HBVdb

Dataset for nucleotide sequence S of genotype RF

[Download (right click)] [Edit] [Sequences] [Repertoires]

1514 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


KJ803822_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccccgatcgtgttacaggc
KU679958_S_P-RF-CB      atggagagcacamyatyaggattcctaggacccctgctcgtgttacaggc
KU679950_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU679956_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KU679954_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KF873527_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU679942_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KU679943_S_P-RF-BC      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KU679948_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU679944_S_P-RF-BC      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KF873523_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KF873521_S_P-RF-BC      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU679955_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KF873524_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KF873522_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KU679941_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KF873517_S_P-RF-BC      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KF873518_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU679946_S_P-RF-BC      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KF873515_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KF873519_S_P-RF-CB      atggagaacacaccatcaggattcctaggacccctgctcgtgttacaggc
KU679953_S_P-RF-BC      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KF873511_S_P-RF-CB      atggagaacacaacatcaggattcctaggaccccttctcgtgttacaggc
KF873513_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU679952_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KF873535_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KF873530_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU679939_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU679940_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KF873531_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KF873532_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KF873533_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KF873534_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KF873540_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KF873537_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KF873538_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KF873542_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KF873543_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU679945_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
JF436923_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
KX777355_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
GU357843_S_P-RF-CB      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggc
FJ386674_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
KX777261_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
HE652157_S_P-RF-BC      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
KF053179_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
KJ803772_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
KX777382_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
KX777386_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
FR822117_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
FR821810_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
FR821925_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
HE652175_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
EU939631_S_P-RF-BC      atggagagcacaacatcaggattcccaggacccctgctcgtgttacaggc
MK052976_S_P-RF-BD      atggagaacatagcatcaggactcctaggacccctgctcgtgttacaggc
KF053166_S_P-RF-BC      atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggc
KJ803827_S_P-RF-BC      atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggc
KF053186_S_P-RF-BC      atggagaacatcgcatcaggactcctagaacccctgctcgtgttacaggc
KJ803778_S_P-RF-BC      atggagaacatcgcatcaggactcctagaacccctgctcgtgttacaggc
MG826150_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MH746812_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttaccggc
MH746813_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttaccggc
MG826145_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttaccggc
MH746811_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttaccggc
MK534701_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
GQ377595_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtattacaggc
MK534668_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
KX774505_S_P-RF-BC      atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggc
MK534716_S_P-RF-BC      atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggc
MK534730_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534721_S_P-RF-BC      atggagaacatcgcatcaggactcctcggacccctgctcgtgttacaggc
MK534620_S_P-RF-BC      atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggc
MK534714_S_P-RF-BC      atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggc
MK534635_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534722_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534695_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534681_S_P-RF-BC      atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggc
MK534637_S_P-RF-BC      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggc
MK534641_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534653_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534686_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
HQ684849_S_P-RF-BC      atggagaacacagcatcaggactcctaggacccctgctcgtgttacaggc
MG826151_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MT645045_S_P-RF-BC      atggagaacattgcatcaggactcctaggacccctgctcgtgttacaggc
MK534587_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK052967_S_P-RF-BD      atggagaacatagcatcaggactcctaggacccctgctcgtgttacaggc
GQ377635_S_P-RF-BC      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
JQ412091_S_P-RF-BC      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
EU939629_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534660_S_P-RF-BC      atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggc
KC793112_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534712_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MT645056_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534559_S_P-RF-BC      atggagaacatctcatcaggactcctaggacccctgctcgggttacaggc
GU079357_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534630_S_P-RF-BC      atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggc
MK534594_S_P-RF-BC      atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggc
JQ801477_S_P-RF-BC      atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggc
MK534723_S_P-RF-BC      atggagaacaccacatcaggactcctaggacccctgctcgtgttacaggc
MK534734_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK052970_S_P-RF-BD      atggagaacatagcatcaggactcctaggacccctgctcgtgttacaggc
MK534609_S_P-RF-BC      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggc
EU660227_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534616_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MG826358_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
GQ377630_S_P-RF-BC      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MK534718_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534582_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534606_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
KJ410497_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534610_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534728_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534715_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK052968_S_P-RF-BD      atggagaacatagcatcaggactcctaggacccctgctcgtgttacaggc
KC774178_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
KC774364_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
EU939627_S_P-RF-BC      atggagaacatcgcatcaggactccyaggacccctgctcgtgttacaggc
MK534607_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534700_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534648_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534684_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534726_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534690_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534688_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534687_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534689_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534664_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534662_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534623_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534558_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534555_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
KP148337_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534562_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534584_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534590_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534617_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534618_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534654_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534655_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534670_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534672_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534675_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534729_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534569_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534736_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534646_S_P-RF-BC      atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggc
MK534633_S_P-RF-BC      atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggc
MK534731_S_P-RF-BC      atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggc
MK534589_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534579_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
KC774414_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534556_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534561_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534563_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534564_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534566_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534567_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534568_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534577_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534580_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534583_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534598_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534625_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534639_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534651_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MK534685_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
EF494378_S_P-RF-CA      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KX096713_S_P-RF-CA      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
JQ040175_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
AB031265_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
KJ717800_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KJ803791_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
JF436919_S_P-RF-CB      atggagaacacaacatccggattcctaggacccctgctcgtgttacaggc
FJ751342_S_P-RF-CB      aaggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
HQ700518_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
EU882006_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
HQ700519_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgkgttacaggc
HQ700521_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
MK534719_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU695742_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
HQ700505_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU695741_S_P-RF-CB      atggagaataccacatcaggattcctaggacccctgctcgtgttacaggc
KU695743_S_P-RF-CB      atggagaataccacatcaggattcctaggacccctgctcgtgttacaggc
KU695744_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KU695746_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
HQ700542_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
MG826144_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KT003704_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
LC416040_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
AP011104_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
AP011105_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KP148352_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
HQ700580_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
X75656_S_P-RF-CB        atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU695745_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
HQ700560_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
HQ700554_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgygttacaggc
HQ700557_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtattacaggc
HQ700498_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
HQ700499_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
HQ700462_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
HQ700485_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
HQ700507_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
HQ700508_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
AP011108_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
HQ700509_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
HQ700515_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
HQ700527_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
HQ700528_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
HQ700520_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
AP011102_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
HQ700530_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
HQ700532_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
HQ700523_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
HQ700531_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
AB493842_S_P-RF-CB      atggagaacacaacatccggattcctaggacccctgctcgtgttacaggc
AP011103_S_P-RF-CB      atggagaacacaacatccggattcctaggacccctgctcgtgttacaggc
AB105172_S_P-RF-CB      atggagaacacaacatccggattcctaggacccctgctcgtgttacaggc
AB493840_S_P-RF-CB      atggagagcacaacatccggattcctaggacccctgctcgtgttacaggc
AB493838_S_P-RF-CB      atggagagcacaacatccggattcctaggacccctgctcgtgttacaggc
AB493847_S_P-RF-CB      atggagagcacaacatccggattcctaggacccctgctcgtgttacaggc
AB493837_S_P-RF-CB      atggagagcacaacatccggattcctaggacccctgctcgtgttacaggc
GQ358155_S_P-RF-CB      atggagagcacaacatccggattcctaggacccctgctcgtgttacaggc
GQ358156_S_P-RF-CB      atggagagcacaacatccggattcctaggacccctgctcgtgttacaggc
KY302989_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KY361539_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
GU079330_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
MK534615_S_P-RF-BC      atggagagcaccacatcaggattcctaggacccctgctcgcgttacaggc
KC315400_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
HE652142_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
HE652155_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
KJ717815_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
KJ717816_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
KJ803803_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
MK534735_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
MK534632_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
MK534713_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
MK534665_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
MK534725_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
MK534706_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
MK534613_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
MK534717_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
MK534724_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
FR822069_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
HE652156_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
KF053188_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
KJ803782_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
KJ717814_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
KJ803802_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
AB241109_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
GU079399_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ751340_S_P-RF-CB      aaggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ751277_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ751336_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
MH094410_S_P-RF-BC      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
GU079271_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
GU079319_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KJ803785_S_P-RF-CB      atggagagcaccacatcaggattcctcggacccctgctcgtgttacaggc
MF925382_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
MG826141_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgtacagggc
MG826147_S_P-RF-CB      atggagaacacaacatcgggattcctaggacccctgctcgtgttacaggc
KJ598675_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
MG826146_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
MG826148_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
JQ514432_S_P-RF-CD      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
JQ514447_S_P-RF-CD      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
FR714496_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
MK534679_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
KJ803798_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
KF053160_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
KJ803753_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
KJ717832_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
JQ027310_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgcgttacaggc
MT645015_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
MF925381_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
KJ717794_S_P-RF-CB      atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggc
KJ803788_S_P-RF-CB      atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggc
KJ803804_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
GQ924618_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
JQ801476_S_P-RF-CG      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
MF925370_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
KJ410506_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
MK534682_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
MZ439673_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
MK534560_S_P-RF-CB      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
MK534574_S_P-RF-CB      atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggc
JQ040146_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctkctcgtgttacaggc
AB367800_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgggttacaggc
JX036329_S_P-RF-CD      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ562223_S_P-RF-CD      atggagagcatcacatcaggattcctaggacccctgctcgtgttacaggc
JX036358_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KY363272_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KY363273_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
EU589337_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ032343_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
GU079304_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
JX504540_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
GU079476_S_P-RF-CD      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ562294_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ386643_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
JX036352_S_P-RF-CD      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
GQ377627_S_P-RF-CD      atggagaacaycacatcaggattcctaggacccctgctcgtgttacaggc
EU939630_S_P-RF-CB      atggagaacatcgcatcaggactcctcggacccctgctcgtgttacaggc
JX036328_S_P-RF-CD      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ751609_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ562328_S_P-RF-CB      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
EU717211_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgggttacaggc
MT426466_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426530_S_P-RF-CB      atggagaacacagcatcaggattcctaggagcgctgctcgtgttacaggc
MT426471_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426544_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426462_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426460_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426522_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426546_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426540_S_P-RF-CB      atgaagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426539_S_P-RF-CB      atgaagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426533_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426526_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426523_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426479_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttaaaggc
MT426469_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426538_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426514_S_P-RF-CB      atggagaacacagcatcaggattcctcgcacccctgctcgtgttacaggc
MT426503_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426481_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426569_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426562_S_P-RF-CB      atggagaacacagcatcaggattcctagcacccctgctcgtgttacaggc
MT426560_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426558_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426575_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426556_S_P-RF-CB      atggagaacacagcatcaggattcctagggcccctgctcgtgttacaggc
MT426555_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426553_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426549_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426545_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426537_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426531_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426534_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426518_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426517_S_P-RF-CB      atggagaacacagcatcaggattcctagtacccctgctcgtgttacaggc
MT426515_S_P-RF-CB      atggagaacacagcatcaggattcctagcacccctgctcgtgttacaggc
MT426512_S_P-RF-CB      atggagaacacagcatcaggattcctagaacccctgctcgtgttacaggc
MT426509_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426508_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426504_S_P-RF-CB      atggagaacacagcatcaggattcctaagacccctgctcgtgttacaggc
MT426502_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426554_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426500_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426543_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426559_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426489_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426488_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcctgttacaggc
MT426486_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426483_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426480_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426478_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426473_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426470_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426465_S_P-RF-CB      atggaaaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426464_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426461_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426457_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426459_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426487_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426496_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426507_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426547_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426563_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426572_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426492_S_P-RF-CB      atgaagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426519_S_P-RF-CB      atgaagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426463_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426468_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426472_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426475_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426476_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426477_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426482_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426484_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426490_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426491_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426493_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426494_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426495_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426497_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426498_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426501_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426505_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426506_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426510_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426511_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426513_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426520_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426521_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426525_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426528_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426529_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426532_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426536_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426542_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426550_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426551_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426561_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426564_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426565_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426566_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426567_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426568_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426570_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426571_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426573_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426574_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426576_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426535_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
