HBVdb

Dataset for nucleotide sequence PreS2 of genotype RF

[Download (right click)] [Edit] [Sequences] [Repertoires]

1208 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


KJ803822_PreS2_P-RF-C      atgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
HE981179_PreS2_P-RF-F      atgcagtggaactcaacccagttccaccaggccctgttggatccgagggt
KJ586803_PreS2_P-RF-A      atgcagtggaactcaacccagttccaccaggccctgtcggatccgagggt
GQ161806_PreS2_P-RF-E      atgcagtggaattccacaacattccaccaacctctgcagratcccagagt
FN594767_PreS2_P-RF-D      atgcagtggaattccacaacattccaccaagctctgcaggatcccagagt
KX660685_PreS2_P-RF-D      atrcagtggaactccacaaccttcctccaaactctgcaagatcccagggt
MN683641_PreS2_P-RF-D      atgcagtggaactccacaaccttcctccaaactctgcaagatcccagggt
JX036359_PreS2_P-RF-D      atgcagtggaattccacgacattccaccaagctctgctagatcccagagt
JN257154_PreS2_P-RF-D      atgcagtggaactccacaacattccaccaaactctgcaagaccccagagt
MN683675_PreS2_P-RF-D      atgcagtggaactccataaccttcctccaaactctgcaagatcccagggg
KX357641_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagattccagagt
X68292_PreS2_P-RF-DA       atgcagtggaactccacaaccttccaccaaactctgcaagatccaagagt
AY341335_PreS2_P-RF-D      atgaagtggaattccacaactttccgccaaattctgcaagatcccagggt
JN257189_PreS2_P-RF-D      atgcagtggaactccactacctttcaccaaactctgcaagatcccagagt
AB674434_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaacctctgcaagatcccagagt
MF925397_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257204_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257191_PreS2_P-RF-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagagt
JN642160_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MF925396_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KJ803771_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
X80925_PreS2_P-RF-DE       atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
JN664946_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MF925371_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU594406_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JQ687532_PreS2_P-RF-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
MF925360_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MF925401_PreS2_P-RF-D      atgcagtggaactccacaaccttcaaccaaactctgcaagatcccagggt
JN688717_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN507835_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KM524357_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KR905422_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KT366503_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MF925388_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MF925392_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JN040803_PreS2_P-RF-D      atgcagtggaactccacaaacttccaccaaactctgcaagatcccagagt
X65259_PreS2_P-RF-DA       atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX036330_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactcagcaagatcccagagt
JF754616_PreS2_P-RF-D      atgcagtggaacatcacaaccttccaccaaactctgcaagatcccagagt
JF754613_PreS2_P-RF-D      atgcagtggaactccacacccttccaccaaactctgcaagatcccagagt
JN040798_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB674436_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN642137_PreS2_P-RF-D      atgcagtggaactccacaacattccaccaaactctgcaagatcccagagt
JN257216_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN642139_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB330368_PreS2_P-RF-D      atgcagtggaactccacagccttccaccaagctctgcaggatcccagagt
JN257206_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257207_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MF925384_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB674433_PreS2_P-RF-D      atgcagtggaactccacaacattccaccaaactctgcaagatcccagagt
AB674432_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF471643_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN642127_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257174_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257164_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN257210_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN642141_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN642152_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KY470853_PreS2_P-RF-D      acgcagtggaactccacaaccttcctccgagctctgcaagatcccagagt
JX036357_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
FN594770_PreS2_P-RF-D      atgcagtggaactccacaaccttccacmaaactctgcaagatcccagagt
KY470844_PreS2_P-RF-D      gtacagtggaactccacaaccttcctccaaactctgcaagatcccagggt
KY470843_PreS2_P-RF-D      gtacagtggaactccacaaccttcctccaaactctgcaagatcccagggt
KY470846_PreS2_P-RF-D      gtacagtggaactccacaaccttcctccaaactctgcaagatcccagggt
KY470847_PreS2_P-RF-D      gtacagtggaactccacaaccttcctccaaactctgcaagatcccagggt
KY470849_PreS2_P-RF-D      gtacagtggaactccacaaccttcctccaaactctgcaagatcccagggt
KY470850_PreS2_P-RF-D      gtacagtggaactccacaaccttcctccaaactctgcaagatcccagggt
KY470855_PreS2_P-RF-D      gtacagtggaactccacaaccttcctccaaactctgcaagatcccagggt
KY470856_PreS2_P-RF-D      gtacagtggaactccacaaccttcctccaaactctgcaagatcccagggt
KY470854_PreS2_P-RF-D      gtacagtggaactccacaaccttcctccaaactctgcaagatcccagggt
FJ904430_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM606741_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
FJ349207_PreS2_P-RF-D      atgcattggaactccacaaccttccatcaaactctgcaagatcccaaagt
AM494716_PreS2_P-RF-D      atgcagtggaactctacaaccttccaccaagctctgcaagatcccagagt
FJ904436_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904414_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
FJ904416_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904417_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ991753_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
FJ904441_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX357627_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagaccccagagt
KP168421_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FN594771_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904425_PreS2_P-RF-D      atgcagtggaactcaacgaccttccaccaaactctgcaagatcccagagt
KX357624_PreS2_P-RF-D      ---cagtggaattccacaaccttccaccaaactctgcaagatcccagagt
KX357631_PreS2_P-RF-D      atgcagtggaactccacaacctttcaccaaactctgcaagatcccagagt
FJ904405_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KP995112_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KP168420_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KU736916_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
FJ904398_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904442_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KU711666_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FN594769_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904401_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904404_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904396_PreS2_P-RF-D      acgcagtggaactccacaactttccaccaaaatctgcaagatcccagagt
FJ904400_PreS2_P-RF-D      atgcagtggaattcaacaaccttccaccaaactctgcaagatcccagagt
KU736917_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KU736914_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KU736915_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MH685719_PreS2_P-RF-D      atgcagtggaactccacaacctttcaccaaactctgcaagatcccagagt
KX827299_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GU177079_PreS2_P-RF-D      atgcagtggaactctacaaccttccaccaaactctgcaagatcccagagt
FJ904403_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX357628_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM606751_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904444_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
KF170740_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ161754_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaagctctgcaagatcccagagt
FJ904447_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904440_PreS2_P-RF-D      atgcagtggaactctacaaccttccaccaaactctgcaagatcccagagt
FJ904394_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX357636_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX357634_PreS2_P-RF-D      tggaagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904407_PreS2_P-RF-D      atgcagtggaactccacaatcttccaccaaactctgcaagatcccagagt
FJ904408_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ904409_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX357629_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX357626_PreS2_P-RF-D      atgcagtggaactcaacaaccttccaccaaactctgcaagatcccagagt
KX357625_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KU736923_PreS2_P-RF-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagagt
FJ904406_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM606750_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX357635_PreS2_P-RF-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagagt
KX357623_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX357633_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX357630_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KP168416_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KP168417_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactcttcaggatcccagagt
KP168418_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KU736921_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KU736922_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KJ647356_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683620_PreS2_P-RF-D      atgcagtggaactccacaaccttcctccaaactctgcaagatcccagggg
MN683662_PreS2_P-RF-D      atgcagtggaactccacaacattccaccaaactctgctagatcccagagt
MN683581_PreS2_P-RF-D      atgcagtggaactccataaccttcctccaaactctgcaagatcccagggt
MN683730_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KY629632_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KT991420_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KT991423_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
FJ562278_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KT991417_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaagctctgcaagatcccagggt
MN683624_PreS2_P-RF-D      atgcagtggaactccacaaacttccaccaagctctgctagatcccagagt
KC774484_PreS2_P-RF-D      atgcaatggaactccacaacttttcaccaaactctgcaagatcccagggt
KC774498_PreS2_P-RF-D      atgcaatggaactccacaacttttcaccaaactctgcaagatcccagggt
KC774431_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774449_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683582_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaacgttgcaagatcccagggt
MN683655_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaggatcccagggt
MN683634_PreS2_P-RF-D      atgcagtggaactctacaaccttccaccaaactctgcaagatcccagggt
KT991421_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KT991419_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774478_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774480_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774452_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AY862865_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactcttcaagatcccagggt
AY862864_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactcttcaagatcccagggt
AY862866_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactcttcaagatcccagggt
MN683618_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774479_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KY670781_PreS2_P-RF-D      ctgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774463_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774489_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683571_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683592_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaagctctgcaagatcccagggt
MN683594_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaagctctgcaagatcccagggt
MN683609_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774487_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JX036332_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JF491448_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683622_PreS2_P-RF-D      atgcagtggaactccacaaacttccaccaaactctgcaagatcccagggt
JF491455_PreS2_P-RF-D      atgcagtggaattccacaactttccaccaaactctgcaagatcccagggt
AY817513_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AY817509_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AB270535_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagrgt
MN683627_PreS2_P-RF-D      atgcagtggacctccacaaccttccaccaaactctgcaagatcccagagt
MN650068_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774442_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU787435_PreS2_P-RF-D      acgcagtggaactccacaaccttcctccaaactttgcaagatcccagggt
DQ478898_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactttgcaagatcccagggt
KC774492_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactttgcaagatcccagggt
KX660677_PreS2_P-RF-D      tacaagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683668_PreS2_P-RF-D      atgaagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KF917451_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683713_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683714_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagggt
KC774490_PreS2_P-RF-D      atgcagtggaactctacaaccttccaccaaactctgcaagatcccagggt
KC774481_PreS2_P-RF-D      atgcagtggaactccacaaccttcctccaaactctgcaagatcccagggt
AY817510_PreS2_P-RF-D      atacagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683645_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683640_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683623_PreS2_P-RF-D      atgcagtggaactccacaaacttccaccaaactctgcaagatcccagggt
MN683610_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683579_PreS2_P-RF-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
MN683574_PreS2_P-RF-D      atgcagtggaactccacaacattccaccaaactctgcaagatcccagggt
KU519423_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683674_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774486_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774483_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774474_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774454_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactttgcaagatcccagggt
KC774453_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774439_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KP276254_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KP276255_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagggt
JF491449_PreS2_P-RF-D      atgcagtggaattccacaacttttcaccaaactctgcaagatcccagggt
KC774470_PreS2_P-RF-D      atgcagtggaactccacaacttttcaccaaactctgcaagatcccagggt
KC774458_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774428_PreS2_P-RF-D      atgcagtggaactccacaaccttcctccaaactctgcaagatcccagggt
MN683717_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683597_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683652_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683684_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683676_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683657_PreS2_P-RF-D      atgcagtggaactccacaacattccaccaaactctgcaagatcccagggt
MN683656_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683654_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683639_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagggt
MN683625_PreS2_P-RF-D      atgaaatggaactccacaactttccaccaaactctgcaagatcccagggt
MN683611_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683603_PreS2_P-RF-D      atgcaatggaactccccaaccttccaccaaactctgcaagatcccagggt
MN683596_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683572_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KX660675_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683607_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683613_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683614_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683615_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683666_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774461_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774447_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
DQ478889_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AY817512_PreS2_P-RF-D      atgcaatggaactccacaaccttccaccaaactctgcaagatcccagggt
AY800249_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774435_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774455_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774443_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683683_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683626_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774466_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683621_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683637_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774448_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JF491451_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683619_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774488_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagggt
KC774493_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagggt
KC774422_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
EU787434_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
AY817515_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774457_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683650_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774495_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774420_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774426_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774475_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KX660674_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
DQ478886_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774476_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KX660680_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683605_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683664_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683665_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683635_PreS2_P-RF-D      atgcagtggaactctacaaccttccaccaaactctgcaagatcccagggt
MN683659_PreS2_P-RF-D      atgcagtggaactctacaaccttccaccaaactctgcaagatcccagggt
MN683658_PreS2_P-RF-D      atgcagtggaactctacaaccttccaccaaactctgcaagatcccagggt
MN683678_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683670_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683663_PreS2_P-RF-D      atgcagtggaactctacaaccttccaccaaactctgcaagatcccagggt
MN683643_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683644_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683647_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683649_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683642_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683638_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683617_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683616_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683612_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683590_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683586_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN657317_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683632_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683660_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683661_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN657316_PreS2_P-RF-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
MN657315_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683580_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KU519422_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683672_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC774494_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774434_PreS2_P-RF-D      atgcagtggaactccacaactttccaccaaactctgcaagatcccagggt
KC774433_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774432_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774430_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774468_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774425_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774424_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JX429898_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774472_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774497_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774499_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683630_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683651_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683653_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JF491456_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
DQ478897_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774423_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
KC774471_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683636_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
MN683669_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
DQ478887_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
DQ478892_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
HQ700492_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaaacctgcaagatcccagagt
FJ904437_PreS2_P-RF-D      atgcagtggaactcaacaaccttccaccaaactctgcaagatcccagagt
AB674504_PreS2_P-RF-D      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
DQ478890_PreS2_P-RF-D      atgcactggaactccacaaccttccaccaaactctgcaagatcccaaagt
MN683588_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683712_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KT991427_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683721_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaggatcccagagt
MN683722_PreS2_P-RF-D      atgcagtggaactccacaaccttcctccaaactctgcaagatcccagagt
KX660686_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MN683707_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MN683716_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN650076_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683671_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683673_PreS2_P-RF-D      atgcagtggaactccacaaacttccaccaaactctgcaagatcccagagt
MN683692_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683628_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX660684_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683706_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KT991424_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HM750144_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactccgcaagatcccagagt
MN650069_PreS2_P-RF-D      atgctgtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683677_PreS2_P-RF-D      atgcagtggaactccacaaacttccaccaaactctgcaagatcccagagt
MN683720_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683718_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683688_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN650083_PreS2_P-RF-D      atgcagtggaactccacaacctttcaccaaactctgcaagatcccagagt
MN650081_PreS2_P-RF-D      atgcagtggaactccacaacctttcaccaaactctgcaagatcccagagt
MN650082_PreS2_P-RF-D      atgcagtggaactccacaacctttcaccaaactctgcaagatcccagagt
MN650084_PreS2_P-RF-D      atgcagtggaactccacaacctttcaccaaactctgcaagatcccagagt
MN650080_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX660689_PreS2_P-RF-D      atgcagtggaactccacaacctttcaccaaactctgcaagatcccagagt
MN683711_PreS2_P-RF-D      atgcagtggaactccacaacctttcaccaaactctgcaagatcccagagt
KC774485_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HM750146_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HM750145_PreS2_P-RF-D      atgcagtggaactccacaaacttccaccaaactctgcaagatcccagagt
HM750143_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ562263_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AY817511_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AY057948_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683700_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683694_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HM750147_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HM750148_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC774482_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683699_PreS2_P-RF-D      atgcagtggaactccacaacctttcaccaaactctgcaagatcccagagt
MN683703_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683697_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683587_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683725_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683719_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683715_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683696_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683680_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN650087_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683687_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN650085_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN650072_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN650073_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN650074_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN650075_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN650077_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN650078_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN650086_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KX354997_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KP276253_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC774456_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HM750150_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ349241_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683686_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683693_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683724_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HM750142_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HM750149_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KP276256_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN650079_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683689_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683690_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683691_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683695_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683723_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683584_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683679_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MN683685_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KP288875_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
J02202_PreS2_P-RF-DE       atgcactggaactccacaaccttccaccaaactctgcaagatcccagagt
MF618346_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KJ470898_PreS2_P-RF-D      atgcagtggaactccacaaccttccawcaaactctgcaagatcccagagt
HQ700494_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaaccctgcaagatcccagagt
AB048702_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ700579_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ700585_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ700536_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
HQ700535_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MH481862_PreS2_P-RF-D      atgcagtggaantccacaaccttccaccaaactctgcaagatcccagagt
MH481861_PreS2_P-RF-D      atgcagtggaantccacaaccttccaccaaactctgcaagatcccagagt
MH481860_PreS2_P-RF-D      atgcagtggaantccacaaccttccaccaaactctgcaagatcccagagt
MH481858_PreS2_P-RF-D      atgcagtggaantccacaaccttccaccaaactctgcaagatcccagagt
MH481859_PreS2_P-RF-D      atgcagtggaantccacaaccttccaccaaactctgcaagatcccagagt
HQ700534_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccaragt
HQ700541_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
HQ700540_PreS2_P-RF-D      atgcagtggaactccactaccttccaccaaactctgcaagatcccagagt
HQ700539_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ700493_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB048703_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ700538_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ700537_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ700533_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ700582_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ700503_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ700500_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB033559_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ700524_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ700525_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ700497_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ700501_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ700581_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ700583_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
HQ700584_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KJ470897_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
KF192835_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF192840_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF192833_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF192836_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF192837_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF192838_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF192839_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF192841_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MF618347_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KJ470887_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
FJ692536_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KF779353_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KJ470884_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KJ470886_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KJ470888_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KJ470890_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KJ470891_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
EU185780_PreS2_P-RF-A      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KC012653_PreS2_P-RF-A      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
DQ464164_PreS2_P-RF-D      atacagtggaactccacaacattctaccaaactctacaagatcccagagt
DQ464165_PreS2_P-RF-D      atacagtggaactcaacaacattcaaacaaactctacaagatcccagagt
DQ464166_PreS2_P-RF-D      atacagtggaactcaacaacattcaaacaaactctacaagatcccagagt
DQ464167_PreS2_P-RF-D      atacagtggaactccacagcattcaaacaaactctacaagatcccagagt
