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX827302_SP_P-RF-DE      cccgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KM359442_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN664943_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN642127_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN257210_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY233295_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB188243_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MH724239_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GU563560_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY233293_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MH464851_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT210033_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KM386676_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MH724222_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MH464846_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MH464852_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KM577667_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN257191_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MW601230_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MZ097719_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KF471643_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
JN257206_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN257207_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN257189_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF754616_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
AB674432_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MZ097687_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB674433_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN257164_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN257174_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN642152_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK598652_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
MK598653_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
EU594436_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
DQ111987_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
EU594435_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
MK598654_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
MK618439_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
MW601284_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
MZ097758_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
MW601227_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MZ097716_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK598656_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KM577664_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KM577663_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774450_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JN642141_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KM577665_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EF103285_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaat
AB188245_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB583679_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AJ627217_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ183486_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN507850_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY373430_SP_P-RF-DE      ctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KM524359_SP_P-RF-DE      ctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KT366492_SP_P-RF-DE      ctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ647356_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
FN594770_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AM494716_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904444_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904405_SP_P-RF-DE      ctcgcctagcagacgaaggtgtcaatcgccgcgtcgcagaagaactcaat
KP288875_SP_P-RF-DE      ctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ349207_SP_P-RF-DE      ctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904430_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904442_SP_P-RF-DE      ctcgcctcgcagacaaaggtctaaatctccgcgtcgcagaagatctcaat
FJ904416_SP_P-RF-DE      ctcgcctagcagacgaaggtstcaatcgccgcgtcgcagaagatctcaat
FJ904417_SP_P-RF-DE      ctcgcctagcagacgaaggtstcaatcgccgcgtcgcagaagatctcaat
FJ904414_SP_P-RF-DE      ctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaat
FJ904400_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccat
FN594769_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ161754_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KM606751_SP_P-RF-DE      ctcgcctcgcaaacgaaggtctcaatcgccacgtcgcagagaatctcaat
FN594771_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904437_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
DQ991753_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357628_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccat
KU736916_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU711666_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF170740_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GU177079_SP_P-RF-DE      ctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaat
FJ904447_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904404_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
FJ904397_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT591274_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT591275_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357632_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357631_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357626_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU736922_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcaraagatctcaat
KP168421_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KM606741_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904436_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904398_SP_P-RF-DE      ctcgcctcgcagacgaaggtstcaatcgccgcgtcgcagaagatctcaat
KX357636_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904441_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357627_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904406_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904428_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904396_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904401_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT426114_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MH685719_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX827299_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357630_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357629_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357625_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357624_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357623_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357633_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357634_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX357635_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU736915_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU736914_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU736917_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KP995112_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KP168420_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904407_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904403_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904394_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904440_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KM606750_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KP168416_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KP168417_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KP168418_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU736921_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU736923_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT591280_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ904408_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaat
FJ904409_SP_P-RF-DE      ctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaat
FJ904425_SP_P-RF-DE      ctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaat
KY470845_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470848_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470851_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470852_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470853_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK052976_SP_P-RF-BD      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MF618346_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ470898_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KY470844_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470854_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470843_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470846_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470847_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470849_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470850_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470855_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470856_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX660685_SP_P-RF-DC      ctcgcctcgcagacaaaggtctcaatcgccgcgtcgcgaaagatctcgat
MN683641_SP_P-RF-DC      ctcgcctcgcagacaaaggtctcaatcgccgcgtcgcgaaagatctcgat
MN683662_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683620_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF917451_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683588_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT645062_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774431_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT645070_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683657_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683634_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY670781_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX660680_SP_P-RF-DC      ctcgccwcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774442_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF491455_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY862865_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683626_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774449_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683655_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683627_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683624_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683625_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683643_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683644_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683645_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683647_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683649_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683609_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683592_SP_P-RF-DC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MN683594_SP_P-RF-DC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MN683590_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KP276254_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KP276255_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774463_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX429898_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774434_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774472_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774489_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774497_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774499_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683597_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683630_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683632_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683635_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683651_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683652_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683653_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683654_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683659_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683660_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683661_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683663_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683683_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT645065_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN657317_SP_P-RF-DC      ctcg------agacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT645067_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683656_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683611_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683581_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX660682_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774488_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774493_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774481_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774458_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774447_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774452_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF491451_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