KJ173350_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
HQ684848_S_P-RF-CB      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AB033557_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ562317_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgcgttacaggc
KC774188_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
EU939547_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
AY206374_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ562302_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
GQ377560_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KC774198_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KC774201_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KC774323_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KC774291_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KC774193_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KC774307_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
Y18857_S_P-RF-CB        atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
AB205152_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
JQ040148_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
GQ377539_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
EU939620_S_P-RF-CB      atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggc
MW887645_S_P-RF-CD      atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggc
KR013948_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ562247_S_P-RF-CB      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
FJ386586_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
GQ475335_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
EU589339_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
GQ377592_S_P-RF-CB      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
AF233236_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
GQ377573_S_P-RF-CB      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
GQ377613_S_P-RF-CB      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MT645039_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgggttacaggc
FJ562226_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
AB300369_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
M38454_S_P-RF-CB        atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
JF828938_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
JF828936_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
JF828935_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
JF828933_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
JF828934_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
GQ377548_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
EU939632_S_P-RF-CB      atggagaacatcgcatcaggactcccaggacccctgctcgtgttacaggc
MT645048_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
JQ707714_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
JF436922_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ562336_S_P-RF-CB      atggagaacacagcgtcaggattcctaggacccctgctcgtgttacaggc
AB195940_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
AB195941_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
GQ377604_S_P-RF-CB      atggagaacatcgcatcaggactcctaggacccctgctcgcgttacaggc
AB367393_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
AB367419_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
MT645071_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
MT645069_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
EU871995_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
EU871988_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
EU871991_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
EU871994_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
EU871996_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
EU871999_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
EU871981_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
EU871983_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
EU871986_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
EU871987_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
EU871989_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
EU871990_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
EU871992_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
EU871993_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
EU871984_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
EU871985_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
EU939668_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
AB195950_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
AB195951_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
GQ377564_S_P-RF-CB      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
MW887644_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
MG826142_S_P-RF-CB      atggagagcacaacatcaggattcctaagacccctgctcgtgttacaggc
KJ410520_S_P-RF-CB      atggagaacacaacatcacgattcctaagacccctgctcgtgttacaggc
KC774305_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
HQ700526_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ032337_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
DQ089798_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
AB195956_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
AB195957_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
AB195939_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
AB367400_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ787446_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ386649_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ787480_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
GQ377596_S_P-RF-CB      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
GQ377614_S_P-RF-CB      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
GQ377590_S_P-RF-CB      atggagaacaymrcatcaggaytcctaggacccctgctcgtgttacaggc
GQ377607_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
GQ377565_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
GQ377581_S_P-RF-CB      atggagaacacarcatcaggattcctaggacccctgctcgtgttacaggc
GQ377602_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
EU939621_S_P-RF-CB      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
EU919166_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
EU919167_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
GQ377549_S_P-RF-CB      atggagaacatcgcatcaggaytcctaggacccctgctcgtgttacaggc
JQ040174_S_P-RF-CB      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
GQ377626_S_P-RF-CB      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
GQ377634_S_P-RF-CB      atggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggc
JX661486_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
JQ040142_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
JX661485_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
MG893554_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
MG893555_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
EU916232_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
EU881995_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
MG826149_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
MG826220_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
JQ732168_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ562267_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
EU522070_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
AY040627_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
AB014375_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963930_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963931_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963932_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963933_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963935_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963936_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963938_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963939_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963940_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963941_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963942_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963943_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963944_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963934_S_P-RF-CB      atggagaacacaacatcaggattcctagtacccctgctcgtgttacaggc
FJ715346_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ715347_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
MK534585_S_P-RF-CB      atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggc
KU964351_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963862_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KR013843_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KR013816_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KM875422_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KJ173325_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KC774324_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KC774212_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
GQ377633_S_P-RF-CB      atggagarcacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ715387_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ715345_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ562271_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
EU939606_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
EU939602_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
EU939581_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
EU916228_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
AY247030_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
AY123424_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
AF411409_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
AF330110_S_P-RF-CB      atggagagcacaatatcaggattcctaggacccctgctcgtgttacaggc
AB642096_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
AB049609_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KY363262_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KY363263_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
JN400086_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
AB195955_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
AY167095_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ715385_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ715384_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ715411_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ715412_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ715413_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ715414_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KM213033_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
KJ173358_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KJ173349_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KC774349_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
KC774222_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
HQ700547_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
GU385774_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ386646_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ386593_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
EU939623_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
EU939589_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KJ173320_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KJ173322_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KJ173329_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KJ173280_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ386578_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ386585_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
AB198084_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU964313_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU964005_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU964006_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU964007_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU964008_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU964009_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU964010_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU964303_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU964304_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU964305_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU964307_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU964308_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU964309_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU964310_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU964311_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU964312_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU964314_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU964315_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU964316_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU964317_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU964306_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
MT426499_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MG893559_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KY470893_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KC774344_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
KC774230_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KC774186_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KC774183_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
JX661498_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
JX661487_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
JQ040130_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
HM750133_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
GQ377534_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
FJ562305_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
EU939551_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
EU872014_S_P-RF-CB      atggagagcacaacatcaggattcccaggacccctgctcgtgttacaggc
EU871997_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KY881840_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
AB670303_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
KC774246_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KC774258_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
GQ377522_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
AF461361_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KC774234_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
LC458432_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963883_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963859_S_P-RF-CB      atggagagcacaacatcaggattcctagaacccctgctcgtgttacaggc
KJ173326_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
GQ377611_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ386633_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ386581_S_P-RF-CB      atggagagcacaacatccggattcctaggacccctgctcgtgttacaggc
EU916240_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
EU872015_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
EU916239_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
EU916241_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963856_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963857_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963858_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963860_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963861_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963863_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963864_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963865_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963866_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963867_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963868_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963869_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963870_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ386635_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
JX429896_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
KC774294_S_P-RF-CB      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
MT426557_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426524_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426456_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426455_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426467_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426485_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426527_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT426541_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
MT645035_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
MK321265_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
MK720627_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
MK720628_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963993_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KR013806_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KJ173330_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963990_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KJ173299_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KJ173300_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KJ173279_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KC774328_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KC774317_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KC774322_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
JX661494_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
GQ377594_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
GQ377556_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ562287_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ562227_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
EF494376_S_P-RF-CA      atggagaacacgacatcaggattcctaggacccctgctcgtgttacaggc
FJ562229_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ562277_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
FJ562314_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
JX026887_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963991_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963994_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963995_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963998_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU963999_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU964001_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KU964003_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
MG893561_S_P-RF-CB      atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
Y18856_S_P-RF-CB        atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggc
KC774263_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
KC774341_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
EU787444_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
KC774332_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
LC279263_S_P-RF-CB      atggagagcacagcatcaggattcctaggacccctgctcgtgttacaggc
LC279264_S_P-RF-CB      atggagagcacagcatcaggattcctaggacccctgctcgtgttacaggc
LC279265_S_P-RF-CB      atggagagcacagcatcaggattcctaggacccctgctcgtgttacaggc
LC279266_S_P-RF-CB      atggagagcacagcatcaggattcctaggacccctgctcgtgttacaggc
LC279267_S_P-RF-CB      atggagagcacagcatcaggattcctaggacccctgctcgtgttacaggc
MT645029_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
GQ377516_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
EU939577_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
EU939565_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
GQ377520_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
GQ377544_S_P-RF-CB      atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggc
FN594767_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AY303879_S_P-RF-ED      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggc
GQ161806_S_P-RF-EA      atggaaagcatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ514421_S_P-RF-DC      atggagaacaccacatcaggattcctaggacccctgctcgggttacaggc
KX660685_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683641_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MF925389_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
DQ464164_S_P-RF-DE      atggagaacatcacatcaggattcctacaaccccttctcgggttacaggc
DQ464165_S_P-RF-DE      atggagaacatcacatcaggattcctacaaccccttctcgtgttacaggc
DQ464166_S_P-RF-DE      atggagaacatcacatcaggattcctacaaccccttctcgtgttacaggc
DQ464167_S_P-RF-DE      atggagagcatcacatcaggattcctacaaccccttctcgtgttacaggc
JN225963_S_P-RF-DG      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
JX849500_S_P-RF-DG      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
KP997620_S_P-RF-DA      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
JN688715_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
KX357641_S_P-RF-DE      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggc
AJ627221_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MT426112_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ349221_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MG877711_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
MH464835_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
AB188243_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
KM577666_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
JF440011_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
JF440013_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
JF439999_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
JF440009_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
JF440006_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
JF440001_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
JF439995_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
JF439994_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
JF439996_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
JF439998_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
JF440000_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
JF440002_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
JF440003_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
JF440004_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
JF440005_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
JF440007_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
JF440008_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
JF440010_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
JF440012_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
JF440014_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
JF440015_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
JF440017_S_P-RF-DA      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
MW601264_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
MZ097745_S_P-RF-DE      atggagaacaycacatcaggactcctaggaccccttctcgtgttacaggc
KF679991_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MK052957_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KM359442_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MZ097806_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ349212_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MK052969_S_P-RF-DE      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KM386676_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
MW601310_S_P-RF-DE      atggagaacatcacatcagggttcctaggaccccttctcgtgttacaggc
MZ097777_S_P-RF-DE      atggagaacatcacatcagggttcctaggaccccttctcgtgttacaggc
MW601284_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgcgttacaggc
MZ097758_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgcgttacaggc
MW601296_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
MZ097767_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
KX827302_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtattacaggc
KJ647349_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MZ097766_S_P-RF-DE      atggagaacataacatcaggattcctaggaccccttctcgtgttacaggc
MZ097667_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
GU563560_S_P-RF-DE      atggcgaacagcatatcaggattcctaggaccccttctcgtgttacaggc
MW601241_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
MZ097724_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
MT426113_S_P-RF-DE      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggc
MH724239_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MH464851_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
MF488702_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MH724240_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
KT366492_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
MW601317_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
KM524337_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
JX898690_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
JN688689_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
AY373430_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctagtgttacaggc
MW601227_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
MZ097716_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
MH724222_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
KM524336_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
KJ586811_S_P-RF-DF      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MF967563_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MT426111_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MT426110_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