AF297619_PreS2_P-RF-D      atgcagtggaattccactgccttgcaccaagctctgcaggatcccagaga
AY230120_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
AY236161_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
AF297620_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JN664935_PreS2_P-RF-D      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
FJ349221_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
AJ627221_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccacagt
MK541689_PreS2_P-RF-D      atgcagtggacctccaaaaccttccaccaagctctacaagatcccagagt
MF488699_PreS2_P-RF-D      gtgcggtggaactccacaaccttccaccaagctctgcaagatcccagagt
JN664929_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaagctctgcaagatcccagagt
AB033558_PreS2_P-RF-D      atgcagtggacttccacaaccttccaccaagctctgcaagatcccagagt
GQ205379_PreS2_P-RF-D      atgcagtggacctccacaaccttccaccaagctctgcaagatcccagagt
MK516279_PreS2_P-RF-D      atgcagtggacctccacaaccttccatcaagctctgcaagatcccagagt
MK516280_PreS2_P-RF-D      atgcagtggacctccacaaccttccatcaagctctgcaagatcccagagt
KT366505_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaagctctgcaagatcccagagt
DQ315779_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaagctctgcaagatcccagagt
JN664940_PreS2_P-RF-D      atgcagtggacctccacaaccttccaccaagctctgcaagatcccagagt
JN664925_PreS2_P-RF-D      atgcagtggacctccacaaccttccaccaagctctgcaagatcccagagt
JN664915_PreS2_P-RF-D      atgcagtggacctccacaaccttccaccaagctctgcaagatcccagagt
JN664933_PreS2_P-RF-D      atgcagtggacctccacaaccttccaccaagctctgcaagatcccagagt
KC875339_PreS2_P-RF-D      atgcagtggacctccacaaccttccaccaagctctgcaagatcccaaagt
KC875338_PreS2_P-RF-D      atgcagtggacctccacaaccttccatcaagctctgcaagatcccagagt
GQ205377_PreS2_P-RF-D      atgcagtggacatccacaaccttccaccaagctctgcaagatcccagagt
GQ205378_PreS2_P-RF-D      atgcagtggacctccacaaccttccaccaagctctgcaagatcccagagt
GQ205386_PreS2_P-RF-D      atgcagtggacctccacaaccttccaccaagctctgcaagatcccagagt
GQ205387_PreS2_P-RF-D      atgcagtggacctccacaaccttccaccaagctctgcaagatcccagagt
JN688715_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
JF440013_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF440011_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF439999_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF440006_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF440001_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF440000_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaagctctgcaagatcccagagc
JF440010_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF440009_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF440004_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF440005_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF439998_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF439995_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF439994_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF439996_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF440002_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF440003_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF440007_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF440012_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF440014_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF440015_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JF440017_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
MK052957_PreS2_P-RF-D      atgcagtggaactcaacaaccttccaccaaactctacaagatcccagagt
MK052969_PreS2_P-RF-D      atgcagtggaactcaacaaccttccaccatactctacaagatcccagagt
KM577666_PreS2_P-RF-D      atgcaatggaactccacaaccttccaccaaactctgcaagataccagagt
KM386676_PreS2_P-RF-D      ---cagtggacctcctcaaccttccaccaaactctgcaagatcccagagt
AB188243_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
KX827302_PreS2_P-RF-D      atgcagtggaactccacaacattccaccaaactctgcaagatcccaaagt
KU668440_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN664934_PreS2_P-RF-D      atgcagtggacctccacaaccttccaccaagctctgcaagatcccagagt
MH464835_PreS2_P-RF-D      atgcagtggaattccacaactttccaccaaactctgcaagatcccagagt
KM359442_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactttgcaagatcccagagt
MG877711_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
FJ349212_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
MH724240_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KJ647349_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM524337_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
DQ315777_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM524336_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MH724243_PreS2_P-RF-D      atgcaatggaactccacgaccttccaccaaactctacaagatcccacagc
AB270538_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctacaagatcccagagt
MH724239_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccaaagt
MF488702_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MK618439_PreS2_P-RF-D      atgcagtggaattccacaactttccaccaaactctgcaagatcccagagt
JX898690_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KJ586811_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MF967563_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JX898698_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JX898699_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JX898686_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JX898687_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JX898688_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
U95551_PreS2_P-RF-DE       atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
AB210819_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
AJ344117_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JX898693_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JX898695_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
JX898696_PreS2_P-RF-D      atgcagtggaattccacaacctttcaccaaactctgcaagatcccagagt
KM577665_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctacaaaatccaagagt
GU563560_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
KM577667_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MH464851_PreS2_P-RF-D      atgcagtggaattccacaactttccaccaaactctgcaagatcccagagt
AJ627217_PreS2_P-RF-D      atgcagtggaattccacaaccttccatcaaactctgcaagatcccagagt
KT366492_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM524359_PreS2_P-RF-D      atgcattggaactccacaaccttccaccaaactctgcaagatcccagagt
JN688689_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AY373430_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MK598653_PreS2_P-RF-D      atgcagtggaactccacaacattccatcaaactctgcaagatcccacagt
MK598652_PreS2_P-RF-D      atgcagtggaactccacaacattccatcaaactctgcaagatcccagagt
MK598654_PreS2_P-RF-D      atgcagtggaactccacaacattccatcaaactctgcaagatcccagagt
MK598656_PreS2_P-RF-D      atgcagtggaactccacaacattccatcaaactctgcaagatcccagagt
MN507850_PreS2_P-RF-D      atgcagtggaactccacaaccttccatcgaactctgcaagatcccagagt
MK618442_PreS2_P-RF-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
MK618440_PreS2_P-RF-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
MK618438_PreS2_P-RF-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
MK618444_PreS2_P-RF-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
MK618445_PreS2_P-RF-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
DQ111987_PreS2_P-RF-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
EU594435_PreS2_P-RF-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
EU594436_PreS2_P-RF-D      atgcagtggaactccacaaccttccatcaaactctgcaagatcccagagt
MH724222_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JN664943_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
AY233293_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
AY233295_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MH464846_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MH464850_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MH464852_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
MT210033_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM577663_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KM577664_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KJ647351_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KC774450_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB188245_PreS2_P-RF-D      atgcagtggaattccacaaccttccaccaaactctgcaagatcccagagt
EF103285_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
AB583679_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
GQ183486_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
KT366504_PreS2_P-RF-D      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
MH368022_PreS2_P-RF-G      atgcagtggaactccacaaccttccaccaagctctgcgagatcccagaat
KP148449_PreS2_P-RF-G      atgcagtggaactccacaaccttccaccaagctctgcaggatcccagaat
KP148441_PreS2_P-RF-G      atgcagtggaactccacaaccttccaccaagctctgcaggatcccaaaat
KP148442_PreS2_P-RF-B      atgcagtggaactccacaaacttccaccaagctctgcaggatcccagaat
KP148450_PreS2_P-RF-G      atgcagtggaactccacaaccttccaccaagctctgcaggatcccagaat
FJ023662_PreS2_P-RF-G      atgcagtggaattccacaaacttccaccaagctctgcaagaccccaggat
KP148447_PreS2_P-RF-G      atgcagtggaactccacaaccttccaccaagctctgcaggatcccagaat
KP148586_PreS2_P-RF-G      atgcagtggaactccacaaccttccaccaagctctgcaggatcccagaat
KY470996_PreS2_P-RF-G      atgcagtggaactccacaaccttccaccaagctctacaagatcccaaaat
FJ023659_PreS2_P-RF-B      atgcagtggaattccacaaccttccaccaagctctgcaagatcccagaat
KY471007_PreS2_P-RF-G      atgcagtggaactccacaaccttccaccaagctctgcaagatcccagaat
KY471004_PreS2_P-RF-G      atgcagtggaactccacaaccttccaccaagctctacaagatcccagaat
KC172106_PreS2_P-RF-G      aggcagtggaactccacaaccttccaccaagctctgcaagatcccagaat
FR714490_PreS2_P-RF-G      atgcagtggaactccacaaccttccaccaagctctgcaagatcccagaat
KY470999_PreS2_P-RF-G      atgcagtggaactccacaaccttccaccaagctctacaagatcccagaat
KY471000_PreS2_P-RF-G      atgcagtggaactccacaaccttccaccaagctctacaagatcccagaat
KY471002_PreS2_P-RF-G      atgcagtggaactccacaaccttccaccaagctctacaagatcccagaat
KY470998_PreS2_P-RF-G      atgcagtggaactccacaaccttccaccaagctctacaagatcccagaat
KY471001_PreS2_P-RF-G      atgcagtggaactccacaaccttccaccaagctctacaagatcccagaat
KY470997_PreS2_P-RF-G      atgcagtggaactccacaaccttccaccaagctctacaagatcccagaat
KY471003_PreS2_P-RF-G      atgcagtggaactccacaaccttccaccaagctctacaagatcccagaat
KY471005_PreS2_P-RF-G      atgcagtggaactccacaaccttccaccaagctctacaagatcccagaat
KY471006_PreS2_P-RF-G      atgcagtggaactccacaaccttccaccaagctctacaagatcccagaat
EU835240_PreS2_P-RF-G      atgcagtggaactccacaaccttccaccaaactctacaagatcccagagt
FJ023666_PreS2_P-RF-G      atgcagtggaactccacaaccttcaamcaagcgcttcaagatcccagagt
FJ882611_PreS2_P-RF-G      atgcagtggaattccacaaccttccaccaagctcttcaagatcccaaagt
FJ882613_PreS2_P-RF-G      atgcagtggaattccacaaccttccaccaagctcttcaagatcccagagt
FJ023665_PreS2_P-RF-G      atgcagtggaactccacaaccttccaccaagcgcttcaagatcccagagt
FJ882617_PreS2_P-RF-G      atgcagtggaattccacaaccttccaccaagctcttcaagatcccagagt
FJ882610_PreS2_P-RF-G      atgcagtggaattccacaaccttccaccaagctcttcaagatcccaaagt
FJ882614_PreS2_P-RF-G      atgcagtggaattccacaaccttccaccaagctcttcaagatcccaaagt
FJ023667_PreS2_P-RF-G      atgcagtggaactccacaaccttccaccaagctcttcaagatcccagagt
FJ023670_PreS2_P-RF-G      atgcagtggaactccacaaccttccaccaagctcttcaagatcccagagt
FJ023668_PreS2_P-RF-G      atgcagtggaactccacaaccttccaccaagctcttcaagatcccagagt
EU833891_PreS2_P-RF-G      atgcagtggaattccacaaccttccaccaagctcttcaagatcccagagt
FJ882612_PreS2_P-RF-G      atgcagtggaattccacaaccttccaccaagctcttcaagatcccagagt
FJ882618_PreS2_P-RF-G      atgcagtggaattccacaaccttccaccaagctcttcaagatcccagagt
FJ023664_PreS2_P-RF-G      atgcagtggaactccacaaccttccaccaagctcttcaagatcccagagt
FJ023673_PreS2_P-RF-G      atgcagtggaactccacaaccttccaccaagctcttcaagatcccagagt
EU833890_PreS2_P-RF-G      atgcagtggaattccactgccgtccaccaagctctgcaggatcccagagt
AB933279_PreS2_P-RF-A      atgcagtggaattccactgccttccaccaaactctgcaggatcccagagt
AB933280_PreS2_P-RF-A      atgcagtggaattccactgccttccaccaaactctgcaggatcccagagt
AB933281_PreS2_P-RF-A      atgcagtggaattccactgccttccaccaaactctgcaggatcccagagt
AB933283_PreS2_P-RF-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
MF925386_PreS2_P-RF-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB453985_PreS2_P-RF-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JF440019_PreS2_P-RF-A      atgcagtggaattccactgccctccaccaagctctgcaagaccccagagt
JF440022_PreS2_P-RF-A      atgcagtggaattccactgccttccaccaagctctgcaaaaccccagagt
AB222708_PreS2_P-RF-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
AB933282_PreS2_P-RF-A      atgcagtggaattccactgccttccaccaagctctgcaggatcccagagt
JQ707426_PreS2_P-RF-G      atgcagtggaattcccc------ccaccaagctctgcaggatcccagagt
KF219922_PreS2_P-RF-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
KP274926_PreS2_P-RF-G      atgcagtggaactccactgccttccaccaagctctgcaggatcccagagt
KX765835_PreS2_P-RF-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JQ272886_PreS2_P-RF-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
JQ272887_PreS2_P-RF-G      atgcagtggaactctacagcattccaccaagctctacaaaatcccaaagt
AB194949_PreS2_P-RF-A      gtgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
GQ161767_PreS2_P-RF-A      ---cagtggaaatccacagctttccagcaagctctgcaagatcccagagt
GQ161753_PreS2_P-RF-A      atgcagtggaattccacaaatttccaccaagctctgcaggatcccagagt
HF571060_PreS2_P-RF-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
GQ161837_PreS2_P-RF-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
GQ161838_PreS2_P-RF-A      atgcagtggaattccacagcttttcaccaagctctgcaagatcccagagt
GQ331048_PreS2_P-RF-A      atacagtggaattccacaaccttccaccaagctctgcaagatcccagagt
EF103283_PreS2_P-RF-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccacagt
EF464099_PreS2_P-RF-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KF214656_PreS2_P-RF-A      atacagtggaattccaccgctttccaccaaactctgcaagatcccagggt
HM146131_PreS2_P-RF-A      atacagtggaattccacagctttccaccaaactcttcaggatccymgagt
EF103284_PreS2_P-RF-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KJ586810_PreS2_P-RF-A      atgcagtggaactccactcagttccaccaggctctgttagatccgagggt
AY161145_PreS2_P-RF-A      atgcagtggaattccacaactttccaccaagctctacaagatcccagagt
AY161146_PreS2_P-RF-A      atgcagtggaattccacaactttccaccaagctctacaagatcccagagt
AY161140_PreS2_P-RF-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
AY161141_PreS2_P-RF-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
EF103282_PreS2_P-RF-A      atgcagtgaaactccacaaccttccaccaagctctgcaagatcccagagt
AY233277_PreS2_P-RF-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MF488705_PreS2_P-RF-A      gtgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
MF925404_PreS2_P-RF-A      atgcagtggaattccacagctttccaccaagctctgcaagatcccagagt
KF873530_PreS2_P-RF-C      atgcagtggaataccacaacattccaccaggctctgcaagatmccagagt
KF873534_PreS2_P-RF-C      atgcagtggaactccacagcatttcaccaagccctgcaagatcccagagt
KF873531_PreS2_P-RF-C      atgcagtggaactccacagcatttcaccaagccctgcaagatcccagagt
KF873532_PreS2_P-RF-C      atgcagtggaactccacagcatttcaccaagccctgcaagatcccagagt
KF873533_PreS2_P-RF-C      atgcagtggaactccacagcatttcaccaagccctgcaagatcccagagt
KF873537_PreS2_P-RF-C      atgcagtggaactccacagcakttcaccaagctctgcaagatcccagagt
KF873540_PreS2_P-RF-C      atgcagtggaactccacagcatttcaccaagctctgcaagatcccagagt
KF873538_PreS2_P-RF-C      atgcagtggaactccacagcatttcaccaagctctgcaagatcccagagt
KF873542_PreS2_P-RF-C      atgcagtggaactccacagcatttcaccaagctctgcaagatcccagagt
KF873543_PreS2_P-RF-C      atgcagtggaactccacagcatttcaccaagctctgcaagatcccagagt
KU679945_PreS2_P-RF-C      atgcagtggaactccacagcatttcaccaaactctgcaagatcccagagt
KF873535_PreS2_P-RF-C      atgcagtggaactccacagcatttcaccaagctctgcaagatcccagagt
KU679939_PreS2_P-RF-C      atgcagtggaactccacagcatttcaccaagctctgcaagatcccagagt
KU679940_PreS2_P-RF-C      atgcagtggaactccacagcatttcaccaagctctacaagatcccagagt
KU679958_PreS2_P-RF-C      atgcagtggaactccacaacattccagcaagcgctrctcgatccgagagt
KU679956_PreS2_P-RF-C      atgcagtggaactcctcagcattccatcaagctctacaagatcccagaat
KU679954_PreS2_P-RF-C      mygcagtggaactcctcagcattccatcaagctctacaagaccccaragt
KF873527_PreS2_P-RF-C      atgcagtggaactcctcagcattccatcaagctctacaagatcccagagt
KU679942_PreS2_P-RF-C      atgcagtggaactcctcagcattccatcaagctctacaagaccccagagt
KU679943_PreS2_P-RF-B      atgcagtggaactcctcagcattccatcaagctctacaagaccccaragt
KF873523_PreS2_P-RF-C      atgcagtggaactccacaacattccagcaagctctgctcgatccgagagt
KF873524_PreS2_P-RF-C      atgcagtggaactccacaacattccagcaagctctgctcgatccgagagt
KF873522_PreS2_P-RF-C      atgcagtggaactccamaacattccagcaagcgctgctcgatccgagagt
KU679941_PreS2_P-RF-C      atgcagtggaactccacaacattccagcaagcgctgctcgatccgagagt
KU679950_PreS2_P-RF-C      atgcagtggaactccacagcattccatcaagctctgcaagatcccagagt
KF873521_PreS2_P-RF-B      atgcagtggaattccacagcattccatcaagctctgcaagatcccagagt
KU679955_PreS2_P-RF-C      atgcagtggaattccacagcattccatcaagctctgcaagatcccagagt
KU679948_PreS2_P-RF-C      atgcagtggaactccacagcattccatcaagctctgcaagatcccagagt
KF873511_PreS2_P-RF-C      atgcagtggaactccacagcattccatcaagctttgcaagatcccagagt
KU679944_PreS2_P-RF-B      atgcagtggaactccacagcattccatcaagctctgcaagatcccagagt
KF873515_PreS2_P-RF-C      atgcagtggaactccacagcattccatcaagctctgcaagatcccagagt
KF873519_PreS2_P-RF-C      atgcagtggaactccacagcattccatcaagctctgcaagatcccagagt
KU679953_PreS2_P-RF-B      atgcagtggaactccacagcattccatcaagctctgcaagatcccagagt
KU679946_PreS2_P-RF-B      atgcagtggaactccacagcattccatcaagctctgcaagatcccagagt
KF873513_PreS2_P-RF-C      atgcagtggaactccacagcattccatcaagctctgcaagatcccagagt
KF873517_PreS2_P-RF-B      atgcagtggaactccacagcattccatcaagctctgcaagatcccagagt
KF873518_PreS2_P-RF-C      atgcagtggaactccacagcattccatcaagctctgcaagatcccagagt
EF494378_PreS2_P-RF-C      attcagtggaattccacaacatttcatcacactctgctagatcccagagt
KF053186_PreS2_P-RF-B      atgcagtggaactccacaacgttccatcaagctctgctagatcccagagt
KJ803778_PreS2_P-RF-B      atgcagtggaactccacaacgttccatcaagctctgctagatcccagagt
KF053179_PreS2_P-RF-B      atgcagtggaattccaccacgttccaccaaactcttcaggatccccgagt
KJ803772_PreS2_P-RF-B      atgcagtggaattccaccacgttccaccaaactcttcaggatccccgagt
KF053166_PreS2_P-RF-B      atgcagtggaactccagcacattccaccctacacttcaagatcccagagt
KJ803827_PreS2_P-RF-B      atgcagtggaactccagcacattccaccctacacttcaagatcccagagt
KJ717800_PreS2_P-RF-C      atgcagtggaactccaccaccttccaccaaactctgctagatcccagagt
KJ803791_PreS2_P-RF-C      atgcagtggaactccaccaccttccaccaaactctgctagatcccagagt
AB241109_PreS2_P-RF-C      atgcagtggaactccacaacatttcatcaagctctgctagatcccagagt
KC315400_PreS2_P-RF-C      atgcagtggaactccaccactttccaccaaactcttcaagatcccagagt
KJ717815_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ717816_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ803803_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KF053188_PreS2_P-RF-C      atgcagtggaactccaccactgtccaccaaactcttcaagatcccagagt
KJ803782_PreS2_P-RF-C      atgcagtggaactccaccactgtccaccaaactcttcaagatcccagagt
KJ717814_PreS2_P-RF-C      atgcagtggaactccaccactttccaccaaactctgctagatcccagagt
KJ803802_PreS2_P-RF-C      atgcagtggaactccaccactttccaccaaactctgctagatcccagagt
MF925389_PreS2_P-RF-D      atgcagtggaactccagaacattccaccaagctctgcaagatcccagagt
KX096713_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ377627_PreS2_P-RF-C      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX504540_PreS2_P-RF-C      gtgcaggggaactccacaacattccaacaagctctgctagatcccagagt
FJ562223_PreS2_P-RF-C      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagagt
JX036358_PreS2_P-RF-D      atgcagtggaaccccacaactttccaccaaactctgcaagatcccagggt
JQ040175_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB031265_PreS2_P-RF-C      atgcagtggaactccagcacattccaccaagctctactagatcccagagt
JF436923_PreS2_P-RF-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF925382_PreS2_P-RF-C      atgcagtggaattccagcacattccaccaagctctgctggaccccagagt
MG826147_PreS2_P-RF-C      gcgcagtggaactccacaacattccaccaagctctgctaggtcccaaagt
MG826141_PreS2_P-RF-C      atgcagtggaactccacaaccttccaccaagctctgctaggtcccaaagt
KJ598675_PreS2_P-RF-C      atgcaatggaattccacaacatttcaccaagctctgctagatcccagagt
MG826146_PreS2_P-RF-C      atgcagtggaactccacaacatttcaccaagctctgctagatcccagagt
MG826148_PreS2_P-RF-C      atgcagtggaactccacaacctttcaccaagctctgctagatcccagagt
KJ803785_PreS2_P-RF-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
FR714496_PreS2_P-RF-C      atacagtggaactccagcaaattccaccaagctctgctagatcccagagt
KJ717832_PreS2_P-RF-C      atgcagtggaactccaccacattccaccaagctctgctagctcccagagt
KJ717794_PreS2_P-RF-C      atgcagtggaattccaccacgttccaccaaactctgctagatcccagagt
KJ803788_PreS2_P-RF-C      atgcagtggaattccaccacgttccaccaaactctgctagatcccagagt
KJ803798_PreS2_P-RF-C      atgcagtggaactccagcacattccatcaagctctgctagatcccagagt
JQ027310_PreS2_P-RF-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF925381_PreS2_P-RF-C      atgcagtggaactccagcacattccaccaaactctgctagatcccagagt
KF053160_PreS2_P-RF-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ803753_PreS2_P-RF-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ803804_PreS2_P-RF-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
KJ410506_PreS2_P-RF-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
GQ924618_PreS2_P-RF-C      atgcagtggaactccagcacattccaccaagctctgctagatcccaaagt
JQ801476_PreS2_P-RF-C      atgcagtggaactccagcacattccaccaagctctgctagatcccagagt
MF925370_PreS2_P-RF-C      atgcagtggaactccaacacattccaccaagctctgctagatcccagagt
JF436919_PreS2_P-RF-C      acgcagtggaactctacaacattccaccaagctctgctagatcccagagt
AP011102_PreS2_P-RF-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
AB493842_PreS2_P-RF-C      atgcagtggaactccacaacgttccaccaagctctgttagatcccagagt
AP011103_PreS2_P-RF-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagagt
AB105172_PreS2_P-RF-C      atgcagtggaactccacaaatttccaccaagctctgctagatcccagagt
AB493840_PreS2_P-RF-C      atgcagtggaactccacagcattccaccaagctctgctagatcccagagt
AB493837_PreS2_P-RF-C      atgcagtggaactccacagcattccaccaagctctgctagatcccagagt
AB493838_PreS2_P-RF-C      atgcagtggaactccacagcattccaccaagctctgctagatcccagagt
AB493847_PreS2_P-RF-C      atgcagtggaactccacagcattccaccaagctctgctagatcccagagt
GQ358155_PreS2_P-RF-C      atgcagtggaactccacagcatttcaccaagctctgctagatcccagagt
GQ358156_PreS2_P-RF-C      atgcagtggaactccacagcattccaccaagctctgctagatcccagagt
HQ700530_PreS2_P-RF-C      atgcagtggaactctacaaccttccaccaagctctgttagatcccagagt
HQ700523_PreS2_P-RF-C      atgcagtggaactccacaaccttccaccaagctctgttagatcccagagt
HQ700531_PreS2_P-RF-C      atgcagtggaactccacaactttccaccaagctctgttagatcccagagt
HQ700532_PreS2_P-RF-C      atgcagtggaactccacaaccttccaccaagctctgttagatcccagagt
GU357843_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
GQ377590_PreS2_P-RF-C      atgaagtggaactcccccactttccaccaaactcttcaagatcccagagt
FJ562294_PreS2_P-RF-C      atgcagtggaactccaccactttccaccaaactcttctagatcccagagt
HQ700527_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
HQ700528_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
HQ700519_PreS2_P-RF-C      atgcagtggaactccacaactttccatcaagctctgctagatccccgagt
HQ700521_PreS2_P-RF-C      atgcagtggaactccacaactttccaccaagctctgctagatccccgagt
HQ700518_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgttagatcccagagt
JQ040146_PreS2_P-RF-C      atgcagtggaactccacaacattcsrccaagctctgctagaccccagagt
AB367800_PreS2_P-RF-C      gtgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU589337_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctcttctagaccccagagt
FJ032343_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctcttctagaccccagagt
HQ700526_PreS2_P-RF-C      atgcagtggaactccacaacattccatcaagctctgctagatcccagagt
GQ377539_PreS2_P-RF-C      atgcagtggaactccaccactttccaccaagctcttcaagatcccagagt
FJ562226_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaaactctgctaggtcccagagt
KC774344_PreS2_P-RF-C      atgcagtggaactccacaaccttccaccaaactctgcaagatcccagggt
JX661485_PreS2_P-RF-C      atgcagtggaactccaccactttccaccaaactcttcaagatcccagagt
EU717211_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ715345_PreS2_P-RF-C      atgcagtggaactcaacaacattccaccaagctctgctagatcccagagt
FJ715346_PreS2_P-RF-C      atgcagtggaactcaacaacattccaccaagctctgctagatcccagagt
FJ715347_PreS2_P-RF-C      atgcagtggaactcaacaacattccatcaagctctgctagatcccagagt
FJ562229_PreS2_P-RF-C      atacaatggaactcctccactttccaccaaactcttcaagatcccagagt
EU522070_PreS2_P-RF-C      atgcagtggaactccaccacattccaacaagctctgctagatcccagagt
EU871995_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgttagaccccagagt
EU871988_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgttagaccccagagt
EU871991_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgttagaccccagagt
EU871994_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgttagaccccagagt
EU871996_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgttagaccccagagt
EU871999_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgttagaccccagagt
EU871981_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgttagaccccagagt
EU871983_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgttagaccccagagt
EU871986_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgttagaccccagagt
EU871987_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgttagaccccagagt
EU871989_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgttagaccccagagt
EU871990_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgttagaccccagagt
EU871992_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgttagaccccagagt
EU871993_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgttagaccccagagt
EU871984_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgttagaccccagagt
EU871985_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgttagaccccagagt
AB367393_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaaactctgctagaccccagagt
KJ173350_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KC774188_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ377602_PreS2_P-RF-C      atgcagtggaactccaccactttccaccaaactcttcaagatcccagagt
FJ562336_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU939602_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
Y18857_PreS2_P-RF-CB       atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939577_PreS2_P-RF-C      atgcagtggaactccacaaccttccaccaagccctgctagatcccagagt
MT426530_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426466_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426471_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426544_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426523_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426479_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426462_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426499_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426557_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426524_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426485_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426456_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426455_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426467_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426527_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426541_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426460_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426522_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426562_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426546_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426540_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426539_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426533_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426526_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426515_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426512_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426469_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426492_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426519_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426538_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426514_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426503_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426481_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426569_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426564_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426563_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426560_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426558_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426575_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426556_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426555_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426553_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426549_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426545_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426542_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426537_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426531_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426534_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426518_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426517_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426509_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426508_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426504_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426502_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426554_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426500_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426543_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426559_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426489_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426488_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426486_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426483_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426480_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426478_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426473_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426470_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426465_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426464_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426461_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426457_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426459_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426487_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426496_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426507_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426547_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426572_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426463_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426468_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426472_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426475_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426476_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426477_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426482_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426484_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426490_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426491_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426493_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426494_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426495_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426497_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426498_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426501_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426505_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426506_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426510_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426511_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426513_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426520_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426521_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426525_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426528_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426529_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426532_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426536_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426550_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426551_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426561_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426565_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426566_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426567_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426568_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426570_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426571_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426573_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426574_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426576_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MT426535_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU919166_PreS2_P-RF-C      atgcagtggaactccacaactttccaccaagcactgctagatcccagagt