DQ478886_SP_P-RF-DC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
AY862866_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY862864_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB270535_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY800249_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY817515_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU787434_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF491449_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774420_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774422_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774426_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774435_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774439_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774443_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774453_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774455_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774457_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774470_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774474_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774475_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774476_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774483_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774484_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774495_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774498_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX660674_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX660675_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683574_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683579_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683603_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683605_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683607_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683610_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683613_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683614_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683615_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683619_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683623_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683639_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683650_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683664_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683665_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683666_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HQ700494_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700493_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
J02202_SP_P-RF-DE        ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700536_SP_P-RF-DE      ctcgcctcgcakacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700579_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700585_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700541_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MH481859_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700582_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700535_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700534_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700533_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700503_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700492_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagaactcaat
AB033559_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700497_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700500_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700501_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700524_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700525_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700537_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700538_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700539_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700581_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700583_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700584_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HQ700540_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
FJ692536_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KF779353_SP_P-RF-DA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MH481860_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
AB048702_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
AB048703_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MH481858_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MH481861_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MH481862_SP_P-RF-DE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KJ470897_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964366_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964370_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964372_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964374_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964379_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964380_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964367_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683712_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683618_SP_P-RF-DC      ctcgcctcgcagaccaaggtctcaatcgccgcgtcgcagaagatctcaat
KF192841_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MF618347_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF192833_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF192835_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF192836_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF192837_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF192838_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF192839_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF192840_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ470887_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ470884_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ470886_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ470888_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ470890_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ470891_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ470892_SP_P-RF-DE      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683722_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683675_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774487_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
AY817509_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX660689_SP_P-RF-DC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MN683711_SP_P-RF-DC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KC774478_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774480_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683730_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ562263_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KT991424_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KT991427_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683718_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683673_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683622_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX660686_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683707_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX660684_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaat
MN683706_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaat
KT991421_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774454_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
DQ478889_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccacgtcgcagaagatctcaat
AY817513_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN650079_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683700_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683582_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HM750144_SP_P-RF-DC      ctcgcctcgcagacgaaggtcccaatcgccgcgtcgcagaagatctcaat
MN650069_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683612_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774468_SP_P-RF-DC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KC774430_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU787435_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY817512_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
DQ478898_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774428_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774492_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774494_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683616_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683725_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683721_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683699_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683703_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683688_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683680_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683697_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683677_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683628_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683571_SP_P-RF-DC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MN650087_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683687_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN650083_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN650076_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN650072_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN650073_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN650074_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN650075_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN650077_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN650078_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN650085_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN650086_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683723_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN650068_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY629632_SP_P-RF-DC      ctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KP276253_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774486_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774485_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774482_SP_P-RF-DC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KC774448_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF491456_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF491448_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HM750147_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HM750148_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683694_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ562278_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774466_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774479_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KT991417_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KT991420_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KT991423_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683621_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ349241_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683686_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683693_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683724_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