JX898698_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
JX898699_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
AB210819_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
AJ344117_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
JX898686_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
JX898687_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
JX898688_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
U95551_S_P-RF-DE        atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
JX898693_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
JX898695_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
JX898696_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MW601260_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MZ097740_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MK618442_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MK618440_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MK598652_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
KT366504_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
KM577667_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
KM577665_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
KM524359_S_P-RF-DE      atggagagcatcacatcaggattcctaggaccccttctcgtgttacaggc
KC774450_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
DQ315777_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
AY233295_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
AY233293_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
AJ627217_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
AB188245_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MW601235_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MZ097721_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MH464846_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MH464850_S_P-RF-DA      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MH464852_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MT210033_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
KJ647351_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MH724243_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
EF103285_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
JN664943_S_P-RF-DE      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggc
MK618445_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MK618439_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MK618438_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MK618444_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MK598656_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttcacgtgttacaggc
MK598654_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MK598653_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
KM577664_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
KM577663_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
EU594436_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
DQ111987_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
AB583679_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
GQ183486_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
EU594435_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
MN507850_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
KJ647356_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JX036357_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KY470845_S_P-RF-DC      atggagaacatcacatcaggattcctaaaacccctgctcgcgttacaggc
KY470848_S_P-RF-DC      atggagaacatcacatcaggattcctaaaacccctgctcgcgttacaggc
KY470851_S_P-RF-DC      atggagaacatcacatcaggattcctaaaacccctgctcgcgttacaggc
KY470852_S_P-RF-DC      atggagaacatcacatcaggattcctaaaacccctgctcgcgttacaggc
KY470853_S_P-RF-DC      atggagaaaatcacatcaggattcctaaaacccctgctcgcgttacaggc
KU964367_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KU964374_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KU964366_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KU964370_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KU964379_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KU964380_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KU964372_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MF682475_S_P-RF-DC      atggagaacatcacatcaggattcctaagacccctgctcgggttacaggc
KY470844_S_P-RF-DC      atggagaacatcacatcaggattcctaacacccctgctcgcgttacaggc
KY470854_S_P-RF-DC      atggagaacatcacatcaggattcctaacacccctgctcgcgttacaggc
KY470843_S_P-RF-DC      atggagaacatcacatcaggattcctaacacccctgctcgcgttacaggc
KY470846_S_P-RF-DC      atggagaacatcacatcaggattcctaacacccctgctcgcgttacaggc
KY470847_S_P-RF-DC      atggagaacatcacatcaggattcctaacacccctgctcgcgttacaggc
KY470849_S_P-RF-DC      atggagaacatcacatcaggattcctaacacccctgctcgcgttacaggc
KY470850_S_P-RF-DC      atggagaacatcacatcaggattcctaacacccctgctcgcgttacaggc
KY470855_S_P-RF-DC      atggagaacatcacatcaggattcctaacacccctgctcgcgttacaggc
KY470856_S_P-RF-DC      atggagaacatcacatcaggattcctaacacccctgctcgcgttacaggc
MN683675_S_P-RF-DC      atggagaacatcacatcaggattcctaagacccctgcgcgtattacaggc
KX660682_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683730_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgcacgtgttacaggc
KC774479_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MT645062_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgggttacaggc
KC774452_S_P-RF-DC      atggagaacatcacatcaggattcctcggacccctgctcgcgttacaggc
MN683582_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683655_S_P-RF-DC      atggagaacataacatcaggattcctaggacccctgctcgtgttacaggc
DQ478890_S_P-RF-DC      atggaaaacatcacatcacgattcctaggacccctgctcgtgttacaggc
AY817513_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtattacaggc
KF917451_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KT991427_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JF491448_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683716_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ622876_S_P-RF-DC      atggagaacatcacatccggattcctaggacccctgctcgtgttacaggc
MN683722_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683634_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ622875_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AY817509_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KX660684_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683706_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN650076_S_P-RF-DC      atggagaacataacatcaggattcctaggacccctgctcgtgttacaggc
MN650068_S_P-RF-DC      atggagaacataacatcaggattcctaggacccctgctcgtgttacaggc
KX660686_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683707_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683671_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683673_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683721_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683717_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683692_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683645_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtggtacaggc
MN683640_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683618_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683572_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN650083_S_P-RF-DC      atggagaacattacatcaggattcctaggacccctgctcgtgttacaggc
KP276254_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KP276255_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774490_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774463_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ622872_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
DQ478889_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683700_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgcgttacaggc
MN683683_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774486_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HM750150_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774461_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683626_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HM750144_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN650069_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683637_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774448_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683712_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683677_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774485_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
DQ478887_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774424_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
DQ478892_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MT645065_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MT645063_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683725_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683720_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683718_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683715_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683699_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683703_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683688_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683684_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683676_S_P-RF-DC      atggagaacatcacatccggattcctaggacccctgctcgtgttacaggc
MN683654_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683642_S_P-RF-DC      atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683638_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtggtacaggc
MN683624_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683625_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683643_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683644_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683647_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683649_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683617_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683616_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttgcaggc
MN683612_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683609_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683596_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683590_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683586_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN650087_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683687_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN650085_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN650080_S_P-RF-DC      atggagaacattacatcaggattcctaggacccctgctcgtgttacaggc
MN650081_S_P-RF-DC      atggagaacattacatcaggattcctaggacccctgctcgtgttacaggc
MN650082_S_P-RF-DC      atggagaacattacatcaggattcctaggacccctgctcgtgttacaggc
MN650084_S_P-RF-DC      atggagaacattacatcaggattcctaggacccctgctcgtgttacaggc
MN650072_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN650073_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN650074_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN650075_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN650077_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN650078_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN650086_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683719_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KX660689_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683711_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KU519423_S_P-RF-DC      atggagaacatcacatccggattcctaggacccctgctcgtgttacaggc
MN683674_S_P-RF-DC      atggagaacatcacatccggattcctaggacccctgctcgtgttacaggc
KT991424_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KP276253_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774494_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774466_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683621_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774456_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774433_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MT645049_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MT645060_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774432_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JX429898_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774434_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774472_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774489_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774497_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774499_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN657317_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683592_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683594_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683627_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683630_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683632_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683635_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683651_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683653_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683659_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683660_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683661_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683663_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JF491456_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HM750147_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HM750148_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774482_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683694_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HM750146_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HM750143_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ562263_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KX354997_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ349241_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683686_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683693_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683724_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
EU787435_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
DQ478898_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AY817512_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774428_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774430_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774468_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774492_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AY817511_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AY817510_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AY057948_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HM750145_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683713_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AB674504_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
DQ478897_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774423_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774425_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774471_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KU519422_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KX660677_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN657316_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683571_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683584_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683636_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683658_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683668_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683669_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683672_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683679_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683685_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MT645066_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HM750142_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HM750149_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KP276256_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN650079_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683689_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683690_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683691_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683695_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683696_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683714_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683723_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KY629632_S_P-RF-DC      atggagaacattacatcaggactcctagcacccctgctcgtgttacaggc
MN683620_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MT645070_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgcgttacaggc
KC774431_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683588_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KT991421_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ622866_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KY670781_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MT645067_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KT991419_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774478_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774480_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JX036332_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683581_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KT991420_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgcattacaggc
FJ562278_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KT991417_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KT991423_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ622864_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774474_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctactcgtgttacaggc
KC774449_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774442_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JX036348_S_P-RF-DC      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JF491455_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AB270535_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ622874_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774498_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JX036355_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774487_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774484_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774483_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774481_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774453_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774447_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774439_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ622865_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AY862865_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AY800249_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683622_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683680_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683697_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683656_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KX660674_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
DQ478886_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774476_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KX660680_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683603_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683605_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683628_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683664_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683665_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JF491451_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774454_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN657315_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683580_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683587_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683670_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683678_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683597_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683652_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683611_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774458_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774435_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774455_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774422_S_P-RF-DC      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggc
JF491449_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774470_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AY862866_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AY817515_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
EU787434_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774443_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774457_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774488_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774493_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KX660675_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683574_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683607_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683613_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683614_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683615_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683619_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683650_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683657_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683666_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AY862864_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683610_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683639_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774495_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774420_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774426_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC774475_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683579_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683623_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MK975864_S_P-RF-DC      atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggc
JN257154_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgtttcaggc
MF925402_S_P-RF-BD      atggagaacatctcatcaggactcctaggacccctgctcgtgttacaggc
FJ904428_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JX036347_S_P-RF-DC      atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggc
JX036350_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JX036354_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JX036359_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JX036330_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JX036353_S_P-RF-DC      atggagaacatcacgtcaggattcctaggacccctgctcgtgttacaggc
X68292_S_P-RF-DA        atggagaacatcacatcaggattcctaggacccctgctcgtgttagaggc
FN594770_S_P-RF-DE      atggagaacatcacatcaagattcctaggacccctgctcgtgttacaggc
MF618346_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ904430_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KP288875_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ904436_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FN594771_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ904397_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AM494716_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KX357631_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KX357624_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KU711666_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HQ700492_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FN594769_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ904437_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MT426114_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtattacaggc
KU736917_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KU736914_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KU736915_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN683662_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KU736916_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KJ470892_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ904441_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ904416_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctactcgtgttacaggc
FJ904417_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctactcgtgttacaggc
FJ904404_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ349207_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KX357628_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ904405_S_P-RF-DE      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggc
HQ700494_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ904414_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ904398_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KX357627_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KP168421_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KJ470898_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KF192835_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KF192841_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MF618347_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KF192833_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KF192836_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KF192837_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KF192838_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KF192839_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KF192840_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MH685719_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