EU919167_PreS2_P-RF-C      atgcagtggaactccacaactttccaccaagcactgctagatcccagagt
KJ173320_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ173322_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ562267_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctttgctagaccccagagt
EU939668_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KC774324_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
GQ377633_PreS2_P-RF-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagagt
FJ032337_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccaaagt
HQ700547_PreS2_P-RF-C      atgcagtggaattccacaaacttccaccaagctctgctagatcccagagt
DQ089798_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
M38454_PreS2_P-RF-CB       atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774222_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaggctctgctagatcccagagt
GU385774_PreS2_P-RF-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagagt
GQ377548_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KR013843_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ173325_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173279_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
JF436922_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562227_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
AB670303_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
AB049609_PreS2_P-RF-C      gtgcagtggaactccaccacattccaccaagctctgctagatcccagagt
KY363263_PreS2_P-RF-C      atacagtggaactccacaacattccaccaggctctgctagatcccagagt
AB367400_PreS2_P-RF-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
GQ377565_PreS2_P-RF-C      atgcagtggaactccaccacattccaccaagctctgctagaccccagagt
GQ377581_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AF461361_PreS2_P-RF-C      atgcagtggaattccaccacattccaccaagctctgctagaccccagagt
KR013816_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
GQ377534_PreS2_P-RF-C      atgcagtggaactccactacattccaccaagctctgctagaccccagagt
MG826149_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
GQ377594_PreS2_P-RF-C      atgcagtggaattccaccactttccaccaagctctgctagatcccagagt
FJ386646_PreS2_P-RF-C      atgcagtggaactccacaacgttccaccaagctctgctagacccctgagt
AF411409_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU939565_PreS2_P-RF-C      atgcagtggaactccactacattccaccaagctctactagaccccagagt
GQ377520_PreS2_P-RF-C      atgcagtggaactccactacattccaccaagctctgctagaccccagagt
KJ173329_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
KJ173326_PreS2_P-RF-C      atgcagtggaacctcacaacattccaccaagctctgctagaccccagagt
MG893559_PreS2_P-RF-C      atgcagtggaactccacaacatttcaccaagctctgctagatcccagagt
KU964351_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
JX661498_PreS2_P-RF-C      atgcagtggaactccacaactttccaccaaactctgctagaccccagagt
GQ377607_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB642096_PreS2_P-RF-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
EF494376_PreS2_P-RF-C      ataaagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ562305_PreS2_P-RF-C      atacagtggaactccacaacattccaccaagctctgctagaccccagagt
EU939589_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KM875422_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173358_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgctagaccccagagt
EU939551_PreS2_P-RF-C      atgcagtggaactccagcacattccaccaagctctgctagaccccagagt
FJ787446_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ787480_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774183_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
JX661487_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ377556_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ377544_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
GQ377516_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccaaagt
FJ562314_PreS2_P-RF-C      atgcagtggaactccacaacatttcaccaagctctgctagatcccagagt
FJ386649_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
EU787444_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AY123424_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774246_PreS2_P-RF-C      atgcagtggaactcaacaacattccaccaagctctgctagatcccagagt
KC774258_PreS2_P-RF-C      atgcagtggaactcaacaacattccaccaagctctgctagatcccagagt
KC774317_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
KC774322_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
MG893561_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctactagaccccagagt
KC774186_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774230_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173349_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KM213033_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774349_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
MK321265_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagancccagagt
MK720627_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
MK720628_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KR013806_PreS2_P-RF-C      gtgcagtggaactccacaacattccaccaagctctgctagaccccagagt
LC279263_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgttagaccccagagt
LC279264_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgttagaccccagagt
LC279265_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgttagaccccagagt
LC279266_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgttagaccccagagt
LC279267_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgttagaccccagagt
KC774332_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774263_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgttagatcccagagt
KC774341_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ386578_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ386585_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY470893_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963883_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774328_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ386633_PreS2_P-RF-C      atgcagtggaactccacagcattccaccaagctctgctagaccccagagt
EU871997_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KY881840_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
AB198084_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
JX661494_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctggatcccagagt
FJ562287_PreS2_P-RF-C      atacagtggaactccacaacattccaccaagctctgctagaccccagagt
LC458432_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774294_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
FJ386581_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
JX429896_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
Y18856_PreS2_P-RF-CB       atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU963993_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963990_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173299_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KJ173300_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
JX026887_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU963991_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963994_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963995_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963998_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU963999_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964001_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KU964003_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
HQ700520_PreS2_P-RF-C      atgcagtggaatgccaaaacattccaccaagctctgctagatcccagagt
KU695742_PreS2_P-RF-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
X75656_PreS2_P-RF-CB       atgcagtggaactccacaacattccaacaagctctgctagatcccagagt
HQ700542_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctactagatcccagagt
KU695744_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU695746_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
HQ700505_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU695741_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU695743_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AP011108_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
HQ700507_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
HQ700508_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
HQ700509_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaaactctgctagatcccagagt
HQ700515_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaaactctgctagatcccagagt
HQ700580_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
HQ700557_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
HQ700560_PreS2_P-RF-C      atgcagtggaatkccacaacattccaccaagctctgctagatcccagagt
HQ700498_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
HQ700499_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
KU695745_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctactagatcccagagt
HQ700554_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
HQ700462_PreS2_P-RF-C      atacagtggaattccacaacattccaccaagctctgctagatcccagagt
HQ700485_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
JX036329_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
AB033557_PreS2_P-RF-C      atgcagtggaactccacgacattccaccaagctctgctagatcccagagt
JX036328_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
AY206374_PreS2_P-RF-C      acgcagtggaactccacaactttcctccaaactctgctagatcccaaagt
FJ562317_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
MG826144_PreS2_P-RF-C      atgcagtggaacaccacaacattccaccaggctctactagatcccagagt
GQ377560_PreS2_P-RF-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
KC774198_PreS2_P-RF-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
KC774201_PreS2_P-RF-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
KC774193_PreS2_P-RF-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
KC774323_PreS2_P-RF-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
KC774291_PreS2_P-RF-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
KC774307_PreS2_P-RF-C      atgcagtggaactccacaactttccaccaagctctgctagatcccagagt
LC416040_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaggctctgctagatcccaaagt
KT003704_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AP011104_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AP011105_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KP148352_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctactagatcccagagt
EU939547_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaaactctgctagatccaagagt
JQ040148_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatccaagagt
AB300369_PreS2_P-RF-C      gtgcagtggaactcaacaacattccaacaagctctgctagatcccagagt
AB205152_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
FJ386586_PreS2_P-RF-C      acgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB195950_PreS2_P-RF-C      gtgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
AB195951_PreS2_P-RF-C      gtgcagtggaactccacaacgttccaccaagctctgctagatcccagagt
JF828938_PreS2_P-RF-C      atacagtggaattccacaacattccaccaagctctgctagatcccagagt
JF828936_PreS2_P-RF-C      atacagtggaattccacaacattccaccaagctctgctagatcccagagt
JF828935_PreS2_P-RF-C      atacagtggaattccacaacattccaccaagctctgctagatcccagagt
JF828933_PreS2_P-RF-C      atacagtggaattccacaacattccaccaagctctgctagatcccagagt
JF828934_PreS2_P-RF-C      atacagtggaattccacaacattccaccaagctctgctagatcccagagt
JQ040142_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgctagatccaaaagt
JX661486_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatccaagagt
MG893554_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatccaaaagt
MG893555_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatccaaaagt
AB367419_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctttgctagatcccagagt
MG826142_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KC774305_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AF233236_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU881995_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccaaagt
KC774234_PreS2_P-RF-C      atgcagtggaactccaccacattccaccaaactctgctagatcccagagt
EU916232_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964316_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagatctgctagatcccagagt
KU964313_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964005_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964006_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964007_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964008_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964009_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964010_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964303_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964304_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964305_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964307_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964308_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964309_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964310_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964311_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964312_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964314_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964315_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964317_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU964306_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KJ410520_PreS2_P-RF-C      atgcagtggaattccacaacattccaccaagctctgctagatcccagagt
AB195940_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctttgctagatcccagagt
AB195941_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctttgctagatcccagagt
KC774212_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JQ732168_PreS2_P-RF-C      atgcagtggaactccaccacattccaccaagctctgctagatcccagagt
AY040627_PreS2_P-RF-C      atgcagtggaactccaccactttccaccaagctctgctagatcccagagt
FJ715387_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ715384_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctaggtcccagagt
FJ715385_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ715411_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ715412_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ715413_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ715414_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AY247030_PreS2_P-RF-C      atgcagtggaactccaccacattccatcaagctctgctagatcccagagt
HM750133_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AY123041_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AF330110_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU939606_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU963862_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ377522_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
FJ386635_PreS2_P-RF-C      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ377611_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU963869_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU963868_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU963859_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU963856_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU963857_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU963858_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU963860_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU963861_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU963863_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU963864_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU963865_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU963866_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU963867_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
KU963870_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU916239_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU916241_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
EU916240_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JN400086_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB195956_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB195957_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB195939_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AB195955_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
AY167095_PreS2_P-RF-C      atgcagtggaactccacaacattccaccaagctctactagatcccagagt
FJ386674_PreS2_P-RF-B      acgcagtggaactccaccactttccaccaaactcttcaagatcccagagt
MF925402_PreS2_P-RF-B      atgcagtggaactccaccactttccaccaaactcttcaagatcccagagt
KX774505_PreS2_P-RF-B      atgcagtggaactccaccacgttccaccaaactcttcaagatccgagagt
EU939631_PreS2_P-RF-B      atacagtggaactccacaacattccaccaagctctgctagatcccagagt
EU882006_PreS2_P-RF-C      acgcagtggaactccaccactttccaccaagctctgctagatcccagagt
EU939620_PreS2_P-RF-C      atacggtggaactccaccactttccaccaaactcttcaagatcccagagt
HQ684848_PreS2_P-RF-C      atgcagtggaactccaccactttccaccaaactctgcaagatcccagagt
EU939630_PreS2_P-RF-C      atgcagtggaactccaccactttccaccaaactcttcaagatcccagagt
EU939623_PreS2_P-RF-C      atgcagtggaattccaccaaattccaccaaactcttcaagatcccagagt
FJ562328_PreS2_P-RF-C      atgaagtggaactcccccactttccaccaaactctccaagatcccagagt
FJ562247_PreS2_P-RF-C      atgcagtggaactccaccactttccaccaaactcttcaagatcccagagt
GQ377604_PreS2_P-RF-C      atgcagtggaactccaccactttccaccaaactcttcaagaccccagagt
GQ377573_PreS2_P-RF-C      atgcagtggaactccaccactttccaccaaactcttcaagatcccagagt
GQ377613_PreS2_P-RF-C      atgcagtggaactccaccactttccaccaaactcttcaagaccccagagt
GQ377592_PreS2_P-RF-C      atgcagtggaactccaccactttccaccaaactcttcaagatcccagagt
EU939621_PreS2_P-RF-C      atgcagtggaactccaccactttccaccaaactcttcaagatcccagagt
JQ040174_PreS2_P-RF-C      atgcagtggaactccaccactttccaccaaactcttcaagatcccagagt
GQ377549_PreS2_P-RF-C      atgcagtggaactccaccactttccaccaaactcttcaagatcccagagt
GQ377634_PreS2_P-RF-C      atgcagtggaactccaccactttccaccaaactctgcaagatcccagagt
GQ377626_PreS2_P-RF-C      atgcagtggaactccaccactttccaccaaactcttcaagatcccagagt
GQ377564_PreS2_P-RF-C      atgcagtggaactccrccactttccaccaaactcttcaagatcccagagt
GQ377596_PreS2_P-RF-C      atgcagtggaactcaaccactttccaccaaactcttcaagatcccagagt
GQ377614_PreS2_P-RF-C      atgcagtggaactccaccactttccaccaaactcttcaagatcccagagt
HQ684849_PreS2_P-RF-B      atgcagtggaactccacaacattccaccaagctctgcaagaccccagagt
KC774178_PreS2_P-RF-B      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KC774364_PreS2_P-RF-B      atgcagtggaactccacaacattccaccaagctctgctagaccccagagt
KP148337_PreS2_P-RF-B      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
JQ412091_PreS2_P-RF-B      atgcagtggaactccacaacatttcaccaagctctgctagatcccagagt
GQ377630_PreS2_P-RF-B      atgcagtggaactccacaacattccaccaagctctgctagatcccagagt
GQ377635_PreS2_P-RF-B      atgcagtggaactccacaacattccaccaagctctgctagatccaagagt
MG826150_PreS2_P-RF-B      gcgcagtggaactccaccactttccaccaaactcttcaagatcccaaagt
MK052976_PreS2_P-RF-B      atgcagtggaactccaccactttccaccaagctcttcaagatcccagagt
MG826145_PreS2_P-RF-B      atgcagtggaactccacaaccttccaccaagctctacaagatcccagaat
MH746813_PreS2_P-RF-B      atgcagtggaactccacaaccttccaccaagctctacaagatcccagaat
MH746811_PreS2_P-RF-B      atgcagtggaacatcaccactttccaccaaactctccaagatcccagagt
MH746812_PreS2_P-RF-B      atgcagtggaacatcaccactttccaccaaactctccaagatcccagagt
GQ377595_PreS2_P-RF-B      atgcagtggaactccaccactttccaccaaactcttcaagatcccagagt
MH094410_PreS2_P-RF-B      atgcagtggaactccaccactttccaccaaactcttcaagatcccagagt
MG826151_PreS2_P-RF-B      gcgcagtggaactccaccaccttccaccaaactcttcaagatcccagagt
EU939629_PreS2_P-RF-B      atacagtggaattccacaacattccaccaagctctgctagaccccagagt
KC793112_PreS2_P-RF-B      atgcggtggaactccaccactttccaccaaactcttcaagatcccagagt
JQ801477_PreS2_P-RF-B      atgcattggaactccaccactttccgccaaactcttcaagatcccagagt
MK052967_PreS2_P-RF-B      atgcagtggaactccaccactttccaccaagctcttcaagatcccagagt
MK052968_PreS2_P-RF-B      atgcagtggaactccaccactttccaccaagctcttcaagatcccagagt
MK052970_PreS2_P-RF-B      atgcagtggaactccaccactttccaccaagctcttcaagatcccagagt
EU939627_PreS2_P-RF-B      atgcagtggaactccaccactttccaccaaactcttcaagatcccagagt
KJ410497_PreS2_P-RF-B      atgcagtggaattccaccactttccaccaaactcttcaagatcccagagt
EU660227_PreS2_P-RF-B      atgcagtggaactccaccactttccaccaaactcttcaagatcccagagt
KC774414_PreS2_P-RF-B      atgcagtggaactccaccactttccaccaaactcttcaagatcccagagt
                                  * *                                 *      

KJ803822_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccgaaacagtaaacc
HE981179_PreS2_P-RF-F      aagggctctgtatgttcctgctggtggctccagttcagagacacagaacc
KJ586803_PreS2_P-RF-A      aagggctctgtattttcctgctggtggccccagttcagagacacagaacc
GQ161806_PreS2_P-RF-E      aagaggtcaggattttcctgctggtggctccagttccggaacagtgaacc
FN594767_PreS2_P-RF-D      aagaggcctgtattttcctgctggtggctccagttccggaacagtaaacc
KX660685_PreS2_P-RF-D      cagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683641_PreS2_P-RF-D      cagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX036359_PreS2_P-RF-D      aaggggcctatattttcctgctggtggctccagctccggaacagtaaacc
JN257154_PreS2_P-RF-D      gaggggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683675_PreS2_P-RF-D      gaaaggcctgtgcttccctgctggtggctccagttcaggaacagtaaacc
KX357641_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
X68292_PreS2_P-RF-DA       gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY341335_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacggtaaacc
JN257189_PreS2_P-RF-D      gaaaggcctgtatytccctgctggtggctccagttcaggaacagtaaacc
AB674434_PreS2_P-RF-D      gagaggcctgtctttccctgctggtggctccagttcaggaacagtaaacc
MF925397_PreS2_P-RF-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257204_PreS2_P-RF-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
JN257191_PreS2_P-RF-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
JN642160_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF925396_PreS2_P-RF-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KJ803771_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaagcc
X80925_PreS2_P-RF-DE       gagaggcctgtacttccctgctggtggctccagttcaggaacagtaaacc
JN664946_PreS2_P-RF-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF925371_PreS2_P-RF-D      gaaagacctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU594406_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ687532_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF925360_PreS2_P-RF-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
MF925401_PreS2_P-RF-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN688717_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN507835_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM524357_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KR905422_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT366503_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF925388_PreS2_P-RF-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
MF925392_PreS2_P-RF-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN040803_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtacacc
X65259_PreS2_P-RF-DA       gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX036330_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF754616_PreS2_P-RF-D      gaaaggcctgtattaccatgctggtggctccagttcaggaacagtaaacc
JF754613_PreS2_P-RF-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
JN040798_PreS2_P-RF-D      gggaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB674436_PreS2_P-RF-D      gagaggcctgtattcccctgctggtggctccagttcagaaacagtaaacc
JN642137_PreS2_P-RF-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
JN257216_PreS2_P-RF-D      ragaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN642139_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB330368_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257206_PreS2_P-RF-D      garaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
JN257207_PreS2_P-RF-D      garag---------tccctgctggtggctccagttcaggaacagtaaacc
MF925384_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB674433_PreS2_P-RF-D      gagaagcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB674432_PreS2_P-RF-D      gagaggcctgaatctccctgctggtggctccagttcaggaacagtaaacc
KF471643_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN642127_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257174_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257164_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN257210_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN642141_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN642152_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KY470853_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX036357_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FN594770_PreS2_P-RF-D      gagaggcctgtatctccctgctggtggctccatttcaggaacagtaaacc
KY470844_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KY470843_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KY470846_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KY470847_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KY470849_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KY470850_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KY470855_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KY470856_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KY470854_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904430_PreS2_P-RF-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
KM606741_PreS2_P-RF-D      gagaggccttcatttccctgttggtggctccagttcaggaacagtaaacc
FJ349207_PreS2_P-RF-D      gagaggcctttatctccctgctggtggctccagttcaggaacagtaaacc
AM494716_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904436_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904414_PreS2_P-RF-D      aagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904416_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904417_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
DQ991753_PreS2_P-RF-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
FJ904441_PreS2_P-RF-D      gagaggcctttatttccctgctggtggctccagttcaggaacagtaaacc
KX357627_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaagcc
KP168421_PreS2_P-RF-D      gagaggcctgtacctccctgctggtggctccagttcaggaacagtgaacc
FN594771_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904425_PreS2_P-RF-D      gagaggcctttatttccctgctggtggctccagttcaggaacagtaaacc
KX357624_PreS2_P-RF-D      gagaggcctg------cctgctggtggctccagttcaggaacagtaagcc
KX357631_PreS2_P-RF-D      gagaggcctg------cctgctggtggctccagttcaggaacagtaagcc
FJ904405_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP995112_PreS2_P-RF-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
KP168420_PreS2_P-RF-D      gagaggcctgtacttccctgctggtggctccagttcaggaacagtgaacc
KU736916_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904398_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904442_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KU711666_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FN594769_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904401_PreS2_P-RF-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904404_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904396_PreS2_P-RF-D      gagagacctgaattcccctgctggtggctccagttcaggaacagtaaacc
FJ904400_PreS2_P-RF-D      gagaggcctttatttccctgctggtggctccagttcaggaacagtaaacc
KU736917_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KU736914_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KU736915_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH685719_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX827299_PreS2_P-RF-D      aagaggcctttatttccctgctggtggctccagttcaggaacagtaaacc
GU177079_PreS2_P-RF-D      gagaggcctgtatttccctgctggtgggtccagttcaggaacagtaaacc
FJ904403_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX357628_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaagcc
KM606751_PreS2_P-RF-D      gagaggtctttatttccctgctgggtgctccagttcaggaacagtaaacc
FJ904444_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF170740_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ161754_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904447_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904440_PreS2_P-RF-D      gagaggcctttatctccctgctggtggctccagttcaggaacagtaaacc
FJ904394_PreS2_P-RF-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