DQ478890_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY817510_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB674504_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
DQ478887_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
DQ478892_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
DQ478897_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774423_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774424_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774425_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774432_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774433_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774461_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774471_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774490_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KT991419_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU519422_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU519423_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX660677_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN657315_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN657316_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683572_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683584_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683586_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683596_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683617_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683636_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683637_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683638_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683640_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683642_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683658_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683668_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683669_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683670_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683671_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683672_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683674_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683679_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683684_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683685_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683713_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683714_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683717_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT645049_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT645060_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT645063_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT645066_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY057948_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY817511_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HM750142_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HM750143_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HM750145_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HM750146_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HM750149_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HM750150_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774456_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KP276256_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX354997_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN650080_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN650081_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN650082_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN650084_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683580_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683587_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683676_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683678_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683689_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683690_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683691_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683692_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683695_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683696_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683715_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683716_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683719_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MN683720_SP_P-RF-DC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB031265_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JQ040175_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ717800_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcttggcagaagatctcaat
KJ803791_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcttggcagaagatctcaat
KU679952_SP_P-RF-CB      ctcgcctcgcaracgaaggtctcaatcgccgcgtcgcaraagatctcaat
KU679940_SP_P-RF-CB      ctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF873535_SP_P-RF-CB      ctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF873530_SP_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KU679958_SP_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KU679954_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcaraagatctcaat
KU679939_SP_P-RF-CB      ctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU679956_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU679943_SP_P-RF-BC      ctcgcctcgcaracgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF873527_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU679942_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF873521_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU679955_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU679950_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
KU679948_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctmaat
KU679946_SP_P-RF-BC      ctcgcctcgcaracgaaggtctcaatcgccgcgtcgccgaagatctcaat
KF873523_SP_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KF873522_SP_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KU679941_SP_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KF873524_SP_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KU679953_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
KF873511_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
KF873513_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
KF873515_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
KF873517_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
KF873518_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
KF873519_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
KU679944_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
KF873534_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF873531_SP_P-RF-CB      ctcgcctcgcagacgaargtctcaatcgccgcgtcgcagaagatctcaat
KF873532_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF873533_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF873537_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU679945_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF873538_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF873542_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF873543_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF873540_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ586803_SP_P-RF-AF      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ161788_SP_P-RF-AE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
GQ161753_SP_P-RF-AE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
GQ161837_SP_P-RF-AE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
GQ161838_SP_P-RF-AE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
GQ161767_SP_P-RF-AE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
HF571060_SP_P-RF-AE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MG826151_SP_P-RF-BC      ctcccctggcagaggaaggtttcaatcgccgcgtcgcagaagatctcaat
MK534665_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HQ684849_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF053188_SP_P-RF-CB      ctcgcctcgcagacgaaggactcaatcgccgcgtcgcagacgatctcaat
KJ803782_SP_P-RF-CB      ctcgcctcgcagacgaaggactcaatcgccgcgtcgcagacgatctcaat
KF053186_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ803778_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ717814_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcttcgcagaagatctcaat
KJ803802_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcttcgcagaagatctcaat
MT645045_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX096713_SP_P-RF-CA      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB241109_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534615_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534725_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534713_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534632_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534706_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ717815_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ803803_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534735_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ717816_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534613_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534724_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534717_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK052970_SP_P-RF-BD      ctcgcctcgcagacaaaggtctcaatcgccgcgtcacaaaagatctcaat
MH746811_SP_P-RF-BC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MG826145_SP_P-RF-BC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MH746812_SP_P-RF-BC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MH746813_SP_P-RF-BC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MK534590_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgttgcagaagatctcaat
MK534700_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC315400_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MG826150_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU882006_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534730_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534701_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ410497_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377595_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534716_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534695_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534630_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534681_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534722_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534721_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534686_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534668_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534641_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534635_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534620_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534714_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534637_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534653_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534734_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaat
MK534718_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534587_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377635_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU939631_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534594_SP_P-RF-BC      ctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534728_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534715_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