J02202_S_P-RF-DE        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ904403_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KJ470897_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KJ470887_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HQ700535_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AB048702_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HQ700579_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HQ700585_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KX357636_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HQ700541_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HQ700540_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HQ700539_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HQ700537_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HQ700536_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HQ700533_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HQ700493_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HQ700582_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HQ700538_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HQ700534_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HQ700503_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HQ700500_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AB033559_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HQ700524_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HQ700525_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HQ700497_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HQ700501_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HQ700581_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HQ700583_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HQ700584_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MH481862_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MH481861_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MH481860_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MH481859_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KJ470884_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KJ470886_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KJ470888_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KJ470890_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KJ470891_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ692536_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KF779353_S_P-RF-DA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AB048703_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MH481858_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ904442_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ904401_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KX827299_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KF170740_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ904447_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ904425_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
DQ991753_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ904409_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ904444_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ904400_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MT591274_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MT591275_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KX357634_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KX357629_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KX357626_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KX357625_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KP168420_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KM606741_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
GU177079_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
GQ161754_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ904394_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ904407_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MT591280_S_P-RF-DE      atggagaccatcacatcaggattcctaggacccctgctcgtgttacaggc
KX357623_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KX357632_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KX357633_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KX357635_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KU736923_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KP995112_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KP168417_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KP168418_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KU736921_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KU736922_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KX357630_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KM606751_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ904440_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ904408_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ904396_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KM606750_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KP168416_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ904406_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AB674412_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AB674434_S_P-RF-DE      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggc
MZ097822_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JN257189_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JN257191_S_P-RF-DE      atggaaaacatcacatcaggaytcctaggacccctgctcgtgttacaggc
MZ097687_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctrctcgtgttacaggc
JF754613_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MZ097826_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgygttacaggc
MF925397_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JN040803_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MZ097652_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JN040798_S_P-RF-DE      atggagaacatcacatcaggattcccaggacccctgctcgtgttacaggc
JN257216_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JN642139_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MZ097680_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MZ097703_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AB674436_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MF925384_S_P-RF-DB      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JX849628_S_P-RF-DA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
X65259_S_P-RF-DA        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KF471643_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JN642137_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AB270538_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JF754616_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgcgttacaggc
AB330368_S_P-RF-DA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JN257206_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JN257207_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MZ097838_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JN642152_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JN642141_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AB674432_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JN257174_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JN257210_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JN642127_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AB674433_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JN257164_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MW601230_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MZ097719_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MZ097814_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JN257204_S_P-RF-DE      atggaaaacatcacatcaggattcctcgcacccctgctcgtgttacaggc
AY341335_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JN642160_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MF488699_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KU668440_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JN664934_S_P-RF-DE      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
JN664929_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JN664925_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JN664935_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MK541689_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KT366505_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
DQ315779_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JN664940_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AB033558_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
GQ205379_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
DQ315780_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MK516279_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MK516280_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JN664915_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JN664933_S_P-RF-DA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
GQ205377_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
GQ205378_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
GQ205386_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
GQ205387_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC875338_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KC875339_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MF925396_S_P-RF-DC      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggc
MF925360_S_P-RF-DB      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
X80925_S_P-RF-DE        atggagaacatcacatcagacttcctaggacccctgctcgtgtcacaggc
KJ803771_S_P-RF-DB      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
EU594406_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JN664946_S_P-RF-DA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ687532_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MZ097850_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JN688717_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MN507835_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MF925401_S_P-RF-DB      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MF925371_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttactggc
KM524357_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MF925388_S_P-RF-DC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KR905422_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MF925392_S_P-RF-DB      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KT366503_S_P-RF-DE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HE981179_S_P-RF-FG      atggacaacatcacatcaggactcctaggacccctgctcgtgttacaggc
AY161147_S_P-RF-DA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
GQ161788_S_P-RF-AE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
EU833890_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
FJ361772_S_P-RF-GC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AB933279_S_P-RF-AG      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AB933280_S_P-RF-AG      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AB933281_S_P-RF-AG      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KF219922_S_P-RF-GH      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
EF464099_S_P-RF-AG      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JF440021_S_P-RF-AG      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KX765835_S_P-RF-GC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707474_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707445_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707432_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707421_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707430_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707463_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707465_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707460_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707456_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707426_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707424_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707441_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707448_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707450_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707467_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707473_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707475_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707457_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707458_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707459_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707461_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707462_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707464_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707466_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707468_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707469_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707470_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707471_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ707472_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HE981180_S_P-RF-GF      atggagaacatcacatcgggattcctaggacccctgctcgtgttacaggc
EU833889_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ272886_S_P-RF-GF      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KP274926_S_P-RF-GA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ272887_S_P-RF-GF      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KJ586803_S_P-RF-AF      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
GQ161767_S_P-RF-AE      atggagaacatcacatcaggatccctaggacccccgcccgtgttacaggc
GQ161753_S_P-RF-AE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
HF571060_S_P-RF-AE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
GQ161837_S_P-RF-AE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
GQ161838_S_P-RF-AE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AB194949_S_P-RF-AE      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
GQ331048_S_P-RF-AE      atggagaacatcacatcaggatccctaggacccctgctcgtgttacaggc
AY230120_S_P-RF-DA      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
AY236161_S_P-RF-DA      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
AY161145_S_P-RF-AD      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AY161146_S_P-RF-AD      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
EU185780_S_P-RF-AD      atggagaacatcacatcaggactcctaggacccctkctcgtgttacaggc
KC012653_S_P-RF-AD      atggagaacatcacatcaggactcctaggacccctkctcgtgttacaggc
EF103284_S_P-RF-AD      atggagaacatcacatcacgattcctaggacccctgctcgtgttacaggc
AY161140_S_P-RF-AD      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AY161141_S_P-RF-AD      atggagaacatcacatcaggattccatggacccctgctcgtgttacaggc
HM146131_S_P-RF-AD      atggagaacatcgcatcaggatacctaggacccctgctcgtgttacaggc
EF103283_S_P-RF-AD      atgcacaagatcacatcaggattcctaggacccctgctcgtgttacaggc
JQ514345_S_P-RF-AD      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AY233277_S_P-RF-AC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KF214656_S_P-RF-AC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
EF103282_S_P-RF-AD      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MF925404_S_P-RF-AC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MF488705_S_P-RF-AD      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KJ586810_S_P-RF-AF      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MT426089_S_P-RF-AB      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AF297620_S_P-RF-DA      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggc
AF297619_S_P-RF-DA      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AB933283_S_P-RF-AG      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AB453985_S_P-RF-AC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AB222708_S_P-RF-AD      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JF439776_S_P-RF-AG      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
MF925386_S_P-RF-AC      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
AB933282_S_P-RF-AG      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JF440019_S_P-RF-AG      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
JF440022_S_P-RF-AG      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
KY470865_S_P-RF-GC      atggagaacatcacatcaggattcctcggaccccggctcgtgttacaggc
KY470858_S_P-RF-GC      atggagaacatcacatcaggattcctcggaccccggctcgtgttacaggc
KY470871_S_P-RF-GC      atggagaacatcacatcaggattcctcggaccccggctcgtgttacaggc
KF214680_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggc
EU835240_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggc
MH368022_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtgttacagga
MK534663_S_P-RF-CB      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggc
MK534669_S_P-RF-CB      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggc
FJ882611_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgcccgtattacaggc
FJ882617_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtattacaggc
FJ882613_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtattacaggc
FJ023667_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtattacaggc
FJ023666_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtattacaggc
FJ882610_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtattacaggc
FJ882614_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtattacaggc
FJ023670_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtattacaggc
FJ023668_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtattacaggc
EU833891_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtattacaggc
FJ023664_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtattacaggc
FJ023673_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtattacaggc
FJ882612_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtattacaggc
FJ882618_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtattacaggc
FJ023665_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtattacaggc
KP148441_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggc
MZ439798_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggc
KP148449_S_P-RF-GC      atggagaacatcacatcaggattcctaggacccctgctcgtgttaccggc
KY470996_S_P-RF-GC      atggggaacatcacatcaggattcctcggacccctgctcgtgttacaggc
KP148442_S_P-RF-BC      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggc
KP148450_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggc
MZ439768_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggc
KP148447_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggc
KY471007_S_P-RF-GC      atggagaacatcacatctggattcctcggacccctgctcgtgttacaggc
KP148586_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggc
FJ023659_S_P-RF-BC      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggc
KY471004_S_P-RF-GC      atggagaacatcagatcaggattcctcggacccctgctcgtgttacaggc
KY470998_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggc
KY471001_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggc
KY470997_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggc
FR714490_S_P-RF-GB      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggc
FJ023662_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggc
KC172106_S_P-RF-GB      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggc
KY470999_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggc
KY471000_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggc
KY471002_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggc
KY471003_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggc
KY471005_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggc
KY471006_S_P-RF-GC      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggc
                        * *   *  *     *       **      * *             ** 

KJ803822_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcgcaatgccacagagtggagaca
KU679958_S_P-RF-CB      ggggtttttcttgttgacaaraatcctcacaataccgcagagtctagact
KU679950_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU679956_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU679954_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF873527_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU679942_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU679943_S_P-RF-BC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU679948_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU679944_S_P-RF-BC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF873523_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF873521_S_P-RF-BC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU679955_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF873524_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF873522_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU679941_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF873517_S_P-RF-BC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF873518_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU679946_S_P-RF-BC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF873515_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF873519_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU679953_S_P-RF-BC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF873511_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF873513_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU679952_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcggagtctagact
KF873535_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF873530_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU679939_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU679940_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF873531_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF873532_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF873533_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF873534_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF873540_S_P-RF-CB      ggggtttttcttgttgacaaraatcctcacaataccgcagagtctagact
KF873537_S_P-RF-CB      ggggtttttcttgttgacaaraatcctcacaataccgcagagtctagact
KF873538_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF873542_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF873543_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU679945_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JF436923_S_P-RF-CB      ggggtttttcttgttgacagaaatcctcacaataccacagagtctagact
KX777355_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
GU357843_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaatgccacagagtctagact
FJ386674_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
KX777261_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
HE652157_S_P-RF-BC      ggggtttttcttgttgacaagaatcctcacaataccacagagtctggact
KF053179_S_P-RF-BC      ggggtttttctcgttgacaaaaatcctcacaataccacagagtctagact
KJ803772_S_P-RF-BC      ggggtttttctcgttgacaaaaatcctcacaataccacagagtctagact
KX777382_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
KX777386_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
FR822117_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
FR821810_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
FR821925_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
HE652175_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
EU939631_S_P-RF-BC      ggggtatttctcgttgacaaaaatcctcacaataccacagagtctagact
MK052976_S_P-RF-BD      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
KF053166_S_P-RF-BC      ggggtttttctcgttgacaaaaatcctcacaataccacagagtctagact
KJ803827_S_P-RF-BC      ggggtttttctcgttgacaaaaatcctcacaataccacagagtctagact
KF053186_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
KJ803778_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MG826150_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MH746812_S_P-RF-BC      ggggtttttcttgttgacaaacatcctcacaataccacagagtctagact
MH746813_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MG826145_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MH746811_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534701_S_P-RF-BC      ggggtttttctcgttgacaaaaatcctcacaataccacagagtctagact
GQ377595_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534668_S_P-RF-BC      ggggttttccttgttgacaaaaatcctcacaataccacagagtctagact
KX774505_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534716_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534730_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534721_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534620_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534714_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534635_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctcgact
MK534722_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534695_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534681_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534637_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534641_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534653_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534686_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
HQ684849_S_P-RF-BC      ggggtttttctcgttgacaaaaatcctcacaataccacagagtctagact
MG826151_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MT645045_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534587_S_P-RF-BC      ggggtttttctcgttgacaaaaatcctcacaataccacagagtctagact
MK052967_S_P-RF-BD      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
GQ377635_S_P-RF-BC      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JQ412091_S_P-RF-BC      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU939629_S_P-RF-BC      ggggtttttctcgttgacaaaaatcctcacaataccacagagtctagact
MK534660_S_P-RF-BC      ggggtttttctcgttgacaaaaatcctcacaataccacagagtctagact
KC793112_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534712_S_P-RF-BC      ggggtttttctcgttgacaaaaatcctcacaataccacagagtctagact
MT645056_S_P-RF-BC      ggggtttttctcgttgacaaaaatcctcacaataccacagagtctagact
MK534559_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
GU079357_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534630_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534594_S_P-RF-BC      ggggtttttctcgttgacaaaaatcctcacaataccacagagtctagact
JQ801477_S_P-RF-BC      ggggtttttctcgttgacaaaaatcctcacaataccacagagtctagact
MK534723_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534734_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK052970_S_P-RF-BD      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534609_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
EU660227_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534616_S_P-RF-BC      ggggtttttctcgttgacaaaaatcctcacaataccacagagtctagact
MG826358_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