KX357636_PreS2_P-RF-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
KX357634_PreS2_P-RF-D      gagaggcctgtattcccctgctggtggctccagttcaggaacagtaagcc
FJ904407_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904408_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaatagtaaacc
FJ904409_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaatagtaaacc
KX357629_PreS2_P-RF-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaagcc
KX357626_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaagcc
KX357625_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaagcc
KU736923_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904406_PreS2_P-RF-D      gagaggcctttatttccctgctggtggctccagttcaggaacagtaaacc
KM606750_PreS2_P-RF-D      gagaggcctttatttccctgctggtggctccagttcaggaacaataaacc
KX357635_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaagcc
KX357623_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaagcc
KX357633_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaagcc
KX357630_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaagcc
KP168416_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP168417_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP168418_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KU736921_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KU736922_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KJ647356_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683620_PreS2_P-RF-D      gagagacctgtgtttccctgctggtggctccagttcaggaacagtaaacc
MN683662_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683581_PreS2_P-RF-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
MN683730_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KY629632_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttccggaacagcaaacc
KT991420_PreS2_P-RF-D      gagaggcctgtacttccctgctggtggctccagttcaggaacagtaaacc
KT991423_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ562278_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT991417_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683624_PreS2_P-RF-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KC774484_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774498_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774431_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774449_PreS2_P-RF-D      gaggggcctgtatctccctgctggtggctccagttcaggaacagtgaacc
MN683582_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683655_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683634_PreS2_P-RF-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT991421_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT991419_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774478_PreS2_P-RF-D      gcgaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774480_PreS2_P-RF-D      gcgaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774452_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtgaacc
AY862865_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggcacagtaaacc
AY862864_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggcacagtaaacc
AY862866_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggcacagtaaacc
MN683618_PreS2_P-RF-D      gaaaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
KC774479_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KY670781_PreS2_P-RF-D      gagaggcc------tccctgctggtggctccagttcaggaacagtaaacc
KC774463_PreS2_P-RF-D      gagaggcctgtacttccctgctggtggctccagttcaggaacagtaaacc
KC774489_PreS2_P-RF-D      gagaggcctgtacttccctgctggtggctccagttcaggaacagtaaacc
MN683571_PreS2_P-RF-D      gagaggcctgtacttccctgctggtggctccagttcaggaacagtaaacc
MN683592_PreS2_P-RF-D      gagaggcctgtacttccctgctggtggctccagttcaggaacagtaaacc
MN683594_PreS2_P-RF-D      gagaggcctgtacttccctgctggtggctccagttcaggaacagtaaacc
MN683609_PreS2_P-RF-D      gagaggcctgtacttccctgctggtggctccagttcaggaacagtaaacc
KC774487_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX036332_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF491448_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683622_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF491455_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY817513_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY817509_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB270535_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683627_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN650068_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774442_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtgaacc
EU787435_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
DQ478898_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
KC774492_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
KX660677_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggcttcagttcaggaacagtaaacc
MN683668_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggcttcagttcaggaacagtaaacc
KF917451_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683713_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683714_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774490_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774481_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY817510_PreS2_P-RF-D      gagaggcctgtatttccctgttggtggctccagttcaggaacagtaaacc
MN683645_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683640_PreS2_P-RF-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683623_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683610_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcagggacagtaaacc
MN683579_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683574_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KU519423_PreS2_P-RF-D      gagaggcttgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683674_PreS2_P-RF-D      gagaggcttgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774486_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774483_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
KC774474_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774454_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
KC774453_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774439_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
KP276254_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KP276255_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF491449_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774470_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774458_PreS2_P-RF-D      gagaggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KC774428_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacaccaatcc
MN683717_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683597_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683652_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683684_PreS2_P-RF-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683676_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagcaaacc
MN683657_PreS2_P-RF-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683656_PreS2_P-RF-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683654_PreS2_P-RF-D      gaggggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683639_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683625_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683611_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
MN683603_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683596_PreS2_P-RF-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683572_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX660675_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
MN683607_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
MN683613_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
MN683614_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
MN683615_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
MN683666_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtgaacc
KC774461_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagcaaacc
KC774447_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
DQ478889_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY817512_PreS2_P-RF-D      gggaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY800249_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774435_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtgaacc
KC774455_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtgaacc
KC774443_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtgaacc
MN683683_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683626_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774466_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683621_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683637_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774448_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF491451_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683619_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774488_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774493_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774422_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU787434_PreS2_P-RF-D      gagaggcttgtatttccctgctggtggctccagttcaggaacagtaaacc
AY817515_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774457_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683650_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774495_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774420_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774426_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774475_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX660674_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
DQ478886_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774476_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX660680_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683605_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683664_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683665_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683635_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683659_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683658_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683678_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683670_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683663_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683643_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683644_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683647_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683649_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683642_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683638_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683617_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683616_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683612_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683590_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683586_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN657317_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683632_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683660_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683661_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN657316_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN657315_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683580_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KU519422_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683672_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774494_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774434_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774433_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774432_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774430_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774468_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774425_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagcaaacc
KC774424_PreS2_P-RF-D      gagaggcttgtatttccctgctggtggctccagttcaggaacagtaaacc
JX429898_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774472_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774497_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774499_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683630_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683651_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683653_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF491456_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
DQ478897_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774423_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC774471_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683636_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN683669_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
DQ478887_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
DQ478892_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700492_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ904437_PreS2_P-RF-D      gaaaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
AB674504_PreS2_P-RF-D      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
DQ478890_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacaacaaacc
MN683588_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683712_PreS2_P-RF-D      gagaggcctatatctccctgctggtggctccagttcaggaacagtaaacc
KT991427_PreS2_P-RF-D      gagaggcctatatctccctgctggtggctccagttcaggaacagtaaacc
MN683721_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683722_PreS2_P-RF-D      gagaggcctatatctccctgctggtggctccagttcaggaacagtaaacc
KX660686_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683707_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683716_PreS2_P-RF-D      gagaggcctatatctccctgctggtggctccagttcaggaacagtaaacc
MN650076_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagcaaacc
MN683671_PreS2_P-RF-D      gagaggcctatatctccctgctggtggctccagttcaggaacagtaaacc
MN683673_PreS2_P-RF-D      gagaggcctatatctccctgctggtggctccagttcaggaacagtaaacc
MN683692_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683628_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacattaaacc
KX660684_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683706_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
KT991424_PreS2_P-RF-D      gagaggcttatatctccctgctggtggctccagttcaggaacagtaaacc
HM750144_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN650069_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683677_PreS2_P-RF-D      gagaggcctatatctccctgctggtggctccagttcaggaacagtaaacc
MN683720_PreS2_P-RF-D      gaaaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683718_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683688_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN650083_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN650081_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN650082_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN650084_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN650080_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX660689_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683711_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
KC774485_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
HM750146_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
HM750145_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
HM750143_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
FJ562263_PreS2_P-RF-D      gaaaggcctatatctccctgctggtggctccagttcaggaacagtaaacc
AY817511_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
AY057948_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683700_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683694_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
HM750147_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcagggacagtaaacc
HM750148_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
KC774482_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683699_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683703_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683697_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683587_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683725_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683719_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683715_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683696_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683680_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN650087_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683687_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN650085_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN650072_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN650073_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN650074_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN650075_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN650077_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN650078_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN650086_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
KX354997_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
KP276253_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
KC774456_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
HM750150_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
FJ349241_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683686_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683693_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683724_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
HM750142_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
HM750149_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
KP276256_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN650079_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683689_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683690_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683691_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683695_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683723_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683584_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683679_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
MN683685_PreS2_P-RF-D      gagaggcctatatttccctgctggtggctccagttcaggaacagtaaacc
KP288875_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
J02202_PreS2_P-RF-DE       gagaggcctgtatttccctgctggtggctccagttcagggacagtaaacc
MF618346_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KJ470898_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700494_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB048702_PreS2_P-RF-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
HQ700579_PreS2_P-RF-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700585_PreS2_P-RF-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700536_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700535_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagtttaggaacagtaaacc
MH481862_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcagggatagtaaacc
MH481861_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcagggatagtaaacc
MH481860_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcagggatagtaaacc
MH481858_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcagggatagtaaacc
MH481859_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcagggatagtaaacc
HQ700534_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700541_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700540_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700539_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700493_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB048703_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700538_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700537_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700533_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700582_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700503_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700500_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB033559_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700524_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700525_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700497_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700501_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700581_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700583_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
HQ700584_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KJ470897_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF192835_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF192840_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF192833_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF192836_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF192837_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF192838_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF192839_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF192841_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF618347_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KJ470887_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ692536_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KF779353_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KJ470884_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KJ470886_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KJ470888_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KJ470890_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KJ470891_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU185780_PreS2_P-RF-A      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KC012653_PreS2_P-RF-A      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
DQ464164_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
DQ464165_PreS2_P-RF-D      gagaggcctgtatctccctgctggtggctccagttcaagaacagtaaacc
DQ464166_PreS2_P-RF-D      gagaggcctgtatctccctgctggtggctccagttcaagaacagtaaacc
DQ464167_PreS2_P-RF-D      gagaggcctgtatctccctgctggtggctccagttcaagaacagtaaacc
AF297619_PreS2_P-RF-D      caggggtctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY230120_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY236161_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AF297620_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN664935_PreS2_P-RF-D      gaggggcctgtatttccctgctggtggctcaagttccggaacagtaaacc
FJ349221_PreS2_P-RF-D      gagaggcctgaatttccctgctggtggctccagttcaggaacagtaaacc
AJ627221_PreS2_P-RF-D      gagaggcctgaatttccctgctggtggctccagttcaggagcagtaaacc
MK541689_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF488699_PreS2_P-RF-D      gagaggcctgaatcgccctgctggtggctcaacttcaggaacagtaaacc
JN664929_PreS2_P-RF-D      gagaggccagaatttccctgctggtggctccagttcaggaacagtaaacc
AB033558_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ205379_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacggtaaacc
MK516279_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK516280_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT366505_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctcaacttcaggaacagtaaacc
DQ315779_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctcaacttcaggaacagtaaacc
JN664940_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctcaacttcaggaacagtaaacc
JN664925_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctcaacttcaggaacagtaaacc
JN664915_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctcaacttcaggaacagtaaacc
JN664933_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctcaacttcaggaacagtaaacc
KC875339_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctcaacttcaggaacagtaaacc
KC875338_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctcaacttcaggaacagtaaacc
GQ205377_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctcaacttcaggaacagtaaacc
GQ205378_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctcaacttcaggaacagtaaacc
GQ205386_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctcaacttcaggaacagtaaacc
GQ205387_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctcaacttcaggaacagtaaacc
JN688715_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JF440013_PreS2_P-RF-D      gaggggcctgtatctccctgctggtggctccagttcaggagcagtaaacc
JF440011_PreS2_P-RF-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439999_PreS2_P-RF-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF440006_PreS2_P-RF-D      gaggggcctgtatctccctgctggtggctccagttcaggagcagtaaacc
JF440001_PreS2_P-RF-D      gaggggcctgtatttccctgctggtggctccagtccaggagcagtaaacc
JF440000_PreS2_P-RF-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF440010_PreS2_P-RF-D      gaggggcctgtatttccccgctggtggctccagttcaggagcagtaaacc
JF440009_PreS2_P-RF-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF440004_PreS2_P-RF-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF440005_PreS2_P-RF-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439998_PreS2_P-RF-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439995_PreS2_P-RF-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439994_PreS2_P-RF-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF439996_PreS2_P-RF-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF440002_PreS2_P-RF-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF440003_PreS2_P-RF-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF440007_PreS2_P-RF-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF440012_PreS2_P-RF-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF440014_PreS2_P-RF-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF440015_PreS2_P-RF-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JF440017_PreS2_P-RF-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
MK052957_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK052969_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM577666_PreS2_P-RF-D      gacaggcctgaatttccctgctggtggctccagttcaggaacagtaaacc
KM386676_PreS2_P-RF-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
AB188243_PreS2_P-RF-D      gaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KX827302_PreS2_P-RF-D      gagaggcctgactttccctgctggtggctccagttcaggaacagtaaacc
KU668440_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN664934_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH464835_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttccggaacagtaaacc
KM359442_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MG877711_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
FJ349212_PreS2_P-RF-D      gagaggcctgtatctccctgctggtggctccagttcaggagcagtaaacc
MH724240_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KJ647349_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM524337_PreS2_P-RF-D      gagaggcctgaatttccctgctggtggctccagttcaggaacagtaaacc
DQ315777_PreS2_P-RF-D      gagaggcctgaatttccctgctggtggctccagttcaggaacagtaaacc
KM524336_PreS2_P-RF-D      gagaggcctgaatttccctgctggtggctccagttcaggaacagtaaacc
MH724243_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB270538_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH724239_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MF488702_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK618439_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX898690_PreS2_P-RF-D      gaggggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
KJ586811_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
MF967563_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JX898698_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JX898699_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JX898686_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JX898687_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JX898688_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
U95551_PreS2_P-RF-DE       gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
AB210819_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AJ344117_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX898693_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JX898695_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
JX898696_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggagcagtaaacc
KM577665_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GU563560_PreS2_P-RF-D      gagaagcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM577667_PreS2_P-RF-D      gcgaggcctgtatttccctgctggtggctccagttcaggaactgtaaacc
MH464851_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AJ627217_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT366492_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM524359_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccaattcaggaacagtaaacc
JN688689_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY373430_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598653_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598652_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598654_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MK598656_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MN507850_PreS2_P-RF-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
MK618442_PreS2_P-RF-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
MK618440_PreS2_P-RF-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
MK618438_PreS2_P-RF-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
MK618444_PreS2_P-RF-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
MK618445_PreS2_P-RF-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
DQ111987_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594435_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EU594436_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggcttcagttcaggaacagtaaacc
MH724222_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JN664943_PreS2_P-RF-D      gagaggcctgtattcccctgctggtggctccagttcaggaacagtaaacc
AY233293_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
AY233295_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH464846_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH464850_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH464852_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MT210033_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM577663_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KM577664_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KJ647351_PreS2_P-RF-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