MK534583_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaat
MK534582_SP_P-RF-BC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
EU660227_SP_P-RF-BC      ctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534607_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534609_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534616_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534684_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534648_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaat
MK534566_SP_P-RF-BC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KX774505_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534726_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534589_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaat
GQ377630_SP_P-RF-BC      ctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534561_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534577_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534610_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT645056_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU939629_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774178_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774364_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MH094410_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534559_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JQ801477_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534606_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534729_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534712_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
MK534690_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534660_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534646_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534617_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534618_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534568_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534563_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534555_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK052968_SP_P-RF-BD      ctcgccccgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK052967_SP_P-RF-BD      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KP148337_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534562_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534584_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534623_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534654_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534655_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534662_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534664_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534670_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534672_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534675_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534687_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534688_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534689_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534723_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534736_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU939627_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534556_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534558_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534564_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534567_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534569_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534579_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534580_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534598_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534625_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534633_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534639_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534651_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534685_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK534731_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774414_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470865_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470858_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470871_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MZ439768_SP_P-RF-GC      ctcgcctcgcagacgaagatctaaatcgccgcgtcgcagaggatctcaat
MZ439798_SP_P-RF-GC      ctcgcctcgcagacgaagatctaaatcgccgcgtcgcagaggatctcaat
EU835240_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MH368022_SP_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaat
KP148442_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ882612_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ882618_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ882617_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ882611_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ882613_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ023665_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF214680_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ882610_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ882614_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU833891_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ023664_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ023667_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ023668_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ023670_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ023673_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ023666_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470996_SP_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KY470999_SP_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KY471000_SP_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KY471002_SP_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KY470998_SP_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KY471001_SP_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KY470997_SP_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KY471004_SP_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
FR714490_SP_P-RF-GB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
FJ023662_SP_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
FJ023659_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC172106_SP_P-RF-GB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KY471003_SP_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KY471005_SP_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KY471006_SP_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KY471007_SP_P-RF-GC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KP148441_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcggaagatctcaat
KP148449_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagagctcaat
KP148586_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KP148447_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KP148450_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KX765835_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF440021_SP_P-RF-AG      ctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaat
EU833890_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
KF219922_SP_P-RF-GH      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
EU833889_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
EF464099_SP_P-RF-AG      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
KP274926_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
AB933279_SP_P-RF-AG      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
AB933280_SP_P-RF-AG      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
AB933281_SP_P-RF-AG      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707463_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707465_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707426_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707459_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707474_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707468_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707456_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707457_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707458_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707460_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707461_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707462_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707464_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707466_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707469_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707470_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707471_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707472_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707432_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707421_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707430_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707441_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707445_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707448_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707450_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707467_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707473_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707475_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
JQ707424_SP_P-RF-GA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
FJ361772_SP_P-RF-GC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JQ272886_SP_P-RF-GF      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JQ272887_SP_P-RF-GF      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HE981179_SP_P-RF-FG      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HE981180_SP_P-RF-GF      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
MK534663_SP_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MK534669_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AF297620_SP_P-RF-DA      ctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaat
EF103284_SP_P-RF-AD      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY236161_SP_P-RF-DA      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB194949_SP_P-RF-AE      ctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaat
JF439776_SP_P-RF-AG      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcat
EU185780_SP_P-RF-AD      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC012653_SP_P-RF-AD      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AF297619_SP_P-RF-DA      ctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaat
AB933283_SP_P-RF-AG      ctcgcctcgcagacgcagatctcaatcgccgcgtcgcasaagatctcaat
JF440019_SP_P-RF-AG      ctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaat
AB222708_SP_P-RF-AD      ctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaat
JF440022_SP_P-RF-AG      ctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaat
MF925386_SP_P-RF-AC      ctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaat
AB453985_SP_P-RF-AC      ctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaat
AB933282_SP_P-RF-AG      ctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaat
GQ331048_SP_P-RF-AE      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
AY161140_SP_P-RF-AD      ctcgcctcgcagacgaagatctcaatcgccgcttcgcagaagatctcaat
AY161141_SP_P-RF-AD      ctcgcctcgcagacgaagatctcaatcgccgcttcgcagaagatctcaat
HM146131_SP_P-RF-AD      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
AY161147_SP_P-RF-DA      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
EF103283_SP_P-RF-AD      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
AY161145_SP_P-RF-AD      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY161146_SP_P-RF-AD      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EF103282_SP_P-RF-AD      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KF214656_SP_P-RF-AC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KJ586810_SP_P-RF-AF      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