GQ377630_S_P-RF-BC      ggggtttttcttgttgacaaraatcctcacaataccacagagtctagact
MK534718_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534582_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534606_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
KJ410497_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534610_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534728_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534715_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK052968_S_P-RF-BD      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
KC774178_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
KC774364_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
EU939627_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534607_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534700_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534648_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534684_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534726_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534690_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534688_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534687_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534689_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534664_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534662_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534623_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534558_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534555_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
KP148337_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534562_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534584_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534590_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534617_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534618_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534654_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534655_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534670_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534672_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534675_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534729_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534569_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534736_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534646_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534633_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534731_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534589_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534579_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
KC774414_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534556_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534561_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534563_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534564_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534566_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534567_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534568_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534577_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534580_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534583_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534598_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534625_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534639_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534651_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534685_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
EF494378_S_P-RF-CA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KX096713_S_P-RF-CA      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JQ040175_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacattaccacagagtctagact
AB031265_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KJ717800_S_P-RF-CB      ggggtttttctcgttgacaagaatcctcacaataccgcagagtctagact
KJ803791_S_P-RF-CB      ggggtttttctcgttgacaagaatcctcacaataccgcagagtctagact
JF436919_S_P-RF-CB      ggggtttttctcgttgacaaaaatcctcacaataccacagagtctagact
FJ751342_S_P-RF-CB      ggggtttttctcgttgacaagaatcctcacaataccacagagtctagact
HQ700518_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU882006_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
HQ700519_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
HQ700521_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
MK534719_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
KU695742_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HQ700505_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU695741_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU695743_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU695744_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU695746_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
HQ700542_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MG826144_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KT003704_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
LC416040_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
AP011104_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
AP011105_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
KP148352_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
HQ700580_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
X75656_S_P-RF-CB        ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU695745_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
HQ700560_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
HQ700554_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
HQ700557_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
HQ700498_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
HQ700499_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
HQ700462_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
HQ700485_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
HQ700507_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
HQ700508_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
AP011108_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
HQ700509_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
HQ700515_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
HQ700527_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
HQ700528_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
HQ700520_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
AP011102_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
HQ700530_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
HQ700532_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
HQ700523_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
HQ700531_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
AB493842_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
AP011103_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
AB105172_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
AB493840_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
AB493838_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
AB493847_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
AB493837_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ358155_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ358156_S_P-RF-CB      ggtgtttttcttgttgacaagaatcctcacaataccacagagtctagact
KY302989_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KY361539_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GU079330_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MK534615_S_P-RF-BC      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC315400_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
HE652142_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
HE652155_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KJ717815_S_P-RF-CB      ggggtttttcttgttaacaagaatcctcacaataccacagagtctagact
KJ717816_S_P-RF-CB      ggggtttttcttgttaacaagaatcctcacaataccacagagtctagact
KJ803803_S_P-RF-CB      ggggtttttcttgttaacaagaatcctcacaataccacagagtctagact
MK534735_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MK534632_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MK534713_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MK534665_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MK534725_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MK534706_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MK534613_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MK534717_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MK534724_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FR822069_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
HE652156_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KF053188_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KJ803782_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KJ717814_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
KJ803802_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
AB241109_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
GU079399_S_P-RF-CB      ggggtttttcttgtagacaagaatcctcacaataccacagagtctagact
FJ751340_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ751277_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ751336_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MH094410_S_P-RF-BC      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GU079271_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GU079319_S_P-RF-CB      ggggtttttcttgtagacaagaatcctcacaataccacagagtctagact
KJ803785_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MF925382_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MG826141_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MG826147_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KJ598675_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MG826146_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MG826148_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JQ514432_S_P-RF-CD      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JQ514447_S_P-RF-CD      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FR714496_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MK534679_S_P-RF-CB      ggggtttttcttgttaacaagaatcctcacaataccacagagtctagact
KJ803798_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KF053160_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
KJ803753_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
KJ717832_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JQ027310_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT645015_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MF925381_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KJ717794_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KJ803788_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KJ803804_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ924618_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JQ801476_S_P-RF-CG      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MF925370_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KJ410506_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MK534682_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MZ439673_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MK534560_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MK534574_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JQ040146_S_P-RF-CB      ggggcttttcttgttgacaagaatcctcacaataccacagagtctagact
AB367800_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
JX036329_S_P-RF-CD      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ562223_S_P-RF-CD      ggggtttttcttgttgacaaaaatcctcacaataccgaagagtctagact
JX036358_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KY363272_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctcgact
KY363273_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctcgact
EU589337_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ032343_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GU079304_S_P-RF-CB      ggggtttttcttgtagacaagaatcctcacaataccacagagtctagact
JX504540_S_P-RF-CB      ggggtttttctcgttgacaagaatcctcacaataccacagagtctagact
GU079476_S_P-RF-CD      ggggtttttcttgtagacaagaatcctcacaataccacagagtctagact
FJ562294_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ386643_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
JX036352_S_P-RF-CD      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ377627_S_P-RF-CD      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
EU939630_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JX036328_S_P-RF-CD      ggggtttttcttgttgacaagaatcctcacaataccacagagtcgagact
FJ751609_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ562328_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
EU717211_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426466_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426530_S_P-RF-CB      gggatttttcttgttgacaagaatcctcacaataccacggagtctagact
MT426471_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426544_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426462_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426460_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426522_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426546_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426540_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426539_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426533_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtatagact
MT426526_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtatagact
MT426523_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426479_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcaccataccacagagtctagact
MT426469_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426538_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426514_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426503_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtcgacact
MT426481_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426569_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426562_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426560_S_P-RF-CB      ggggtttctcttgttgacaagaatcctcacaataccacagagtctagact
MT426558_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426575_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426556_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426555_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426553_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426549_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426545_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426537_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426531_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426534_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426518_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426517_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426515_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426512_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426509_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426508_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426504_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426502_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426554_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426500_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426543_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426559_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426489_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426488_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426486_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426483_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426480_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426478_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426473_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426470_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426465_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426464_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426461_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426457_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426459_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426487_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426496_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426507_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426547_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426563_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426572_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426492_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426519_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426463_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426468_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426472_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426475_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426476_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426477_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426482_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426484_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426490_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426491_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426493_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426494_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426495_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426497_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426498_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426501_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426505_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426506_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426510_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426511_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426513_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426520_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426521_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426525_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426528_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426529_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426532_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426536_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426542_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426550_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426551_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426561_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426564_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426565_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426566_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426567_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426568_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426570_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426571_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426573_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426574_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426576_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426535_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KJ173350_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
HQ684848_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
AB033557_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ562317_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774188_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU939547_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
AY206374_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ562302_S_P-RF-CB      ggggcttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ377560_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774198_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774201_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774323_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774291_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774193_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774307_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
Y18857_S_P-RF-CB        ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
AB205152_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JQ040148_S_P-RF-CB      ggggtttttcttgtkgacaagaatcctcacaataccacagagtctagact
GQ377539_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU939620_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MW887645_S_P-RF-CD      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
KR013948_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ562247_S_P-RF-CB      ggggtttttctygttgacaaraatcctcacaataccacagagtctagact
FJ386586_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ475335_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU589339_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ377592_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
AF233236_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
GQ377573_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
GQ377613_S_P-RF-CB      ggggtttttcttgttgacaaraatcctcacaataccacagagtctagact
MT645039_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagaggctagact
FJ562226_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
AB300369_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
M38454_S_P-RF-CB        ggggtttttcttgttgacaagaatcctcacaataccacagagtctacact
JF828938_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JF828936_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JF828935_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JF828933_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JF828934_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ377548_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU939632_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MT645048_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JQ707714_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaatacctcagagtctagact
JF436922_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ562336_S_P-RF-CB      ggggttttccttgttgacaagaatcctcacaataccacagagtctagact
AB195940_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
AB195941_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ377604_S_P-RF-CB      ggggtttttctcgttgacaaaaatcctcacaataccacagagtctagact
AB367393_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
AB367419_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT645071_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT645069_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU871995_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU871988_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU871991_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU871994_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU871996_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU871999_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU871981_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU871983_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU871986_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU871987_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU871989_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU871990_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU871992_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU871993_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU871984_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU871985_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU939668_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
AB195950_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
AB195951_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ377564_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MW887644_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MG826142_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KJ410520_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774305_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
HQ700526_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ032337_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
DQ089798_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
AB195956_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
AB195957_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
AB195939_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
AB367400_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ787446_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ386649_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ787480_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ377596_S_P-RF-CB      ggggtttttcttgttgacaaraatcctcacaataccacagagtctagact
GQ377614_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
GQ377590_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ377607_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ377565_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ377581_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ377602_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU939621_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU919166_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU919167_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ377549_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
JQ040174_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ377626_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ377634_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
JX661486_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JQ040142_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JX661485_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MG893554_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MG893555_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacggagtctagact
EU916232_S_P-RF-CB      ggggtttttcttgttgacaagagtcctcacaataccacagagtctagact