KC774450_PreS2_P-RF-D      gagagggctgtatttccctgctggtggctccagttcaggaacagtaaacc
AB188245_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
EF103285_PreS2_P-RF-D      gagaggcctgtatctccctgctggtggctccagttcaggaacagtaaacc
AB583679_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
GQ183486_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
KT366504_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
MH368022_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KP148449_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctacagttcaggaacagtaaacc
KP148441_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KP148442_PreS2_P-RF-B      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
KP148450_PreS2_P-RF-G      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
FJ023662_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KP148447_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KP148586_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KY470996_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ023659_PreS2_P-RF-B      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KY471007_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KY471004_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KC172106_PreS2_P-RF-G      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaaacc
FR714490_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KY470999_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KY471000_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KY471002_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KY470998_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KY471001_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KY470997_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KY471003_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KY471005_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KY471006_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU835240_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ023666_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ882611_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ882613_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ023665_PreS2_P-RF-G      caggggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
FJ882617_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ882610_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ882614_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ023667_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ023670_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ023668_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU833891_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ882612_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ882618_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ023664_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
FJ023673_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
EU833890_PreS2_P-RF-G      caggggtctgaattttcctgctggtggctccagttcaggaacagtaaacc
AB933279_PreS2_P-RF-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
AB933280_PreS2_P-RF-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
AB933281_PreS2_P-RF-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
AB933283_PreS2_P-RF-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
MF925386_PreS2_P-RF-A      caggggtctgtatcttcctgctggtggctccagttcaggaacagtaaacc
AB453985_PreS2_P-RF-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF440019_PreS2_P-RF-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JF440022_PreS2_P-RF-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB222708_PreS2_P-RF-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
AB933282_PreS2_P-RF-A      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
JQ707426_PreS2_P-RF-G      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF219922_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
KP274926_PreS2_P-RF-G      caggggtctgtattttcctgctggtggctccagttcaggaacagtaaacc
KX765835_PreS2_P-RF-G      caggggcctgtatcttcctgctggtggctccagttcagggatagtgaacc
JQ272886_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
JQ272887_PreS2_P-RF-G      caggggcctgtattttcctgctggtggctccagttcagggatagtgaacc
AB194949_PreS2_P-RF-A      caggggcctgtatcttcctgctggtggctccagttcaggaacagtaagcc
GQ161767_PreS2_P-RF-A      caggggcctgccctttcctgctggtggctccagttcaggaacagtaaacc
GQ161753_PreS2_P-RF-A      aaggggcctgtattttcctgctggtggctccagttcagaaacagtaaacc
HF571060_PreS2_P-RF-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
GQ161837_PreS2_P-RF-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaccc
GQ161838_PreS2_P-RF-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaccc
GQ331048_PreS2_P-RF-A      caggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
EF103283_PreS2_P-RF-A      caggggactgtattttcctgctggtggctccagttcacgaacactcaacc
EF464099_PreS2_P-RF-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KF214656_PreS2_P-RF-A      cagaggcctgtatttccctgctggtggctccagttcagggacactcaacc
HM146131_PreS2_P-RF-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
EF103284_PreS2_P-RF-A      caggggcctgtattttcctgctggtggctccagttcaggaacacacaacc
KJ586810_PreS2_P-RF-A      aagggctctgtattttcctgctggtggctccagttcagagacactcaacc
AY161145_PreS2_P-RF-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AY161146_PreS2_P-RF-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AY161140_PreS2_P-RF-A      caggggcctgtattctcctgctggtggctccagttcaggaacactcaacc
AY161141_PreS2_P-RF-A      caggggcctgtatctccttgctggtggctccagttcaggaacactcaacc
EF103282_PreS2_P-RF-A      cagaggcctgtattttcctgctggtggctccagttcaggaacactcaacc
AY233277_PreS2_P-RF-A      caggggcctgtattttcctgctggtggctccagttcaggaatactcaacc
MF488705_PreS2_P-RF-A      caggggcctgtattttcctgctggtggctccagttcaggaactctcaacc
MF925404_PreS2_P-RF-A      caggggcctgtattttcctgctggtggctccagttcaggaacactcaacc
KF873530_PreS2_P-RF-C      aaggggcctgtattttcctgctggtggctccagttccggaacagcaaacc
KF873534_PreS2_P-RF-C      aaagggcctgtattttcctgctggtggctccagttccggaacagtaaacc
KF873531_PreS2_P-RF-C      aaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
KF873532_PreS2_P-RF-C      aaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
KF873533_PreS2_P-RF-C      aaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
KF873537_PreS2_P-RF-C      aaggrgcctgtattttcctgctggtggctccagttccggaacagtaaacc
KF873540_PreS2_P-RF-C      aaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
KF873538_PreS2_P-RF-C      aaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
KF873542_PreS2_P-RF-C      aaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
KF873543_PreS2_P-RF-C      aaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
KU679945_PreS2_P-RF-C      aaggggcctgtattttcctgctggtggctccagttcaggaacagtaaacc
KF873535_PreS2_P-RF-C      aaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
KU679939_PreS2_P-RF-C      aaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
KU679940_PreS2_P-RF-C      aaggggcctgtatyttcctgctggtggctccagttccggaacagtaaacc
KU679958_PreS2_P-RF-C      raggggtctgtatttccctgctggtggctccagttccggaacagtaaacc
KU679956_PreS2_P-RF-C      aaggggtctgtattttcctgctggtggctccagttccggaacagtaaacc
KU679954_PreS2_P-RF-C      aaggggtctgtatyttcctgctggtggctccagttccggaacagtaagcc
KF873527_PreS2_P-RF-C      aaggggtctgtattttcctgctggtggctccagttccggaacagtaagcc
KU679942_PreS2_P-RF-C      aaggggtctgtattttcctgctggtggctccagttccggaacagtaagcc
KU679943_PreS2_P-RF-B      aaggggtctgtattttcctgctggtggctccagttccggaacagtaagcc
KF873523_PreS2_P-RF-C      aaggggtctgtatttccctgctggtggctccagttccggaacagtaaacc
KF873524_PreS2_P-RF-C      aaggggtctgtatttccctgctggtggctccagttccggaacagtaaacc
KF873522_PreS2_P-RF-C      aaggggtctgtatttccctgctggtggctccagttccggaacagtaaacc
KU679941_PreS2_P-RF-C      aaggggtctgtatttccctgctggtggctccagttccggaacagtaaacc
KU679950_PreS2_P-RF-C      aaggggtctgtattttcctgctggtggctccagttccggggcagtaaacc
KF873521_PreS2_P-RF-B      aaggggtctgtattttcctgctggtggctccagtttcggggcagtaaacc
KU679955_PreS2_P-RF-C      aaggggtctgtattttcctgctggtggctccagtttcggggcagtaaacc
KU679948_PreS2_P-RF-C      aaggggtctgtattttcctgctggtggctccagttccggggcagtaaacc
KF873511_PreS2_P-RF-C      aaggggtctgtattttcctgctggtggctccagttccggggcagtaaacc
KU679944_PreS2_P-RF-B      aaggggtctgtattttcctgctggtggctccagttccggggcagtaaacc
KF873515_PreS2_P-RF-C      aaggggtctgtattttcctgctggtggctccagttccggggcagtaaacc
KF873519_PreS2_P-RF-C      aaggggtctgtattttcctgctggtggctccagttccggggcagtaaacc
KU679953_PreS2_P-RF-B      aaggggtctgtattttcctgctggtggctccagttccggggcagtaaacc
KU679946_PreS2_P-RF-B      aaggggtctgtattttcctgctggtggctccagttccggggcagtaaacc
KF873513_PreS2_P-RF-C      aaggggtctgtattttcctgctggtggctccagttccggggcagtaaacc
KF873517_PreS2_P-RF-B      aaggggtctgtattttcctgctggtggctccagttccggggcagtaaacc
KF873518_PreS2_P-RF-C      aaggggtctgtattttcctgctggtggctccagttccggggcagtaaacc
EF494378_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagctccggaacagcaaacc
KF053186_PreS2_P-RF-B      gaggggcctgtattttcctgctggtggctccagttcaggaacagtgagcc
KJ803778_PreS2_P-RF-B      gaggggcctgtattttcctgctggtggctccagttcaggaacagtgagcc
KF053179_PreS2_P-RF-B      cagggctctgtactttcctgctggtggctccagttcaggaacagtgaacc
KJ803772_PreS2_P-RF-B      cagggctctgtactttcctgctggtggctccagttcaggaacagtgaacc
KF053166_PreS2_P-RF-B      cagggctctgtactttcctgctggtggctccagttcaggaacagtaaacc
KJ803827_PreS2_P-RF-B      cagggctctgtactttcctgctggtggctccagttcaggaacagtaaacc
KJ717800_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
KJ803791_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
AB241109_PreS2_P-RF-C      aaggggcctatactttcctgctggtggctccagttccggaacagcaaacc
KC315400_PreS2_P-RF-C      cagggccctgtactttcctgctggtggctcaagttccggaacagtaaacc
KJ717815_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KJ717816_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KJ803803_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
KF053188_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ803782_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ717814_PreS2_P-RF-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KJ803802_PreS2_P-RF-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
MF925389_PreS2_P-RF-D      gagaggcctgtactttcctgctggtggctccagttcaggaacagtaaacc
KX096713_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
GQ377627_PreS2_P-RF-C      gagaggcctrtatttccctgctggtggctccagttcaggaacagtaaacc
JX504540_PreS2_P-RF-C      gaggggcctatattttcctgctggcggctccagttccggaacagcaaacc
FJ562223_PreS2_P-RF-C      gagaggcctgtattcccctgctggtggctccagttcaggaacagtaaacc
JX036358_PreS2_P-RF-D      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JQ040175_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB031265_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JF436923_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
MF925382_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
MG826147_PreS2_P-RF-C      gagggccctaaaccttcctgctggtggctccagttccggaacagtaaacc
MG826141_PreS2_P-RF-C      gaggggcctagaccttcctgctggtggctccagttccggaacagtaaacc
KJ598675_PreS2_P-RF-C      gaggggcctatacctccctgctggtggctccagttccggaacagtaaacc
MG826146_PreS2_P-RF-C      gaggggcctatactatcctgctggtggctccagttccggaacagtaaacc
MG826148_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ803785_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
FR714496_PreS2_P-RF-C      gaggggcctatactctcctgctggtggctccagttccggaacagtaaacc
KJ717832_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KJ717794_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ803788_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ803798_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JQ027310_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
MF925381_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KF053160_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KJ803753_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
KJ803804_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ410506_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ924618_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctcaagttccggaacagtaaacc
JQ801476_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctcaagttccgggacagtaaacc
MF925370_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctcaagttccggaacagtaaacc
JF436919_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AP011102_PreS2_P-RF-C      gaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
AB493842_PreS2_P-RF-C      gaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
AP011103_PreS2_P-RF-C      gaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
AB105172_PreS2_P-RF-C      gagaggcctttattttcctgctggtggctccagttccggaacagtaaacc
AB493840_PreS2_P-RF-C      gaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
AB493837_PreS2_P-RF-C      gaggggcctttattttcctgctggtggctccagttccggaacagtacacc
AB493838_PreS2_P-RF-C      gaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
AB493847_PreS2_P-RF-C      gaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
GQ358155_PreS2_P-RF-C      gaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
GQ358156_PreS2_P-RF-C      gaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
HQ700530_PreS2_P-RF-C      gaggggcctttattttcctgctggtggctccagttcaggaacattaaacc
HQ700523_PreS2_P-RF-C      gaggggcctttattttcctgctggtggctccagttccggaacactaaacc
HQ700531_PreS2_P-RF-C      gaggggtctttattttcctgctggtggctccagttccggaacactaaacc
HQ700532_PreS2_P-RF-C      gaggggtctttattttcctgctggtggctccagttccggaacactaaacc
GU357843_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377590_PreS2_P-RF-C      gagggscctrtactttcctgctggtggctccagttccggaacagtrarcc
FJ562294_PreS2_P-RF-C      gaggggcctgtactttcctgctggtggctccagttccggaacagtaaacc
HQ700527_PreS2_P-RF-C      gagaggcctttattttcctgctggtggctccagttccggaacagtaaacc
HQ700528_PreS2_P-RF-C      gagaggcctttattttcctgctggtggctccagttccggaacagtaaacc
HQ700519_PreS2_P-RF-C      aaggggcctttatcttcctgctggtggctccagttccgggacagcaaacc
HQ700521_PreS2_P-RF-C      aaggggcctttattttcctgctggtggctccagttccgggacagtaaacc
HQ700518_PreS2_P-RF-C      gaggggcctttattttcctgctggtggctccggttccggaacagtaaacc
JQ040146_PreS2_P-RF-C      gaggggactatactttcctgctggtggctccagttccggaacagtaaacc
AB367800_PreS2_P-RF-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
EU589337_PreS2_P-RF-C      gaggggcc------ttcctgctggtggctccagttccggaacagtaaacc
FJ032343_PreS2_P-RF-C      gaggggcc------ttcctgctggtggctccagttccggaacagtaaacc
HQ700526_PreS2_P-RF-C      gagaggcctgtattttcctgctggtggctccagttccggaacagtaaccc
GQ377539_PreS2_P-RF-C      cagggccctgtactttcctgctggtggctccagttccggaacagtaaacc
FJ562226_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774344_PreS2_P-RF-C      gagaggcctgtatttccctgctggtggctccagttcaggaacagtaaacc
JX661485_PreS2_P-RF-C      cagggctctgtaccttcctggtggtggctccagttcaggaacagtaaacc
EU717211_PreS2_P-RF-C      gaggagcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ715345_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccgggacagtaaacc
FJ715346_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccgggacagtaaacc
FJ715347_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccgggacagtaaacc
FJ562229_PreS2_P-RF-C      cagggccctgcacagccctgctggtggctccagttccggaacagtaaacc
EU522070_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccaattccggaacagtaaacc
EU871995_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccgcaacagtaaacc
EU871988_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccgcaacagtaaacc
EU871991_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccgcaacagtaaacc
EU871994_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccgcaacagtaaacc
EU871996_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccgcaacagtaaacc
EU871999_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccgcaacagtaaacc
EU871981_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccgcaacagtaaacc
EU871983_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccgcaacagtaaacc
EU871986_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccgcaacagtaaacc
EU871987_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccgcaacagtaaacc
EU871989_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccgcaacagtaaacc
EU871990_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccgcaacagtaaacc
EU871992_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccgcaacagtaaacc
EU871993_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccgcaacagtaaacc
EU871984_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccgcaacagtaaacc
EU871985_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccgcaacagtaaacc
AB367393_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173350_PreS2_P-RF-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KC774188_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377602_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562336_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
EU939602_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
Y18857_PreS2_P-RF-CB       gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939577_PreS2_P-RF-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
MT426530_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426466_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426471_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426544_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426523_PreS2_P-RF-C      gaggggcatataccttcctgctggtggctccagttccggaacagtaaacc
MT426479_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttcaggaacagtaaacc
MT426462_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426499_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426557_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426524_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426485_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426456_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426455_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426467_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426527_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426541_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426460_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426522_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426562_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426546_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426540_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426539_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426533_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426526_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426515_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426512_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacaggaaacc
MT426469_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426492_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426519_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426538_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426514_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426503_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426481_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426569_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426564_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426563_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426560_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426558_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426575_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426556_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426555_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426553_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426549_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426545_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426542_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426537_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426531_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426534_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426518_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426517_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426509_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426508_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426504_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426502_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426554_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426500_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426543_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426559_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426489_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426488_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426486_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426483_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426480_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426478_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426473_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426470_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426465_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426464_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426461_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426457_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426459_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426487_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426496_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426507_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426547_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426572_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426463_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426468_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426472_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426475_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426476_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426477_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426482_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426484_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426490_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426491_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426493_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426494_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426495_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426497_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426498_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426501_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426505_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426506_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426510_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426511_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426513_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426520_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426521_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426525_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426528_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426529_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426532_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426536_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426550_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426551_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426561_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426565_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426566_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426567_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426568_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426570_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426571_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426573_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426574_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426576_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
MT426535_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
EU919166_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU919167_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KJ173320_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
KJ173322_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttcaggaacagtaaacc
FJ562267_PreS2_P-RF-C      gagaggcctatactttcctgctggtggctccagttccggaacagtagacc
EU939668_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774324_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377633_PreS2_P-RF-C      gaggggcctataytttcctgctggtggctccagttccggaacagyaaacc
FJ032337_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
HQ700547_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
DQ089798_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
M38454_PreS2_P-RF-CB       gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774222_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GU385774_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
GQ377548_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013843_PreS2_P-RF-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
KJ173325_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173279_PreS2_P-RF-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
JF436922_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562227_PreS2_P-RF-C      gaggggcctatacattcctgctggtggctccagttccgggacagtaaacc
AB670303_PreS2_P-RF-C      gaggggcctatactyccctgctggtggctccagttccggaacagtaaacc
AB049609_PreS2_P-RF-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
KY363263_PreS2_P-RF-C      gcggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB367400_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377565_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377581_PreS2_P-RF-C      gargggcctatactttcctgctggtggctccagttccggaacagtaaacc
AF461361_PreS2_P-RF-C      gaggggcc------ttcctgctggtggctccagttccggaacagtaaacc
KR013816_PreS2_P-RF-C      gaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
GQ377534_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MG826149_PreS2_P-RF-C      gaggggcctctactttcctgctggtggctccagttccggaacagtaaacc
GQ377594_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ386646_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AF411409_PreS2_P-RF-C      gaggggcctatacctccctgctggtggctccagttccggaacagtaaacc
EU939565_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377520_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173329_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaatagtaaacc
KJ173326_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MG893559_PreS2_P-RF-C      gaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
KU964351_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JX661498_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377607_PreS2_P-RF-C      gaggggtctatattttcctgctggtggctccagttccggaacagtaaacc
AB642096_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EF494376_PreS2_P-RF-C      gagggacctatactttcctgctggtggctccagttccggaacagtaagcc
FJ562305_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
EU939589_PreS2_P-RF-C      gaggggcctatacttccctgctggtggctccagttccggaacagtaaacc
KM875422_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173358_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU939551_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ787446_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
FJ787480_PreS2_P-RF-C      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KC774183_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JX661487_PreS2_P-RF-C      gagaggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377556_PreS2_P-RF-C      gaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
GQ377544_PreS2_P-RF-C      gaggggcctgtactttcctgctggtggctccagttccggaacagtaaacc
GQ377516_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ562314_PreS2_P-RF-C      gaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
FJ386649_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU787444_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AY123424_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774246_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774258_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774317_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774322_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MG893561_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774186_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774230_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173349_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KM213033_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774349_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
MK321265_PreS2_P-RF-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MK720627_PreS2_P-RF-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MK720628_PreS2_P-RF-C      aaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KR013806_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccggttccggaacagtaaacc
LC279263_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
LC279264_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
LC279265_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
LC279266_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
LC279267_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774332_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774263_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774341_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ386578_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
FJ386585_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY470893_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963883_PreS2_P-RF-C      gaggagcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774328_PreS2_P-RF-C      gaggggcctctactttcctgctggtggctccagttccggaacagtaaacc
FJ386633_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
EU871997_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KY881840_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
AB198084_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JX661494_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ562287_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
LC458432_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774294_PreS2_P-RF-C      gaggggtctatactttcctgctggtggctccagttccggaacagtaaacc