AY233277_SP_P-RF-AC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MF925404_SP_P-RF-AC      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MF488705_SP_P-RF-AD      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
MT426089_SP_P-RF-AB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KF053166_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ803827_SP_P-RF-BC      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774323_SP_P-RF-CB      ctcgcctcgcagacgagaagaccaattgccgcgtcccagaagatctcaat
EF494378_SP_P-RF-CA      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaagt
KJ803822_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HQ700518_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HQ700520_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagcagatctcaat
GQ377592_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
HQ700580_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagamgatctcagt
JF436919_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaat
EU787444_SP_P-RF-CB      ctcgcctcttgcacgaaggtctccttcgccgagacgaaaaagatctcaat
FJ386643_SP_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
EU916228_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
EU717211_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JQ040146_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU589337_SP_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
FJ562227_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
DQ089798_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MG826144_SP_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KU963862_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KR013843_SP_P-RF-CB      ctcgcctcgcggacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ173350_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ173325_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377604_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU939632_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU939577_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaag
AF411409_SP_P-RF-CB      ctcgcctcgcagacgaaggactcaatcgccgcgtcgcagaagatctcaat
MT645039_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963930_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaat
KU963931_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaat
KU963932_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaat
KU963933_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaat
KU963934_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaat
KU963935_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaat
KU963936_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaat
KU963938_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaat
KU963939_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaat
KU963940_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaat
KU963941_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaat
KU963942_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaat
KU963943_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaat
KU963944_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaat
GQ377556_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
Y18856_SP_P-RF-CB        ctcgcctcgcagacgaaggtctcaatccgcgcgtcgcagaagatctcaat
GQ377539_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JF828938_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
JF828933_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
JF828934_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
JF828936_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
JF828935_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
MT426455_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX661486_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JQ732168_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatctccgcgtcgcagaagatctcaat
JF436922_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GU357843_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ562302_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ562277_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU939565_SP_P-RF-CB      ctcgcctcgcagactaaggtctcaatcgccgcgtcgccgaagatctcaat
AP011108_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaat
HM750133_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU939606_SP_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KJ173320_SP_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
KJ173322_SP_P-RF-CB      ctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaat
EU919166_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU919167_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JQ040142_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaat
JQ040148_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX661485_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MG893554_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MG893555_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377548_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EF494376_SP_P-RF-CA      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ386635_SP_P-RF-CB      ctcgcctcgcagacgaagatctaaatcgccgcgtcgcagaagatctcaat
MG893561_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT645069_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT645048_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT426524_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK321265_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK720627_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MK720628_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT426456_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT426467_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT426485_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT426527_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT426541_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT426557_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
LC458432_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964313_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KR013806_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KM875422_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ173329_SP_P-RF-CB      ctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ173330_SP_P-RF-CB      ctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ173299_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ173300_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774344_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774317_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774322_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774305_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774234_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774183_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774186_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774230_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX661487_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GU385774_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377522_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774222_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377520_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
GQ377534_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaat
FJ715345_SP_P-RF-CB      ctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ715346_SP_P-RF-CB      ctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ715347_SP_P-RF-CB      ctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ562336_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ562287_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ562247_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ386593_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ386578_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU939630_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU939551_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaat
EU872014_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AY040627_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AF461361_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB670303_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
AB198084_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU916232_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964005_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964006_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964007_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964008_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964009_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964010_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964303_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964304_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964305_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964306_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964307_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964308_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964309_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964310_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964311_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964312_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964314_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964315_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964316_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964317_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU871997_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU872015_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ386581_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ386585_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ562305_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ562314_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ715385_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ715387_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ715411_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ715412_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ715413_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
FJ715414_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377516_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
GQ377544_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JQ040130_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
JX026887_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774263_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774294_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774332_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KC774341_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ173326_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KJ173349_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963883_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963990_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963991_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963993_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963994_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963995_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963998_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU963999_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964001_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KU964003_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY470893_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
KY881840_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
LC279263_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
LC279264_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
LC279265_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
LC279266_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
LC279267_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MG893559_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT645029_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
MT645035_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU916239_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaat
EU916240_SP_P-RF-CB      ctcgcctcgcagacgaaggtctcaa