EU881995_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MG826149_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MG826220_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JQ732168_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ562267_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU522070_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
AY040627_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
AB014375_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
KU963930_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963931_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963932_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963933_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963935_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963936_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963938_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963939_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963940_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963941_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963942_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963943_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963944_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963934_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ715346_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
FJ715347_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MK534585_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU964351_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963862_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KR013843_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KR013816_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KM875422_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KJ173325_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774324_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774212_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ377633_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ715387_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ715345_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
FJ562271_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU939606_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU939602_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU939581_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU916228_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
AY247030_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
AY123424_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
AF411409_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
AF330110_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
AB642096_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
AB049609_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KY363262_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KY363263_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JN400086_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
AB195955_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
AY167095_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ715385_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ715384_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ715411_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ715412_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ715413_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ715414_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KM213033_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KJ173358_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KJ173349_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774349_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774222_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
HQ700547_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GU385774_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ386646_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagrct
FJ386593_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU939623_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU939589_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KJ173320_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KJ173322_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KJ173329_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KJ173280_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ386578_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ386585_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
AB198084_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU964313_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU964005_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU964006_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU964007_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU964008_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU964009_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU964010_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU964303_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU964304_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU964305_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU964307_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU964308_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU964309_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU964310_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU964311_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU964312_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU964314_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU964315_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU964316_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU964317_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU964306_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426499_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MG893559_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KY470893_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagggtctagact
KC774344_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774230_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774186_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774183_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JX661498_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JX661487_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JQ040130_S_P-RF-CB      ggggtttttcttgtagacaagaatcctcacaataccacagagtctagact
HM750133_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ377534_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ562305_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU939551_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU872014_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU871997_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KY881840_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
AB670303_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774246_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774258_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ377522_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
AF461361_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774234_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
LC458432_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963883_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963859_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KJ173326_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ377611_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ386633_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ386581_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU916240_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU872015_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU916239_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU916241_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963856_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963857_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963858_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963860_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963861_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963863_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963864_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963865_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963866_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963867_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963868_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963869_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963870_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ386635_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JX429896_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774294_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426557_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426524_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426456_S_P-RF-CB      ggggttcttcttgttgacaagaatcctcacaataccacagagtctagact
MT426455_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426467_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426485_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426527_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT426541_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT645035_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MK321265_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MK720627_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MK720628_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963993_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KR013806_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KJ173330_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963990_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KJ173299_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KJ173300_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KJ173279_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774328_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774317_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774322_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JX661494_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ377594_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ377556_S_P-RF-CB      ggggtttttcttgttgacaaraatcctcacaataccacagagtctagact
FJ562287_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ562227_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EF494376_S_P-RF-CA      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ562229_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ562277_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ562314_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JX026887_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963991_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963994_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963995_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963998_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU963999_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU964001_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KU964003_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MG893561_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
Y18856_S_P-RF-CB        ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774263_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774341_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU787444_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774332_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
LC279263_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
LC279264_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
LC279265_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
LC279266_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
LC279267_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT645029_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ377516_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU939577_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
EU939565_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ377520_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
GQ377544_S_P-RF-CB      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FN594767_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AY303879_S_P-RF-ED      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
GQ161806_S_P-RF-EA      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
JQ514421_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaatactgcagagtctagact
KX660685_S_P-RF-DC      ggcgttattcttgttgacaaggatgctcacaataccgctaagtctttact
MN683641_S_P-RF-DC      ggcgttattcttgttgacaaggatgctcacaataccgctaagtctttact
MF925389_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
DQ464164_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
DQ464165_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
DQ464166_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
DQ464167_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
JN225963_S_P-RF-DG      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JX849500_S_P-RF-DG      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KP997620_S_P-RF-DA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JN688715_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KX357641_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AJ627221_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MT426112_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
FJ349221_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MG877711_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MH464835_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
AB188243_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagaatctagact
KM577666_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JF440011_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
JF440013_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
JF439999_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
JF440009_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
JF440006_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
JF440001_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
JF439995_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
JF439994_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
JF439996_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
JF439998_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
JF440000_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
JF440002_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
JF440003_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
JF440004_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
JF440005_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
JF440007_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
JF440008_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
JF440010_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
JF440012_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
JF440014_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
JF440015_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
JF440017_S_P-RF-DA      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
MW601264_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MZ097745_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF679991_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MK052957_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KM359442_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MZ097806_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ349212_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MK052969_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KM386676_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MW601310_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MZ097777_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MW601284_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MZ097758_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MW601296_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MZ097767_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KX827302_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KJ647349_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgaagagtctagact
MZ097766_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MZ097667_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
GU563560_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MW601241_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MZ097724_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MT426113_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MH724239_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MH464851_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MF488702_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MH724240_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KT366492_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MW601317_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KM524337_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JX898690_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JN688689_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AY373430_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MW601227_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MZ097716_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MH724222_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KM524336_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KJ586811_S_P-RF-DF      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MF967563_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MT426111_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MT426110_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JX898698_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JX898699_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AB210819_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AJ344117_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JX898686_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JX898687_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JX898688_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
U95551_S_P-RF-DE        ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JX898693_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JX898695_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JX898696_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MW601260_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MZ097740_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MK618442_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MK618440_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MK598652_S_P-RF-DE      ggggtttttcttgttgtcaagaatcctcacaataccgaagagtctagact
KT366504_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KM577667_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KM577665_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KM524359_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774450_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
DQ315777_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AY233295_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AY233293_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AJ627217_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcaccataccgcagagtctagact
AB188245_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MW601235_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MZ097721_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MH464846_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MH464850_S_P-RF-DA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MH464852_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MT210033_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KJ647351_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MH724243_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
EF103285_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JN664943_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MK618445_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MK618439_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MK618438_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MK618444_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MK598656_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgaagagtctagact
MK598654_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgaagagtcaagact
MK598653_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgaagagtctagact
KM577664_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KM577663_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
EU594436_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
DQ111987_S_P-RF-DE      ggggtttttcttgttaacaagaatcctcacaataccgcagagtctagact
AB583679_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
GQ183486_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
EU594435_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN507850_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KJ647356_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgaagagtctagact
JX036357_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KY470845_S_P-RF-DC      ggggtttttctggttgacaagaatcctcacaataccgcagagtctagact
KY470848_S_P-RF-DC      ggggtttttctggttgacaagaatcctcacaataccgcagagtctagact
KY470851_S_P-RF-DC      ggggtttttctggttgacaagaatcctcacaataccgcagagtctagact
KY470852_S_P-RF-DC      ggggtttttctggttgacaagaatcctcacaataccgcagagtctagact
KY470853_S_P-RF-DC      ggggtttttctcgttgacaagaatcctcacaataccgcagagtctagact
KU964367_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU964374_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU964366_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU964370_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU964379_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU964380_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU964372_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MF682475_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KY470844_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KY470854_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KY470843_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KY470846_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KY470847_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KY470849_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KY470850_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KY470855_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KY470856_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683675_S_P-RF-DC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
KX660682_S_P-RF-DC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
MN683730_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaatacctcagagtctagact
KC774479_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MT645062_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774452_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MN683582_S_P-RF-DC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
MN683655_S_P-RF-DC      ggggttttcctggttgacaagaatcctcacaataccgcagagtctagact
DQ478890_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AY817513_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF917451_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KT991427_S_P-RF-DC      ggggtttttctcgttgacaagaatcctcacaataccgcagagtctagact
JF491448_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683716_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ622876_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683722_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683634_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ622875_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AY817509_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KX660684_S_P-RF-DC      ggagtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683706_S_P-RF-DC      ggagtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN650076_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN650068_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KX660686_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683707_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683671_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683673_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683721_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683717_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683692_S_P-RF-DC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
MN683645_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683640_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683618_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683572_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN650083_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KP276254_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KP276255_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774490_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774463_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ622872_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
DQ478889_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683700_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683683_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774486_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HM750150_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774461_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683626_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HM750144_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN650069_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683637_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagaca
KC774448_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683712_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683677_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774485_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
DQ478887_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774424_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
DQ478892_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MT645065_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagaatctagact
MT645063_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MN683725_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683720_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683718_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683715_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683699_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683703_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683688_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683684_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683676_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683654_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683642_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683638_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683624_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683625_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683643_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683644_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683647_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683649_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683617_S_P-RF-DC      ggggtttttcttgttgacgagaatcctcacaataccgcagagtctagact
MN683616_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683612_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683609_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683596_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683590_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683586_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN650087_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683687_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN650085_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN650080_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN650081_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN650082_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN650084_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN650072_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN650073_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN650074_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN650075_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN650077_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN650078_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN650086_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683719_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KX660689_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683711_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU519423_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683674_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KT991424_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KP276253_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774494_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774466_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683621_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774456_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774433_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT645049_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MT645060_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774432_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JX429898_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774434_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774472_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774489_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774497_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774499_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN657317_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683592_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683594_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683627_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683630_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683632_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683635_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683651_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683653_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683659_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683660_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683661_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683663_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JF491456_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HM750147_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HM750148_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774482_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683694_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HM750146_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HM750143_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ562263_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KX354997_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ349241_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683686_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683693_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683724_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
EU787435_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
DQ478898_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AY817512_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774428_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774430_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774468_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774492_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AY817511_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AY817510_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AY057948_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HM750145_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683713_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AB674504_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
DQ478897_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774423_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774425_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774471_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU519422_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KX660677_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN657316_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683571_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683584_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683636_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683658_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683668_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683669_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683672_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683679_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683685_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MT645066_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HM750142_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HM750149_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KP276256_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN650079_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683689_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683690_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683691_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683695_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683696_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683714_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683723_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KY629632_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683620_S_P-RF-DC      ggggtttttctggttgacaagaatcctcacaataccacagagtctagact
MT645070_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774431_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683588_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KT991421_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ622866_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KY670781_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MT645067_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KT991419_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774478_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774480_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JX036332_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683581_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KT991420_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ562278_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KT991417_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KT991423_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ622864_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774474_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774449_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774442_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JX036348_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JF491455_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AB270535_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ622874_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774498_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JX036355_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774487_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774484_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774483_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774481_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774453_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774447_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774439_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
FJ622865_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AY862865_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AY800249_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683622_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683680_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683697_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683656_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KX660674_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
DQ478886_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774476_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KX660680_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683603_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683605_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683628_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683664_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683665_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JF491451_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774454_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN657315_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683580_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683587_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683670_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683678_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683597_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683652_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683611_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774458_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774435_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774455_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774422_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JF491449_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774470_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AY862866_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AY817515_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
EU787434_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774443_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774457_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774488_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774493_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KX660675_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683574_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683607_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683613_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683614_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683615_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683619_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683650_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683657_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683666_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AY862864_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683610_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MN683639_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
KC774495_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774420_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774426_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC774475_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683579_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683623_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MK975864_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JN257154_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
MF925402_S_P-RF-BD      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
FJ904428_S_P-RF-DE      ggggttttccttgttgacaagaatcctcacaacaccgcagagtctagact
JX036347_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JX036350_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JX036354_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JX036359_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JX036330_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JX036353_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
X68292_S_P-RF-DA        ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FN594770_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MF618346_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ904430_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KP288875_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ904436_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FN594771_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ904397_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AM494716_S_P-RF-DE      ggggttttccttgttgacaagaatcctcacaataccgcagagtctagact
KX357631_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KX357624_S_P-RF-DE      ggggttttccttgttgacaagaatcctcacaataccgcagagtctagact
KU711666_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HQ700492_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgaagagtctagact
FN594769_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ904437_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MT426114_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU736917_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU736914_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU736915_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN683662_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU736916_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KJ470892_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ904441_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ904416_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ904417_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ904404_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ349207_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcggagtctagact
KX357628_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ904405_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HQ700494_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ904414_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ904398_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KX357627_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KP168421_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KJ470898_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccrmagagtctagact
KF192835_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF192841_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MF618347_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF192833_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF192836_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF192837_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF192838_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF192839_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF192840_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MH685719_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
J02202_S_P-RF-DE        ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ904403_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KJ470897_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KJ470887_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HQ700535_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
AB048702_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HQ700579_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HQ700585_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KX357636_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HQ700541_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HQ700540_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HQ700539_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgmagagtctagact
HQ700537_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HQ700536_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgaagagtctagact
HQ700533_S_P-RF-DE      ggggtttttcttgttaacaagaatcctcacaataccgcagagtctagact
HQ700493_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HQ700582_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HQ700538_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HQ700534_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HQ700503_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HQ700500_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AB033559_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HQ700524_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HQ700525_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HQ700497_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HQ700501_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HQ700581_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HQ700583_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HQ700584_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MH481862_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MH481861_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagaatctagact
MH481860_S_P-RF-DE      ggggtttttcttgttggcaagaatcctcacaataccgcagagtctagact
MH481859_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaatatcgcagagtctagact
KJ470884_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KJ470886_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KJ470888_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KJ470890_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KJ470891_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ692536_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF779353_S_P-RF-DA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AB048703_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MH481858_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ904442_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgaagagtctagact
FJ904401_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KX827299_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF170740_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ904447_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
FJ904425_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
DQ991753_S_P-RF-DE      ggggttttccttgttgacaagaatcctcacaataccgcagagtctagact
FJ904409_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ904444_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
FJ904400_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MT591274_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MT591275_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KX357634_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KX357629_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgaagagtctagact
KX357626_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KX357625_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KP168420_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KM606741_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
GU177079_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
GQ161754_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaatacctcagagtctagact
FJ904394_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ904407_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MT591280_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KX357623_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KX357632_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KX357633_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KX357635_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU736923_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KP995112_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcacagtctagact
KP168417_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KP168418_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU736921_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KU736922_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KX357630_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KM606751_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ904440_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ904408_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ904396_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KM606750_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KP168416_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ904406_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgaagagtctagact
AB674412_S_P-RF-DE      ggtgtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AB674434_S_P-RF-DE      ggggttttcctggttgacaaaaatcctcacaataccgcagagtctagact
MZ097822_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JN257189_S_P-RF-DE      ggggttttycttgttgacaagaatcctcacaataccgcagagtctagact
JN257191_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MZ097687_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
JF754613_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MZ097826_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MF925397_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JN040803_S_P-RF-DE      ggggtttttcttgttgacaaaaatcctcacaataccgaagagtctagact
MZ097652_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JN040798_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgaagagtctagact
JN257216_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JN642139_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MZ097680_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MZ097703_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AB674436_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MF925384_S_P-RF-DB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JX849628_S_P-RF-DA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
X65259_S_P-RF-DA        ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF471643_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JN642137_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgaagagtctagact
AB270538_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JF754616_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AB330368_S_P-RF-DA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JN257206_S_P-RF-DE      ggggttttycttgttgacaagaatcctcacaataccgcagagtctagact
JN257207_S_P-RF-DE      ggggttttycttgttgacaagaatcctcacaataccgcagagtctagact
MZ097838_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JN642152_S_P-RF-DE      ggggtttttcttggtgacaagaatcctcacaataccgcagagtctagact
JN642141_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AB674432_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JN257174_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JN257210_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JN642127_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AB674433_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JN257164_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MW601230_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MZ097719_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MZ097814_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JN257204_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AY341335_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JN642160_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MF488699_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgaagagtctagact
KU668440_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JN664934_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JN664929_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgaagagtctagact
JN664925_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JN664935_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
MK541689_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KT366505_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
DQ315779_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JN664940_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AB033558_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
GQ205379_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
DQ315780_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MK516279_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MK516280_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JN664915_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JN664933_S_P-RF-DA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
GQ205377_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
GQ205378_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
GQ205386_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