FJ386581_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JX429896_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
Y18856_PreS2_P-RF-CB       gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963993_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963990_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173299_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KJ173300_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
JX026887_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963991_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963994_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963995_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963998_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU963999_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964001_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KU964003_PreS2_P-RF-C      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
HQ700520_PreS2_P-RF-C      gaggggcctttattttcctgctggtggctcaagttccggaacagtaaacc
KU695742_PreS2_P-RF-C      aaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
X75656_PreS2_P-RF-CB       gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
HQ700542_PreS2_P-RF-C      gaggggcctttattttcctgctggtggctccagttccggagcagtaaacc
KU695744_PreS2_P-RF-C      gaggggcctttattttcctgctggtggctccagttccgggacagtaaacc
KU695746_PreS2_P-RF-C      gaggggcctttattttcctgctggtggctccagttccgggacagtaaacc
HQ700505_PreS2_P-RF-C      gaggggcctttattttcctgctggtggctccagttccgggacagtaaacc
KU695741_PreS2_P-RF-C      gaggggcctttattttcctgctggtggctccagttccgggacagtaaacc
KU695743_PreS2_P-RF-C      gaggggcctttattttcctgctggtggctccagttccgggacagtaaacc
AP011108_PreS2_P-RF-C      gaggggcctttattttcctgctggtggctccagttccggaacgataaacc
HQ700507_PreS2_P-RF-C      gaggggcctttattttcctgctggtggctccagttccgggacagtaaacc
HQ700508_PreS2_P-RF-C      gaggggcctttattttcctgctggtggctccagttccgggacagtaaacc
HQ700509_PreS2_P-RF-C      gaggggcctttattttcctgctggtggctccagttccgggacagtaaacc
HQ700515_PreS2_P-RF-C      gaggggcctttacttccctgctggtggctccagttccgggacagtaaacc
HQ700580_PreS2_P-RF-C      aaggggcctttattttcctgctggtggctccagttccggaacagtgaacc
HQ700557_PreS2_P-RF-C      aaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
HQ700560_PreS2_P-RF-C      aaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
HQ700498_PreS2_P-RF-C      aaggggcctttattttcctgctggtggctccagttccggagcagtaaacc
HQ700499_PreS2_P-RF-C      aaggggcctttattttcctgctggtggctccagttccggagcagtaaacc
KU695745_PreS2_P-RF-C      aaggggcctttattttcctgctggtggctccagttccggagcagtaaacc
HQ700554_PreS2_P-RF-C      aaggggcctttattttcctgctggtggctccagttccggaacagtaaacc
HQ700462_PreS2_P-RF-C      aaggggcctgtatcttcctgctggtggctccagttccggaacagtaaacc
HQ700485_PreS2_P-RF-C      aaggggcctgtattttcctgctggtggctccagttccggaacagtaaacc
JX036329_PreS2_P-RF-C      aaggggcctatattttcctgctggtggctccagctccggaacagtaaacc
AB033557_PreS2_P-RF-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
JX036328_PreS2_P-RF-C      aaggggtctatattttcctgctggtggctccagctccggaacagtaaacc
AY206374_PreS2_P-RF-C      aaggggcctttactttcctgttggtggctccagttccggaacagtaaacc
FJ562317_PreS2_P-RF-C      gaggggcctatatctccctgctggtggctccagttccggaacaataaacc
MG826144_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377560_PreS2_P-RF-C      aaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KC774198_PreS2_P-RF-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KC774201_PreS2_P-RF-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KC774193_PreS2_P-RF-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KC774323_PreS2_P-RF-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KC774291_PreS2_P-RF-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
KC774307_PreS2_P-RF-C      gaggggcctttactttcctgctggtggctccagttccggaacagtaaacc
LC416040_PreS2_P-RF-C      gaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
KT003704_PreS2_P-RF-C      gaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
AP011104_PreS2_P-RF-C      gaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
AP011105_PreS2_P-RF-C      gaggggcctctattttcctgctggtggctccagttccggaacagtaaacc
KP148352_PreS2_P-RF-C      gaggggcctctattttcctgctggcggctccagttccggaacagtaaacc
EU939547_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JQ040148_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB300369_PreS2_P-RF-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
AB205152_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ386586_PreS2_P-RF-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
AB195950_PreS2_P-RF-C      gaagggcctatattttcctgctggtggctccagttcaggaacagtaaacc
AB195951_PreS2_P-RF-C      gaagggcctatattttcctgctggtggctccagttcaggaacagtaaacc
JF828938_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JF828936_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JF828935_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JF828933_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JF828934_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JQ040142_PreS2_P-RF-C      gagaggcctatattttcctgctggtggctccagttccggaacagtaaacc
JX661486_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
MG893554_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
MG893555_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB367419_PreS2_P-RF-C      gaggggcctatatcttcctgctggtggctccagttccggaacagtaaacc
MG826142_PreS2_P-RF-C      gaggggcctagaccttcctgctggtggctccagttccggaacagtaaacc
KC774305_PreS2_P-RF-C      gcggggcctatattttcctgctggtggctccagttccggaacagtaagcc
AF233236_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU881995_PreS2_P-RF-C      gaggggcctatatttccctgctggtggctccagttccggaacagtaaacc
KC774234_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
EU916232_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
KU964316_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
KU964313_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
KU964005_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
KU964006_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
KU964007_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
KU964008_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
KU964009_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
KU964010_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
KU964303_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
KU964304_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
KU964305_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
KU964307_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
KU964308_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
KU964309_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
KU964310_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
KU964311_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
KU964312_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
KU964314_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
KU964315_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
KU964317_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
KU964306_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacaataaacc
KJ410520_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB195940_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB195941_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KC774212_PreS2_P-RF-C      aaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JQ732168_PreS2_P-RF-C      acggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AY040627_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715387_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715384_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715385_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715411_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715412_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715413_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ715414_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AY247030_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
HM750133_PreS2_P-RF-C      gaggggcctgtattttcctgctggtggctccagttccggaactgtaaacc
AY123041_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AF330110_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU939606_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963862_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377522_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagcaaacc
FJ386635_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377611_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963869_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963868_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963859_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963856_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963857_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963858_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963860_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963861_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963863_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963864_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963865_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963866_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963867_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
KU963870_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU916239_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagcaaacc
EU916241_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagcaaacc
EU916240_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagcaaacc
JN400086_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB195956_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB195957_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB195939_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AB195955_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
AY167095_PreS2_P-RF-C      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
FJ386674_PreS2_P-RF-B      cagggcactgtactttcctgctggtggctccagttcaggaacactgagcc
MF925402_PreS2_P-RF-B      cagggctctgtactttcctgctggtggctccagttcaggaacagtgagcc
KX774505_PreS2_P-RF-B      cagggctctgtactttcctgctggtggctccagttcaggaacagtgaacc
EU939631_PreS2_P-RF-B      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
EU882006_PreS2_P-RF-C      gaggggcctgtactttcctgctggtggctccagttcaggaacagtgagcc
EU939620_PreS2_P-RF-C      cagggccctgtacagtcctgctggtggctccagttcaggaacagtgagcc
HQ684848_PreS2_P-RF-C      cagggccctgttctttcctgctggtggctccagttcaggaacagtgagcc
EU939630_PreS2_P-RF-C      cagggccctgtacttccctgctggtggctccagttcaggaacagtgagcc
EU939623_PreS2_P-RF-C      cagggccctgtactttcctgctggtggctccagttcaggaacagtgagcc
FJ562328_PreS2_P-RF-C      cagggccctgtactttcctgctggtggctccagttcaggaacagtgagcc
FJ562247_PreS2_P-RF-C      cagggccctgtaccttcctgctggtggctccagttcaggaacagtgagcc
GQ377604_PreS2_P-RF-C      cagggccctgtactttcctgctggtggctccagttcaggaacagtgagcc
GQ377573_PreS2_P-RF-C      cagggccctgtactttcctgctggtggctccagttcaggaacagtgagcc
GQ377613_PreS2_P-RF-C      cagggccctgtactttcctgctggtggctccagttcaggaacagtgagcc
GQ377592_PreS2_P-RF-C      cagggccctgtactttcctgctggtggctccagttcaggaacagtgagcc
EU939621_PreS2_P-RF-C      cagggccctgtactttcctgctggtggctccagttcaggaacagtgagcc
JQ040174_PreS2_P-RF-C      cagggccctgtactttcctgctggtggctccagttcaggaacagtgagcc
GQ377549_PreS2_P-RF-C      cagggccctgtactttcctgctggtggctccagttcaggaacagtgagcc
GQ377634_PreS2_P-RF-C      cagggccctgtactttcctgctggtggctccagttcaggaacagtgagcc
GQ377626_PreS2_P-RF-C      cagggccctgtactttcctgctggtggctccagttcaggaacagtaagcc
GQ377564_PreS2_P-RF-C      cagggccctgtactttcctgctggtggctccagttcaggaacagtgagcc
GQ377596_PreS2_P-RF-C      cagggccctgtactttcctgctggtggctccagttcaggaacagtgagcc
GQ377614_PreS2_P-RF-C      cagggccctgtactttcctgctggtggctccagttcaggaacagtgagcc
HQ684849_PreS2_P-RF-B      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
KC774178_PreS2_P-RF-B      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KC774364_PreS2_P-RF-B      gaggggcctataccttcctgctggtggctccagttccggaacagtaaacc
KP148337_PreS2_P-RF-B      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
JQ412091_PreS2_P-RF-B      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
GQ377630_PreS2_P-RF-B      gaggggcctatattttcctgctggtggctccagttccggaacagtaaacc
GQ377635_PreS2_P-RF-B      gaggggcctatactttcctgctggtggctccagttccggaacagtaaacc
MG826150_PreS2_P-RF-B      cagggccctgtactttcctgctggtggctccagttcaggaacagtaagcc
MK052976_PreS2_P-RF-B      cagggccctgtactttcctgctggtggctccagttcaggaacagtgagcc
MG826145_PreS2_P-RF-B      caggggcctgtattttcctgctggtggctccagttcaggaacagtgagcc
MH746813_PreS2_P-RF-B      caggggcctgtactttcctgctggtggctccggttcaggaacagtgagcc
MH746811_PreS2_P-RF-B      cagggctctgtactttcctgctggtggctccagtgcaggaacagtgagcc
MH746812_PreS2_P-RF-B      cagggctctgtactttcctgctggtggctccggttcaggaacagtgagcc
GQ377595_PreS2_P-RF-B      cagggctctgtactttcctgctggtggctccagttcaggaacagtgagcc
MH094410_PreS2_P-RF-B      cagggccctgtactttcctgctggtggctccagttcaggaacagtgagcc
MG826151_PreS2_P-RF-B      cagggccctgtactttcctgctggtggctccagttcaggaacagtgagcc
EU939629_PreS2_P-RF-B      cagggccctgtactttcctgctggtggctccagttcaggaacagtgagcc
KC793112_PreS2_P-RF-B      cagggccctgtatcttcctgctggtggctccagttcaggaacagtgagcc
JQ801477_PreS2_P-RF-B      cagggccctgtactttcctgctggtggctccagttcaggaacagtgagcc
MK052967_PreS2_P-RF-B      cagggccctgtactttcctgctggtggctccagttcaggaacagtgagcc
MK052968_PreS2_P-RF-B      cagggccctgtactttcctgctggtggctccagttcaggaacagtgagcc
MK052970_PreS2_P-RF-B      cagggccctgtactttcctgctggtggctccagttcaggaacagtgagcc
EU939627_PreS2_P-RF-B      cagggccctgtacttccctgctggtggctccagttcaggaacagtgagcc
KJ410497_PreS2_P-RF-B      cagggccctgtactttcctgctggtggctccagttcaggaacagtgagcc
EU660227_PreS2_P-RF-B      cagggccctgtactttcctgctggtggctccagttcaggaacagtgagcc
KC774414_PreS2_P-RF-B      cagggccctgtactttcctgctggtggctccagttcaggaacagtgagcc
                                           *  * ***  *                     **

KJ803822_PreS2_P-RF-C      ttgttccgaatacagcctctcccatctcgtcaatcttctggaggattggg
HE981179_PreS2_P-RF-F      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
KJ586803_PreS2_P-RF-A      ctgctccgactattgcctctctcacatcatcaatcttctcgaagactggg
GQ161806_PreS2_P-RF-E      ctgttccgactactgcctcactcatctcgtcaatcttctcgaggattggg
FN594767_PreS2_P-RF-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KX660685_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683641_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX036359_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN257154_PreS2_P-RF-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
MN683675_PreS2_P-RF-D      ctgttccgaatactgcctctcccatatcgtcaaccttcttgaggattggg
KX357641_PreS2_P-RF-D      ctgttccgactactgcctctcacatattgtcaaccttctcgaggattggg
X68292_PreS2_P-RF-DA       ctgttctgactactgcctctcccttatcgtcaatctccgcgaggactggg
AY341335_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN257189_PreS2_P-RF-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
AB674434_PreS2_P-RF-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
MF925397_PreS2_P-RF-D      ctgttccgactactgtctctcacacatcgtcaaccttatcgacgactggg
JN257204_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN257191_PreS2_P-RF-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN642160_PreS2_P-RF-D      ctgttccgactactgcatctcccatatcgtcaatcttctcgaggattggg
MF925396_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KJ803771_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
X80925_PreS2_P-RF-DE       ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN664946_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
MF925371_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU594406_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ687532_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MF925360_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MF925401_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN688717_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN507835_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KM524357_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KR905422_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KT366503_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MF925388_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MF925392_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JN040803_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaaccttctcgaggattggg
X65259_PreS2_P-RF-DA       ctgttctgactactgcctctcccttatcgtcaatctccgcgaggactggg
JX036330_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JF754616_PreS2_P-RF-D      ctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggg
JF754613_PreS2_P-RF-D      ctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggg
JN040798_PreS2_P-RF-D      ctgttccgaccactgtctctcccatatcgtcaatcttctcgaggattggg
AB674436_PreS2_P-RF-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN642137_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN257216_PreS2_P-RF-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN642139_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AB330368_PreS2_P-RF-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN257206_PreS2_P-RF-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN257207_PreS2_P-RF-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
MF925384_PreS2_P-RF-D      ctgttccgactactgtctctcacatatcgtcaatcttatcgaggattggg
AB674433_PreS2_P-RF-D      ctgttccgactactgtctctcacacatcatcaatcttctcgaggattggg
AB674432_PreS2_P-RF-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
KF471643_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN642127_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN257174_PreS2_P-RF-D      ctgttccgactactgtctctcatatatcgtcaatcttctcgaggattggg
JN257164_PreS2_P-RF-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN257210_PreS2_P-RF-D      ctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggg
JN642141_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JN642152_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KY470853_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
JX036357_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
FN594770_PreS2_P-RF-D      ctgctccgactactgcctctcccatatcgtcaacctccgcgaggattggg
KY470844_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatctcctcgaggattggg
KY470843_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatctcctcgaggattggg
KY470846_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatctcctcgaggattggg
KY470847_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatctcctcgaggattggg
KY470849_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatctcctcgaggattggg
KY470850_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatctcctcgaggattggg
KY470855_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatctcctcgaggattggg
KY470856_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatctcctcgaggattggg
KY470854_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatctcctcgaggattggg
FJ904430_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KM606741_PreS2_P-RF-D      ctgttcccactactgcctctcccatatcggcaatcttcccgaggactggg
FJ349207_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AM494716_PreS2_P-RF-D      ctgttccgactactgcctctcacatatcgtcaatcttatcgaggattggg
FJ904436_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
FJ904414_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
FJ904416_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
FJ904417_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
DQ991753_PreS2_P-RF-D      ctgttccgattactgcctctcacatatcgtcaatcttctcgaggattggg
FJ904441_PreS2_P-RF-D      ctgttccgactactgcctcgcccatatcgtcaatcttctcgaggattggg
KX357627_PreS2_P-RF-D      ctgttccgaccactgcctctcacatatcgtcaatcttctcgaggattggg
KP168421_PreS2_P-RF-D      ctgttccgactactgcctctcacatattgtcaatcttctcgaggattggg
FN594771_PreS2_P-RF-D      ctgttccgactactgcctctcctatatcgtcaatcttctcgaggattggg
FJ904425_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KX357624_PreS2_P-RF-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
KX357631_PreS2_P-RF-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
FJ904405_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP995112_PreS2_P-RF-D      ctgctccgaccactgcctctctcatatcgtcaatcttctcgaagattggg
KP168420_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
KU736916_PreS2_P-RF-D      ctgttccgactactgcctctctcatatcgtcaatcttctcgaggattggg
FJ904398_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
FJ904442_PreS2_P-RF-D      ctgttccgaccactgcctctcccatattgtcaatcttctcgaggattggg
KU711666_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
FN594769_PreS2_P-RF-D      ctgttccgactactgcctctcatatatcgtcaatcttctcgaggattggg
FJ904401_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
FJ904404_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
FJ904396_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
FJ904400_PreS2_P-RF-D      ctgttccgactactgcatctcccatatcgtcaatcttctcgaggattggg
KU736917_PreS2_P-RF-D      ctgttccgactactgcctctcacatattgtcaatcttctcgaggattggg
KU736914_PreS2_P-RF-D      ctgttccgactactgcctctcacatattgtcaatcttctcgaggattggg
KU736915_PreS2_P-RF-D      ctgttccgactactgcctctcacatattgtcaatcttctcgaggattggg
MH685719_PreS2_P-RF-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
KX827299_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
GU177079_PreS2_P-RF-D      ctgttccgactactgcctctcacatatcgtcaatcttatcgaggattggg
FJ904403_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KX357628_PreS2_P-RF-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
KM606751_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
FJ904444_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KF170740_PreS2_P-RF-D      ctgttccgactactgcctctcacacatcgtcaatcttctcgaggattggg
GQ161754_PreS2_P-RF-D      ctgttccgactactgcctctcatatatcgtcaatcttctcgaggattggg
FJ904447_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
FJ904440_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
FJ904394_PreS2_P-RF-D      ctgttccgactactgcatctcccatatcgtcagtcttctcgaggattggg
KX357636_PreS2_P-RF-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
KX357634_PreS2_P-RF-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
FJ904407_PreS2_P-RF-D      ctgttccgactactgcatctcccatatcgtcaatcttctcgaggattggg
FJ904408_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
FJ904409_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KX357629_PreS2_P-RF-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
KX357626_PreS2_P-RF-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
KX357625_PreS2_P-RF-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
KU736923_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
FJ904406_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KM606750_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KX357635_PreS2_P-RF-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
KX357623_PreS2_P-RF-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
KX357633_PreS2_P-RF-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
KX357630_PreS2_P-RF-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
KP168416_PreS2_P-RF-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
KP168417_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP168418_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KU736921_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KU736922_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KJ647356_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683620_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
MN683662_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggactggg
MN683581_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatctccttgaggattggg
MN683730_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KY629632_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KT991420_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgttaatcttctcgaggattggg
KT991423_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
FJ562278_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgttaatcttctcgaggattggg
KT991417_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgttaatcttctcgaggattggg
MN683624_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggactggg
KC774484_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaagattggg
KC774498_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaagattggg
KC774431_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774449_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
MN683582_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683655_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MN683634_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KT991421_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgttaatcttctcgaggattggg
KT991419_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgttaatcttctcgaggattggg
KC774478_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774480_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774452_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
AY862865_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaaccttctcgaggattggg
AY862864_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AY862866_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683618_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaagattggg
KC774479_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KY670781_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774463_PreS2_P-RF-D      ctgttccgaatactgcctctcccatatcgtcaatcttctcgaggattggg
KC774489_PreS2_P-RF-D      ctgttctgaatactgcctctcccatatcgtcaatcttctcgaggattggg
MN683571_PreS2_P-RF-D      ctgttccgaatactgcctctcccatatcgtcaatcttctcgaggattggg
MN683592_PreS2_P-RF-D      ctgttccgaatactgcctctcccatatcgtcaatcttctcgaggattggg
MN683594_PreS2_P-RF-D      ctgttccgaatactgcctctcccatatcgtcaatcttctcgaggattggg
MN683609_PreS2_P-RF-D      ctgttccgaatactgcctctcccatatcgtcaatcttctcgaggattggg
KC774487_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaagattggg
JX036332_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttcttgaggattggg
JF491448_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatctactcgaggattggg
MN683622_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
JF491455_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AY817513_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AY817509_PreS2_P-RF-D      ctgttccgactattgcctctcccatatcgtcaatcttctcgaggattggg
AB270535_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683627_PreS2_P-RF-D      ctgttccgactactgcctttcccatatcgtcaatcttctcgaggattggg
MN650068_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttcgcgaggattggg
KC774442_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
EU787435_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
DQ478898_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774492_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KX660677_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgagaattggg
MN683668_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgagaattggg
KF917451_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683713_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MN683714_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KC774490_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774481_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttcttgaggattggg
AY817510_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MN683645_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgcggattggg
MN683640_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683623_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MN683610_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683579_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683574_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttcttgaggattggg
KU519423_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MN683674_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KC774486_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
KC774483_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774474_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774454_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774453_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774439_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP276254_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP276255_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JF491449_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774470_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774458_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaagattggg
KC774428_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683717_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683597_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683652_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683684_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683676_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683657_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683656_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683654_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683639_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683625_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683611_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683603_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683596_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683572_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KX660675_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgagaattggg
MN683607_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgagaattggg
MN683613_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgagaattggg
MN683614_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgagaattggg
MN683615_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgagaattggg
MN683666_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgagaattggg
KC774461_PreS2_P-RF-D      ctgttccgattactgcctctcccatatcgtcaatcttctcgaggattggg
KC774447_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
DQ478889_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AY817512_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AY800249_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774435_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
KC774455_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
KC774443_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
MN683683_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683626_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774466_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MN683621_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683637_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774448_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JF491451_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttcttgaggattggg
MN683619_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaggattggg
KC774488_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774493_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774422_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
EU787434_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AY817515_PreS2_P-RF-D      ctgttccgactattgcctctcccatatcgtcaatcttctcgaggattggg
KC774457_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683650_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774495_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774420_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774426_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774475_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KX660674_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
DQ478886_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774476_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KX660680_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683605_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683664_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683665_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683635_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MN683659_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MN683658_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MN683678_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683670_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683663_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MN683643_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683644_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683647_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683649_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683642_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683638_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683617_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683616_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683612_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683590_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683586_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN657317_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MN683632_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MN683660_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MN683661_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MN657316_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN657315_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683580_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KU519422_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683672_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774494_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774434_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774433_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774432_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774430_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774468_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774425_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774424_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JX429898_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774472_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774497_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774499_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683630_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683651_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683653_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JF491456_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
DQ478897_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774423_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774471_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683636_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683669_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
DQ478887_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
DQ478892_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700492_PreS2_P-RF-D      ctgttccgactaytgcctctcccayatcgtcaatcttctcraggattggg
FJ904437_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
AB674504_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
DQ478890_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgacaatcttctcgaggattggg
MN683588_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683712_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttatcgaggattggg
KT991427_PreS2_P-RF-D      ctgttccgactattgcctctcccatatcgtcaatcttctcgaggattggg
MN683721_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683722_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KX660686_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683707_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683716_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN650076_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683671_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683673_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683692_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683628_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KX660684_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683706_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KT991424_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HM750144_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN650069_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683677_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683720_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683718_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683688_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN650083_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN650081_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN650082_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN650084_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN650080_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KX660689_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683711_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774485_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HM750146_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HM750145_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HM750143_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
FJ562263_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AY817511_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AY057948_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683700_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683694_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HM750147_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HM750148_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774482_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683699_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683703_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683697_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683587_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MN683725_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683719_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683715_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683696_PreS2_P-RF-D      ctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggg
MN683680_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN650087_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683687_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN650085_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN650072_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN650073_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN650074_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN650075_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN650077_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN650078_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN650086_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KX354997_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP276253_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KC774456_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HM750150_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
FJ349241_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683686_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683693_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683724_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HM750142_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HM750149_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP276256_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN650079_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683689_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683690_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683691_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683695_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683723_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683584_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683679_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MN683685_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KP288875_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
J02202_PreS2_P-RF-DE       ctgttccgactactacctctcccatatcgtcaatcttctcgaggattggg
MF618346_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KJ470898_PreS2_P-RF-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
HQ700494_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB048702_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700579_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700585_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700536_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700535_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MH481862_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MH481861_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MH481860_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MH481858_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
MH481859_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700534_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700541_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700540_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700539_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700493_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB048703_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700538_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700537_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700533_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700582_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700503_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700500_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AB033559_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700524_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700525_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700497_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700501_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700581_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700583_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
HQ700584_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
KJ470897_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KF192835_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KF192840_PreS2_P-RF-D      ctgttctgactactgcctctcacttatcgtcaatcttctcgaggattggg
KF192833_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KF192836_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KF192837_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KF192838_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KF192839_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KF192841_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MF618347_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KJ470887_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
FJ692536_PreS2_P-RF-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
KF779353_PreS2_P-RF-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
KJ470884_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KJ470886_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KJ470888_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KJ470890_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KJ470891_PreS2_P-RF-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
EU185780_PreS2_P-RF-A      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KC012653_PreS2_P-RF-A      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
DQ464164_PreS2_P-RF-D      ctgttccgactactgcctctccctcatcgtcaatctcctcgaggattggg
DQ464165_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
DQ464166_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
DQ464167_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
AF297619_PreS2_P-RF-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
AY230120_PreS2_P-RF-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
AY236161_PreS2_P-RF-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
AF297620_PreS2_P-RF-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
JN664935_PreS2_P-RF-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggactggg
FJ349221_PreS2_P-RF-D      ctgttccgactactgcctctcccgcatcgtcaatcttctcgaggattggg
AJ627221_PreS2_P-RF-D      ctgttccgaccactgcctctcccttatcgtcaatcttctcgaggattggg
MK541689_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtctctcttctcgaagattggg
MF488699_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
JN664929_PreS2_P-RF-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaagattggg
AB033558_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
GQ205379_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
MK516279_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
MK516280_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
KT366505_PreS2_P-RF-D      ctgttccgactactgcctcgcccatattgtcaatcttctcgaagattggg
DQ315779_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
JN664940_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
JN664925_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
JN664915_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
JN664933_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
KC875339_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
KC875338_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
GQ205377_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
GQ205378_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
GQ205386_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
GQ205387_PreS2_P-RF-D      ctgttccgactactgcctctcccatattgtcaatcttctcgaagattggg
JN688715_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JF440013_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF440011_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF439999_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF440006_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF440001_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF440000_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF440010_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF440009_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF440004_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF440005_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF439998_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF439995_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF439994_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF439996_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF440002_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF440003_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF440007_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF440012_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF440014_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF440015_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JF440017_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MK052957_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK052969_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KM577666_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KM386676_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggactggg
AB188243_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KX827302_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KU668440_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JN664934_PreS2_P-RF-D      ctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH464835_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KM359442_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MG877711_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
FJ349212_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH724240_PreS2_P-RF-D      ctgttccgactactgcctctcccgaatcgtcaaccttctcgaggattggg
KJ647349_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KM524337_PreS2_P-RF-D      ctgttccgactactgcctctcgcttatcgtcaatcttctcgaggattggg
DQ315777_PreS2_P-RF-D      ctgttccgactactgcctctcgcttatcgtcaatcttctcgaggattggg
KM524336_PreS2_P-RF-D      ctgttccgactactgcctctcgcttatcgtcaatcttctcgaggattggg
MH724243_PreS2_P-RF-D      ctgttccgactactgcatctcccttatcgtcaatcttctcgaggattggg
AB270538_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MH724239_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MF488702_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK618439_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggaatggg
JX898690_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KJ586811_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MF967563_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JX898698_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JX898699_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JX898686_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JX898687_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JX898688_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
U95551_PreS2_P-RF-DE       ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
AB210819_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
AJ344117_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JX898693_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JX898695_PreS2_P-RF-D      ctgctccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JX898696_PreS2_P-RF-D      ctgctccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KM577665_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
GU563560_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KM577667_PreS2_P-RF-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
MH464851_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
AJ627217_PreS2_P-RF-D      ctgttccgaccactgcctctcacttatcgtcaatcttctcgaggattggg
KT366492_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KM524359_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
JN688689_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
AY373430_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MK598653_PreS2_P-RF-D      ctcttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
MK598652_PreS2_P-RF-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
MK598654_PreS2_P-RF-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
MK598656_PreS2_P-RF-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
MN507850_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK618442_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK618440_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK618438_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK618444_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MK618445_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
DQ111987_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
EU594435_PreS2_P-RF-D      ctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggg
EU594436_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MH724222_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
JN664943_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
AY233293_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
AY233295_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH464846_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH464850_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MH464852_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
MT210033_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KM577663_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KM577664_PreS2_P-RF-D      ctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggg
KJ647351_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KC774450_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
AB188245_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
EF103285_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
AB583679_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
GQ183486_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
KT366504_PreS2_P-RF-D      ctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggg
MH368022_PreS2_P-RF-G      ctgctccgaatattgcctctcacatctcatcaatcttcgcgaggactggg
KP148449_PreS2_P-RF-G      ctgctccgaatattgtctctcacatctcatcaatcttcgcgaggactggg
KP148441_PreS2_P-RF-G      ctgctccgaatattgtctctcacatctcatcaatcttcgcgaggactggg
KP148442_PreS2_P-RF-B      ctgctccgaatattgtctctcacatctcatcaatcttcgcgaggactggg
KP148450_PreS2_P-RF-G      ctgctccgaatattgtctctcacatcacatcaatcttcgcgaggactggg
FJ023662_PreS2_P-RF-G      ctgctccgaatattgcctctcacatctcatcaatcttcgcgaggattggg
KP148447_PreS2_P-RF-G      ctgctccgaatattgtctctcacatctcatcaatcttcgcgaggactggg
KP148586_PreS2_P-RF-G      ctgctccgaatattgtctctcacatctcatcaatcttcgcgaggattggg
KY470996_PreS2_P-RF-G      ctgctccgaatattgcctctcacatctcatcaatcttcacgaggattggg
FJ023659_PreS2_P-RF-B      ctgctccgaatattgcctctcacatctcatcaatcttcacgaggattggg
KY471007_PreS2_P-RF-G      ctgctccgaatattgcctctcacatctcatcaatcttcacgaggattggg
KY471004_PreS2_P-RF-G      ctgctccgaatattgcccctcacatctcatcaatcttcacgaggattggg
KC172106_PreS2_P-RF-G      ctgctccgaatattgcctctcacatctcatcaatcttcacgaggattggg
FR714490_PreS2_P-RF-G      ctgctccgaatattgcctctcacatctcatcaatcttcacgaggattggg
KY470999_PreS2_P-RF-G      ctgctccgaatattgcctctcacatctcatcaatcttcacgagggttggg
KY471000_PreS2_P-RF-G      ctgctccgaatattgcctctcacatctcatcaatcttcacgagggttggg
KY471002_PreS2_P-RF-G      ctgctccgaatattgcctctcacatctcatcaatcttcacgagggttggg
KY470998_PreS2_P-RF-G      ctgctccgaatattgcctctcacatctcatcaatcttcacgaggattggg
KY471001_PreS2_P-RF-G      ctgctccgaatattgcctctcacatctcatcaatcttcacgaggattggg
KY470997_PreS2_P-RF-G      ctgctccgaatattgcctctcacatctcatcaatcttcacgaggattggg
KY471003_PreS2_P-RF-G      ctgctccgaatattgcctctcacatctcatcaatcttcacgaggattggg
KY471005_PreS2_P-RF-G      ctgctccgaatattgcctctcacatctcatcaatcttcacgaggattggg
KY471006_PreS2_P-RF-G      ctgctccgaatattgcctctcacatctcatcaatcttcacgaggattggg
EU835240_PreS2_P-RF-G      ctgttccgaatattgcctctcacatctcatcaatcttcgcgaggactggg
FJ023666_PreS2_P-RF-G      ctgttccgaatattgcctctcacatctcatcaatctccgcgaggactggg
FJ882611_PreS2_P-RF-G      ctgttccgaatattgcctctcacatctcatcaatcttcgcgaggactggg
FJ882613_PreS2_P-RF-G      ctgttccgaatattgcctctcacatctcatcaatcttcgcgaggactggg
FJ023665_PreS2_P-RF-G      ctgttccgaatattgcctctcacatctcatcaatcttcgcgaggactggg
FJ882617_PreS2_P-RF-G      ctgttccgaatattgcctctcacatctcatcaatcttcgcgaggactggg
FJ882610_PreS2_P-RF-G      ctgttccgaatattgcctctcacatctcatcaatcttcgcgaggactggg
FJ882614_PreS2_P-RF-G      ctgttccgaatattgcctctcacatctcatcaatcttcgcgaggactggg
FJ023667_PreS2_P-RF-G      ctgttccgaatattgcctctcacatctcatcaatcttcgcgaggactggg
FJ023670_PreS2_P-RF-G      ctgttccgaatattgcctctcacatctcatcaatcttcgcgaggactggg
FJ023668_PreS2_P-RF-G      ctgttccgaatattgcctctcacatctcatcaatcttcgcgaggactggg
EU833891_PreS2_P-RF-G      ctgttccgaatattgcctctcacatctcatcaatcttcgcgaggactggg
FJ882612_PreS2_P-RF-G      ctgttccgaatattgcctctcacatctcatcaatcttcgcgaggactggg
FJ882618_PreS2_P-RF-G      ctgttccgaatattgcctctcacatctcatcaatcttcgcgaggactggg
FJ023664_PreS2_P-RF-G      ctgttccgaatattgcctctcacatctcatcaatcttcgcgaggactggg
FJ023673_PreS2_P-RF-G      ctgttccgaatattgcctctcacatctcatcaatcttcgcgaggactggg
EU833890_PreS2_P-RF-G      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB933279_PreS2_P-RF-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB933280_PreS2_P-RF-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB933281_PreS2_P-RF-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB933283_PreS2_P-RF-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggaytggg
MF925386_PreS2_P-RF-A      ctgctccgaatattgcctctcacatatcgtcaatctccacgaggactggg
AB453985_PreS2_P-RF-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF440019_PreS2_P-RF-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JF440022_PreS2_P-RF-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB222708_PreS2_P-RF-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
AB933282_PreS2_P-RF-A      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
JQ707426_PreS2_P-RF-G      ctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggg
KF219922_PreS2_P-RF-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
KP274926_PreS2_P-RF-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
KX765835_PreS2_P-RF-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JQ272886_PreS2_P-RF-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
JQ272887_PreS2_P-RF-G      ctgttccgactattgcctctcacatctcgtcaatcttctccaggattggg
AB194949_PreS2_P-RF-A      ctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
GQ161767_PreS2_P-RF-A      ctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
GQ161753_PreS2_P-RF-A      ctgttccgaatatcgcctctcacatcttgtcaatctcctcgaggactggg
HF571060_PreS2_P-RF-A      ctgttccgaacattgcctctcacatctcgtcaatctcctcgaggactggg
GQ161837_PreS2_P-RF-A      ctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
GQ161838_PreS2_P-RF-A      ctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggg
GQ331048_PreS2_P-RF-A      ctgttcagaatattgcctctcacatctcgtcaatctcctcgaggactggg
EF103283_PreS2_P-RF-A      ctgttccaactattgcctctcacatctcgacaatctcctcgaggattgcg
EF464099_PreS2_P-RF-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
KF214656_PreS2_P-RF-A      ctgttccaaatattgcctctcacatctcgtcaatctccttgaggattggg
HM146131_PreS2_P-RF-A      ctgttccaactattgcctctcacatctcgtctatctcctcgaggattggg
EF103284_PreS2_P-RF-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
KJ586810_PreS2_P-RF-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AY161145_PreS2_P-RF-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AY161146_PreS2_P-RF-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
AY161140_PreS2_P-RF-A      ctgttccaattattgcccctctcatctcgtcaatctcctcgaggattggg
AY161141_PreS2_P-RF-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggg
EF103282_PreS2_P-RF-A      ctgttccgaccattgcctctcacatctcgtcaatctcctcgaggattggg
AY233277_PreS2_P-RF-A      ctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggg
MF488705_PreS2_P-RF-A      ctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggg
MF925404_PreS2_P-RF-A      ctgttccaactattgcctctcacatctcgtcaatctcctcgaggactggg
KF873530_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KF873534_PreS2_P-RF-C      ctgttccgaatactgtctctcacatctcatcaatcttcacgacgactggg
KF873531_PreS2_P-RF-C      ctgttccgaatactgtctctcacatctcatcaatcttcacgacgactggg
KF873532_PreS2_P-RF-C      ctgttccgaatactgtctctcacatctcatcaatcttcacgacgactggg
KF873533_PreS2_P-RF-C      ctgttccgaatactgtctctcacatctcatcaatcttcacgacgactggg
KF873537_PreS2_P-RF-C      ctgttccgaatactgtctctcacatctcatcaatcttcacgacgactggg
KF873540_PreS2_P-RF-C      ctgttccgaatactgtctctcacatctcatcaatctycacgacgactggg
KF873538_PreS2_P-RF-C      ctgttccgaatactgtctctcacatctcatcaatcttcacgacgactggg
KF873542_PreS2_P-RF-C      ctgttccgaatactgtctctcacatctcatcaatcttcacgacgactggg
KF873543_PreS2_P-RF-C      ctgttccgaatactgtctctcacatctcatcaatcttcacgacgactggg
KU679945_PreS2_P-RF-C      ctgttccgaatactgtctctcacatctcatcaatcttcacgacgactggg
KF873535_PreS2_P-RF-C      ctgttccgaatactgtctctcacatatcatcaatcttcacgacgactggg
KU679939_PreS2_P-RF-C      ctgttccgaatactgtctctcacatatcatcaatcttcacgacgactggg
KU679940_PreS2_P-RF-C      ctgttccgaatactgtctctcacatatcatcaatcttcacgacgactggg
KU679958_PreS2_P-RF-C      ctgttccgaatactgtctctcacatctcrtcaatcttcrcgaagactggg
KU679956_PreS2_P-RF-C      ctgttccgaatactgtctctcacatctcatcaatcttcacgaagactggg
KU679954_PreS2_P-RF-C      ctgttccgaatactgtctctcacatctcatcaatcttcacgaagactggg
KF873527_PreS2_P-RF-C      ctgttcagaatactgtctctcacatctcatcaatcttcacgaagactggg
KU679942_PreS2_P-RF-C      ctgttccgaatactgtctctcacatctcatcaatcttcacgaagactggg
KU679943_PreS2_P-RF-B      ctgttccgaatactgtctctcacatctcatcaaycttcacgaagactggg
KF873523_PreS2_P-RF-C      ctgttccgaatactgtctctcacatctcatcaatctycacgaagactggg
KF873524_PreS2_P-RF-C      ctgttccgaatactgtctctcacatctcatcaatcttcacgaagactggg
KF873522_PreS2_P-RF-C      ctgttccgaatactgtctctcacatctcatcaatcttcacgaagactggg
KU679941_PreS2_P-RF-C      ctgttccgaatactgtctctcacatctcatcaatcttcacgaagactggg
KU679950_PreS2_P-RF-C      ctgttccgaatactgtcyctcccatctcatcaatcttcacgaagactggg
KF873521_PreS2_P-RF-B      ctgttccgaatactgtctctcccatctcatcaatcttcacgaagactggg
KU679955_PreS2_P-RF-C      ctgttccgaatactgtctctcccatctcatcaatcttcacgaagactggg
KU679948_PreS2_P-RF-C      ctgttccgaatactgtctctcccatctcatcaatcttcacgaagactggg
KF873511_PreS2_P-RF-C      ctgttccgaatactgtctctcccatctcatcaatcttcacgaagactggg
KU679944_PreS2_P-RF-B      ctgttccgaatactgtctctcccatctcatcaatcttcacgaagactggg
KF873515_PreS2_P-RF-C      ctgttccgaatactgtctctcccatatcatcaatcttcacgaagactggg
KF873519_PreS2_P-RF-C      ctgttccgaatactgtctctcccatctcatcaatcttcacgaagactggg
KU679953_PreS2_P-RF-B      ctgttccgaatactgtctctcccatctcatcaatcttcacgaagactggg
KU679946_PreS2_P-RF-B      ctgttccgaatactgtctctcccatctcatcaatcttcacgaagactggg
KF873513_PreS2_P-RF-C      ctgttccgaatactgtctctcccatctcatcaatcttcacgaagactggg
KF873517_PreS2_P-RF-B      ctgttccgaatactgtctctcccatctcatcaatcttcacgaagactggg
KF873518_PreS2_P-RF-C      ctgttccgaatactgtctctcccatctcatcaatcttcacgaagactggg