GQ205387_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC875338_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC875339_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MF925396_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MF925360_S_P-RF-DB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
X80925_S_P-RF-DE        ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KJ803771_S_P-RF-DB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
EU594406_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JN664946_S_P-RF-DA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ687532_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MZ097850_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JN688717_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MN507835_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MF925401_S_P-RF-DB      ggggtttttcttgttgacaagaatcctcacaataccgaagagtctagact
MF925371_S_P-RF-DC      ggggttttccttgttgacaagaatcctcacaataccgcagagtctagact
KM524357_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MF925388_S_P-RF-DC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KR905422_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MF925392_S_P-RF-DB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KT366503_S_P-RF-DE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HE981179_S_P-RF-FG      ggtgtgtttcttgttgacaaaaatcctcacaataccacagagtctagact
AY161147_S_P-RF-DA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
GQ161788_S_P-RF-AE      ggggttttccttgttgacaagaatcctcacaataccgcagagtctagact
EU833890_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
FJ361772_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccgcagaatctagact
AB933279_S_P-RF-AG      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AB933280_S_P-RF-AG      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AB933281_S_P-RF-AG      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF219922_S_P-RF-GH      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
EF464099_S_P-RF-AG      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JF440021_S_P-RF-AG      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KX765835_S_P-RF-GC      ggggtttttcttgttgacaagaatcctcacaataccacagagtctagact
JQ707474_S_P-RF-GA      ggggtttttcttgttaacaagaatcctcacaataccgcagagtctagact
JQ707445_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgaagagtctagact
JQ707432_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ707421_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ707430_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ707463_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ707465_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ707460_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ707456_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ707426_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ707424_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ707441_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ707448_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ707450_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ707467_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ707473_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ707475_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ707457_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ707458_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ707459_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ707461_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ707462_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ707464_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ707466_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ707468_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ707469_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ707470_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ707471_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ707472_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HE981180_S_P-RF-GF      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
EU833889_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ272886_S_P-RF-GF      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KP274926_S_P-RF-GA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JQ272887_S_P-RF-GF      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KJ586803_S_P-RF-AF      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
GQ161767_S_P-RF-AE      ggggttttccttgttgacaagaatcctcacaataccgcagagtctagact
GQ161753_S_P-RF-AE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
HF571060_S_P-RF-AE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
GQ161837_S_P-RF-AE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
GQ161838_S_P-RF-AE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AB194949_S_P-RF-AE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
GQ331048_S_P-RF-AE      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctcgact
AY230120_S_P-RF-DA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagatt
AY236161_S_P-RF-DA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagatt
AY161145_S_P-RF-AD      ggggtttttcttgttgacaagcttcctcacaataccgcagagtctagact
AY161146_S_P-RF-AD      ggggtttttcttgttgacaagcttcctcacaataccgcagagtctagact
EU185780_S_P-RF-AD      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KC012653_S_P-RF-AD      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
EF103284_S_P-RF-AD      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AY161140_S_P-RF-AD      ggggtttttcttgttgacaagaatcctcacaataccgcagagtatagact
AY161141_S_P-RF-AD      ggggtttttcttgttgacaagaatcctcacaataccgcagagtatagact
HM146131_S_P-RF-AD      ggggtttttcttgttgacaagaatcctcacgataccgcagagtctagact
EF103283_S_P-RF-AD      ggggtttatcttgttgacaagaatcctctctctaccgcagagtctagact
JQ514345_S_P-RF-AD      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AY233277_S_P-RF-AC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KF214656_S_P-RF-AC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
EF103282_S_P-RF-AD      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MF925404_S_P-RF-AC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MF488705_S_P-RF-AD      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KJ586810_S_P-RF-AF      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MT426089_S_P-RF-AB      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AF297620_S_P-RF-DA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AF297619_S_P-RF-DA      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AB933283_S_P-RF-AG      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AB453985_S_P-RF-AC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AB222708_S_P-RF-AD      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JF439776_S_P-RF-AG      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
MF925386_S_P-RF-AC      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
AB933282_S_P-RF-AG      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JF440019_S_P-RF-AG      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
JF440022_S_P-RF-AG      ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagact
KY470865_S_P-RF-GC      ggggttttccttgttgacaaaaatcctcacaataccgcagagtctagact
KY470858_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
KY470871_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
KF214680_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
EU835240_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccacagagtctagact
MH368022_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
MK534663_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
MK534669_S_P-RF-CB      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
FJ882611_S_P-RF-GC      gggattttccttgttgacaaaaatcctcacaataccgcagagtctagact
FJ882617_S_P-RF-GC      gggatttttcttgttgacaaaaatcctcacaataccgcagagtctagact
FJ882613_S_P-RF-GC      gggatttttcttgttgacaaaaatcctcacaataccgcagagtctagact
FJ023667_S_P-RF-GC      gggatttttcttgttgacaaaaatcctcacaataccgcagagtctagact
FJ023666_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
FJ882610_S_P-RF-GC      gggatttttcttgttgacaaaaatcctcacaataccgcagagtctagact
FJ882614_S_P-RF-GC      gggatttttcttgttgacaaaaatcctcacaataccgcagagtctagact
FJ023670_S_P-RF-GC      gggatttttcttgttgacaaaaatcctcacaataccgcagagtctagact
FJ023668_S_P-RF-GC      gggatttttcttgttaacaaaaatcctcacaataccgcagagtctagact
EU833891_S_P-RF-GC      gggatttttcttgttgacaaaaatcctcacaataccgcagagtctagact
FJ023664_S_P-RF-GC      gggatttttcttgttgacaaaaatcctcacaataccgcagagtctagact
FJ023673_S_P-RF-GC      gggatttttcttgttgacaaaaatcctcacaataccgcagagtctagact
FJ882612_S_P-RF-GC      gggatttttcttgttgacaaaaatcctcacaataccgcagagtctagact
FJ882618_S_P-RF-GC      gggatttttcttgttgacaaaaatcctcacaataccgcagagtctagact
FJ023665_S_P-RF-GC      gggatttttcttgttgacaaaaatcctcacaataccgcagagtctagact
KP148441_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
MZ439798_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
KP148449_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
KY470996_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
KP148442_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
KP148450_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
MZ439768_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
KP148447_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
KY471007_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
KP148586_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
FJ023659_S_P-RF-BC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
KY471004_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
KY470998_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
KY471001_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
KY470997_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
FR714490_S_P-RF-GB      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
FJ023662_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
KC172106_S_P-RF-GB      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
KY470999_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
KY471000_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
KY471002_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
KY471003_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
KY471005_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
KY471006_S_P-RF-GC      ggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagact
                        **       ** *    *     * *** *                    

KJ803822_S_P-RF-CB      gttgcaggaattctttcaattttctagggggagcacccacgtgtcgtggc
KU679958_S_P-RF-CB      cgtggtggacttctctcaattttctaggggargctcccgcgtgtcttggc
KU679950_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KU679956_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KU679954_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcytggc
KF873527_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KU679942_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KU679943_S_P-RF-BC      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KU679948_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagctcccgcgtgtcttggc
KU679944_S_P-RF-BC      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KF873523_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KF873521_S_P-RF-BC      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KU679955_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KF873524_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KF873522_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KU679941_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KF873517_S_P-RF-BC      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KF873518_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KU679946_S_P-RF-BC      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KF873515_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KF873519_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KU679953_S_P-RF-BC      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KF873511_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KF873513_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KU679952_S_P-RF-CB      cgtggtggacttctctcagttttctaggggragctcccgcgtgtcytggc
KF873535_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KF873530_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KU679939_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KU679940_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KF873531_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KF873532_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KF873533_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KF873534_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KF873540_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KF873537_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KF873538_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KF873542_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KF873543_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
KU679945_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggc
JF436923_S_P-RF-CB      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
KX777355_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
GU357843_S_P-RF-CB      cgtggtggacttctcacaattttctagggggaacacccgtgtgtcttggc
FJ386674_S_P-RF-BC      cgtggtggacttctctcagttttctagggggaacacccgtgtgtcgtggc
KX777261_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
HE652157_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
KF053179_S_P-RF-BC      cgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggc
KJ803772_S_P-RF-BC      cgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggc
KX777382_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
KX777386_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
FR822117_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
FR821810_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
FR821925_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
HE652175_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
EU939631_S_P-RF-BC      cgtggtggacttctctcaattttcaaagggaaacacccgtgtgtcatggc
MK052976_S_P-RF-BD      cgtggtggacttctctcaattttctagggggcacacccgtgtgtcttggc
KF053166_S_P-RF-BC      cgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggc
KJ803827_S_P-RF-BC      cgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggc
KF053186_S_P-RF-BC      cgtggtggacttctctcagttctctagggggaacaaccgtgtgtcttggc
KJ803778_S_P-RF-BC      cgtggtggacttctctcagttctctagggggaacaaccgtgtgtcttggc
MG826150_S_P-RF-BC      cgtggtggacttctctcagttttctagggggaacaaccgtgtgtcgtggc
MH746812_S_P-RF-BC      cgaggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MH746813_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MG826145_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MH746811_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534701_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
GQ377595_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgagtgtcttggc
MK534668_S_P-RF-BC      cgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggc
KX774505_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534716_S_P-RF-BC      cgtggtggacttctctcagttttctaggggaaacacccgtgtgtcttggc
MK534730_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaactcccgtgtgtcttggc
MK534721_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534620_S_P-RF-BC      cgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggc
MK534714_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534635_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534722_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534695_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534681_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534637_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534641_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534653_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534686_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
HQ684849_S_P-RF-BC      cgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggc
MG826151_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MT645045_S_P-RF-BC      cgtggtggacttctctcagttttctagggggaacacccgtgtgtcgtggc
MK534587_S_P-RF-BC      cgtggtggacttctctcaattttctaggggagacacccgtgtgtcttggc
MK052967_S_P-RF-BD      cgtggtggacttctctcaattttctagggggcacacccgtgtgtcttggc
GQ377635_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
JQ412091_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
EU939629_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534660_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
KC793112_S_P-RF-BC      cgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggc
MK534712_S_P-RF-BC      cgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggc
MT645056_S_P-RF-BC      cgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggc
MK534559_S_P-RF-BC      cgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggc
GU079357_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534630_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534594_S_P-RF-BC      cgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggc
JQ801477_S_P-RF-BC      cgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggc
MK534723_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534734_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK052970_S_P-RF-BD      cgtggtggacttctctcaattttctagggggcacacccgtgtgtcttggc
MK534609_S_P-RF-BC      cgtggtggacttctctcagttttctaggggggacacccgtgtgtcttggc
EU660227_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534616_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MG826358_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
GQ377630_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534718_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534582_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534606_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
KJ410497_S_P-RF-BC      cgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggc
MK534610_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534728_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534715_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK052968_S_P-RF-BD      cgtggtggacttctctcaattttctagggggcacacccgtgtgtcttggc
KC774178_S_P-RF-BC      tgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
KC774364_S_P-RF-BC      tgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
EU939627_S_P-RF-BC      cgtggtggacttctctcaattttctaggggraacacccgtgtgtcttggc
MK534607_S_P-RF-BC      tgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534700_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534648_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534684_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534726_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534690_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534688_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534687_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534689_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534664_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534662_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534623_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534558_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534555_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
KP148337_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534562_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534584_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534590_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534617_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534618_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534654_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534655_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534670_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534672_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534675_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534729_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534569_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534736_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534646_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534633_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534731_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534589_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534579_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
KC774414_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534556_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534561_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534563_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534564_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534566_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534567_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534568_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534577_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534580_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534583_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534598_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534625_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534639_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534651_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
MK534685_S_P-RF-BC      cgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggc
EF494378_S_P-RF-CA      cgtggtggacttctctcaattttctagggggagcacccacgtgtcctggc
KX096713_S_P-RF-CA      cgtggtggacttctctcaattttctagggggatcacccgcgtgtcctggc
JQ040175_S_P-RF-CB      cgaggtggacttctctcaattttctagggggagcacccgcgtgtcctggc
AB031265_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccacgtgtcctggc
KJ717800_S_P-RF-CB      cgtggtggacttctctcaattttccagggggagcacccgcgtgtcctggc
KJ803791_S_P-RF-CB      cgtggtggacttctctcaattttccagggggagcacccgcgtgtcctggc
JF436919_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggc
FJ751342_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccacgtgtcctggc
HQ700518_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagctcccatgtgtcctggc
EU882006_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccacgtgtcctggc
HQ700519_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagctcccgcgtgtcctggc
HQ700521_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagcacccgcgtgtcctggc
MK534719_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggc
KU695742_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagcacccaggtgtcctggc
HQ700505_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggc
KU695741_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggc
KU695743_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggc
KU695744_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggc
KU695746_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggc
HQ700542_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggc
MG826144_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggc
KT003704_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggc
LC416040_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggc
AP011104_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggc
AP011105_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggc
KP148352_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggc
HQ700580_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagyaccaaggtgtcctggc
X75656_S_P-RF-CB        cggggtggacttctctcaattttctaggggaagcaccaaggtgtcctggc
KU695745_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggc
HQ700560_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggc
HQ700554_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggc
HQ700557_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggc
HQ700498_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggc
HQ700499_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggc
HQ700462_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggc
HQ700485_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggc
HQ700507_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggc
HQ700508_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggc
AP011108_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggc
HQ700509_S_P-RF-CB      cgtggtggacttctctcaattttctaggggragcacccgtgtgtcctggc
HQ700515_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggc
HQ700527_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagctcycgtgtgtcktggc
HQ700528_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagctcccgtgtgtcttggc
HQ700520_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagctcccatgtgtcctggc
AP011102_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagcacccatgtgtcctggc
HQ700530_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagctcccgtgtgtcctggc
HQ700532_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagctcccatgtgtcctggc
HQ700523_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagctcccatgtgtcctggc
HQ700531_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagctcccatgtgtcctggc
AB493842_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagcacccatgtgtcctggc
AP011103_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagcacccatgtgtcctggc
AB105172_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagcacccatgtgtcctggc
AB493840_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagcacccatgtgtcctggc
AB493838_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagcacccatgtgtcctggc
AB493847_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagcacccatgtgtcctggc
AB493837_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagcacccatgtgtcctggc
GQ358155_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagcacccatgtgtcctggc
GQ358156_S_P-RF-CB      cgtggtggacttctctcaattttctaggggaagcacccatgtgtcctggc
KY302989_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccacgtgtcctggc
KY361539_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccacgtgtcctggc
GU079330_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccacgtgtcctggc
MK534615_S_P-RF-BC      cgtggtggacttctctcagttttctagggggagcacccatgtgtcctggc
KC315400_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccacgtgtcctggc
HE652142_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcgcccacgtgtcctggc
HE652155_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccacgtgtcctggc
KJ717815_S_P-RF-CB      cgtggtggacttctctcaattttctagggggagcacccacgtgtcctggc
KJ717816_S_P-RF-CB      cgtggtggacttctctcaattttc