EF494378_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KF053186_PreS2_P-RF-B      ctgctcaaaatactgtctccaccacatcgtcacacttatcgaagactggg
KJ803778_PreS2_P-RF-B      ctgctcaaaatactgtctccaccacatcgtcacacttatcgaagactggg
KF053179_PreS2_P-RF-B      ctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggg
KJ803772_PreS2_P-RF-B      ctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggg
KF053166_PreS2_P-RF-B      ctgttcagaacactgcctctcccatatcgtcaatcttatcgacgactggg
KJ803827_PreS2_P-RF-B      ctgttcagaacactgcctctcccatatcgtcaatcttatcgacgactggg
KJ717800_PreS2_P-RF-C      ctgttccgacttctgcctctcccatatcgtcaatcttctcgaggactggg
KJ803791_PreS2_P-RF-C      ctgttccgacttctgcctctcccatatcgtcaatcttctcgaggactggg
AB241109_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KC315400_PreS2_P-RF-C      ctgctccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KJ717815_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KJ717816_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KJ803803_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KF053188_PreS2_P-RF-C      ctgttccgaatactgcctctcccatatcgtcaatcttatcgaggactggg
KJ803782_PreS2_P-RF-C      ctgttccgaatactgcctctcccatatcgtcaatcttatcgaggactggg
KJ717814_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KJ803802_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
MF925389_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KX096713_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377627_PreS2_P-RF-C      ctgttccgactactgyctcwcacatatcgtcaatcttctcgaggaytggg
JX504540_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcatcaatcttctcgaggattggg
FJ562223_PreS2_P-RF-C      ctgttccgactactgyctcwcscatatcgtcaatcttctcgaggactggg
JX036358_PreS2_P-RF-D      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggg
JQ040175_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB031265_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
JF436923_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
MF925382_PreS2_P-RF-C      ctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggg
MG826147_PreS2_P-RF-C      cttttccgactattgcctctcccatttcatcaatcttctcgagggctggg
MG826141_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KJ598675_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
MG826146_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
MG826148_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KJ803785_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
FR714496_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KJ717832_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KJ717794_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KJ803788_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KJ803798_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
JQ027310_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
MF925381_PreS2_P-RF-C      ctgttccgactattgcctctcccatatcgtcaatcttctcgaggactggg
KF053160_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KJ803753_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KJ803804_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KJ410506_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
GQ924618_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
JQ801476_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
MF925370_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
JF436919_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AP011102_PreS2_P-RF-C      ctgttccgactattgcctctcccatatcgtcaatcttcttgaggactggg
AB493842_PreS2_P-RF-C      ctgttccgactattgcctctcccatctcgtcaatcttctcgaggactggg
AP011103_PreS2_P-RF-C      ctgttccgactattgcctctcccatctcgtcaatcttctcgaggactggg
AB105172_PreS2_P-RF-C      ctgttccgactattgcctctcccatctcgtcaatcttctcgaggactggg
AB493840_PreS2_P-RF-C      ctgttccgactattgcctctcccatctcgtcaatcttctcgaggattggg
AB493837_PreS2_P-RF-C      ctgttccgactattgcctctcccatctcgtcaatcttcttgaggactggg
AB493838_PreS2_P-RF-C      ctgttccgactattgcctcacccatctcgtcaatcttctcgaggactggg
AB493847_PreS2_P-RF-C      ctgttccgactattgcctcacccatctcgtcaatcttctcgaggactggg
GQ358155_PreS2_P-RF-C      ctgttccgactattgcctctcccatctcgtcaatcttctcgaggactggg
GQ358156_PreS2_P-RF-C      ctgttccgactattgcctctcccatctcgtcaatcttctcgaggactggg
HQ700530_PreS2_P-RF-C      ttgttccgactactgcctctcccatatcgtcaatcttmkcgacgactggg
HQ700523_PreS2_P-RF-C      ttgttccgactactgcttatcccatatcgtcaatcttctcgaggactggg
HQ700531_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttatcgaggactggg
HQ700532_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttatcgaggactggg
GU357843_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttatcgaagactggg
GQ377590_PreS2_P-RF-C      ctgytcmgamtactgyctcwsccatatcgtcaatcttctcgargactggg
FJ562294_PreS2_P-RF-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggg
HQ700527_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatctcctccaggactggg
HQ700528_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctccaggactggg
HQ700519_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
HQ700521_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
HQ700518_PreS2_P-RF-C      ctgttccgactattgcctctcccatatcgtcaatcttctcgaggactggg
JQ040146_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB367800_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU589337_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaattttctcgaggactggg
FJ032343_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaattttctcgaggactggg
HQ700526_PreS2_P-RF-C      ctgttccgacttctgcctctaccatatcgtcaatcttatcgaggactggg
GQ377539_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562226_PreS2_P-RF-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggattggg
KC774344_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
JX661485_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU717211_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
FJ715345_PreS2_P-RF-C      ctgttccgactactgcctcgcccatattgtcaatcttctcgaggactggg
FJ715346_PreS2_P-RF-C      ctgttccgactactgcctcgcccatattgtcaatcttctcgaggactggg
FJ715347_PreS2_P-RF-C      ctgttccgactactgcctcgcccatattgtcaatcttctcgaggactggg
FJ562229_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU522070_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU871995_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU871988_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU871991_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU871994_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU871996_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU871999_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU871981_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU871983_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU871986_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU871987_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU871989_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU871990_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU871992_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU871993_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU871984_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
EU871985_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
AB367393_PreS2_P-RF-C      ctgttccgactactgcctcgcccatatcgtcaatcttctcgaggactggg
KJ173350_PreS2_P-RF-C      ctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggg
KC774188_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377602_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562336_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatctgctcgaggactggg
EU939602_PreS2_P-RF-C      ctgttccgactactgcctcgcccatatcgtcaatcttctcgaggactggg
Y18857_PreS2_P-RF-CB       ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939577_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
MT426530_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426466_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426471_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426544_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426523_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426479_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426462_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426499_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426557_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426524_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426485_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggattggg
MT426456_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426455_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426467_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426527_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426541_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426460_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426522_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426562_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426546_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426540_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426539_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426533_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426526_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426515_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaattttctcgaggactggg
MT426512_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426469_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426492_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426519_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426538_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426514_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426503_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426481_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426569_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426564_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426563_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttcgcgaggactggg
MT426560_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426558_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426575_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426556_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426555_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426553_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426549_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426545_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426542_PreS2_P-RF-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
MT426537_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426531_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426534_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426518_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426517_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426509_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426508_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426504_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426502_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426554_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426500_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426543_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426559_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426489_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426488_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426486_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426483_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426480_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426478_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426473_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426470_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426465_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426464_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426461_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426457_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426459_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426487_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426496_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426507_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426547_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426572_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426463_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426468_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426472_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426475_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426476_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426477_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426482_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426484_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426490_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426491_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426493_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426494_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426495_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426497_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426498_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426501_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426505_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426506_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426510_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426511_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426513_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426520_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426521_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426525_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426528_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426529_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426532_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426536_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426550_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426551_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426561_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426565_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426566_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426567_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426568_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426570_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426571_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426573_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426574_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426576_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MT426535_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU919166_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU919167_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173320_PreS2_P-RF-C      ctgttccgactactgcctcacacatatcatcaatcttctcgaggattggg
KJ173322_PreS2_P-RF-C      ctgttccgactactgcctcacacatatcatcaatcttctcgaggattggg
FJ562267_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939668_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774324_PreS2_P-RF-C      ctgttccgacttctgcctcacccatatcgtcaatcttctcgaggactggg
GQ377633_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ032337_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
HQ700547_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttcttgaggactggg
DQ089798_PreS2_P-RF-C      ctgttccgactattgcctcacccatatcgtcaatcttctcgaggactggg
M38454_PreS2_P-RF-CB       ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774222_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaagactggg
GU385774_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377548_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013843_PreS2_P-RF-C      ctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173325_PreS2_P-RF-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggattggg
KJ173279_PreS2_P-RF-C      ctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggg
JF436922_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562227_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
AB670303_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB049609_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY363263_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB367400_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377565_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377581_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AF461361_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013816_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377534_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MG826149_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377594_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
FJ386646_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AF411409_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939565_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377520_PreS2_P-RF-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
KJ173329_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173326_PreS2_P-RF-C      ctgttccgactactgcctcacccacatcgtcaatcttctcgaggattggg
MG893559_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964351_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX661498_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377607_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB642096_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EF494376_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562305_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939589_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KM875422_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173358_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939551_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ787446_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ787480_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774183_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX661487_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377556_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
GQ377544_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
GQ377516_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562314_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386649_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU787444_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcatcaatcttctcgaggactggg
AY123424_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774246_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774258_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774317_PreS2_P-RF-C      ctgttccgactactgcctcgcccatatcgtcaatcttctcgaggactggg
KC774322_PreS2_P-RF-C      ctgttccgactactgcctcgcccatatcgtcaatcttctcgaggactggg
MG893561_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KC774186_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774230_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173349_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KM213033_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774349_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MK321265_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MK720627_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MK720628_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KR013806_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
LC279263_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
LC279264_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
LC279265_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
LC279266_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
LC279267_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774332_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774263_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774341_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386578_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386585_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY470893_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963883_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774328_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386633_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU871997_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KY881840_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB198084_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX661494_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ562287_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
LC458432_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774294_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386581_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX429896_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
Y18856_PreS2_P-RF-CB       ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963993_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963990_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173299_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KJ173300_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX026887_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963991_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963994_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963995_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963998_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963999_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964001_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU964003_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
HQ700520_PreS2_P-RF-C      ctgttccgactactgcctttcccatatcgtcaatcttctcgaggactggg
KU695742_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
X75656_PreS2_P-RF-CB       ctgttccgactactgcctctctcatttcgtcaatcttctcgaggactggg
HQ700542_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
KU695744_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtccaacttcgcgagaactggg
KU695746_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtccagcttcgtgagaattggg
HQ700505_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtccatcttctcgaggactggg
KU695741_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtccatcttctcgaggactggg
KU695743_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtccatcttctcgaggactggg
AP011108_PreS2_P-RF-C      ctgttccgactactgcctctcccgtatcgtcaatcttctcgaagactggg
HQ700507_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
HQ700508_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
HQ700509_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
HQ700515_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
HQ700580_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
HQ700557_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
HQ700560_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
HQ700498_PreS2_P-RF-C      ctgttccgactactgcctcgcccatatcgtcaatcttctcgaggactggg
HQ700499_PreS2_P-RF-C      ctgttccgactactgcctcgcccatatcgtcaatcttctcgaggactggg
KU695745_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
HQ700554_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
HQ700462_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
HQ700485_PreS2_P-RF-C      ctgttccgacttctgcctctcccatatcgtcaatcttctcgaggactggg
JX036329_PreS2_P-RF-C      ctgttccgactactgccttacccacatcgtcaatcttctcgaggactggg
AB033557_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
JX036328_PreS2_P-RF-C      ctgttccgactactgccttacccacatcgtcaatcttctcgaggactggg
AY206374_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
FJ562317_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
MG826144_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
GQ377560_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KC774198_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KC774201_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KC774193_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggattggg
KC774323_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
KC774291_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
KC774307_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
LC416040_PreS2_P-RF-C      ctgttccgacttctgcctctcccatatcgtcaatcttctcgaggactggg
KT003704_PreS2_P-RF-C      ctgttccgacttctgcctctcccatatcgtcaatcttctcgaggactggg
AP011104_PreS2_P-RF-C      ctgttctgacttctgcctctcccatatcgtcaatcttctcgaggactggg
AP011105_PreS2_P-RF-C      ctgttctgacttctgcctctcccatatcgtcaatcttctcgaggactggg
KP148352_PreS2_P-RF-C      ctgttccgacttctgcctctcccatatcgtcaatcttctcgaggactggg
EU939547_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JQ040148_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB300369_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB205152_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386586_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
AB195950_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB195951_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JF828938_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JF828936_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JF828935_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JF828933_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JF828934_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JQ040142_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JX661486_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MG893554_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MG893555_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB367419_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MG826142_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
KC774305_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AF233236_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU881995_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KC774234_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
EU916232_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
KU964316_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
KU964313_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
KU964005_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
KU964006_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
KU964007_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
KU964008_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
KU964009_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
KU964010_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
KU964303_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
KU964304_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
KU964305_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
KU964307_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
KU964308_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
KU964309_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
KU964310_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
KU964311_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
KU964312_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
KU964314_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
KU964315_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
KU964317_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
KU964306_PreS2_P-RF-C      ctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggg
KJ410520_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AB195940_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaagactggg
AB195941_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaagactggg
KC774212_PreS2_P-RF-C      ctgttccgactactgccttacccacatcgtcaatcttctcgaggactggg
JQ732168_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AY040627_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715387_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715384_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715385_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715411_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715412_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715413_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ715414_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AY247030_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
HM750133_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
AY123041_PreS2_P-RF-C      ctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggg
AF330110_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU939606_PreS2_P-RF-C      ctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggg
KU963862_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377522_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386635_PreS2_P-RF-C      ctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggg
GQ377611_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963869_PreS2_P-RF-C      ctgttccgactactgccttacccatatcgtcaatcttctcgaggactggg
KU963868_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttcccgaggactggg
KU963859_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963856_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963857_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963858_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963860_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963861_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963863_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963864_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963865_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963866_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963867_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
KU963870_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU916239_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU916241_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU916240_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
JN400086_PreS2_P-RF-C      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
AB195956_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaagactggg
AB195957_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaagactggg
AB195939_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaagactggg
AB195955_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaagactggg
AY167095_PreS2_P-RF-C      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
FJ386674_PreS2_P-RF-B      ctgctcagaacactgtctctaccacatcgtcaatctcatcgaagactggg
MF925402_PreS2_P-RF-B      ctgctcagaatactgcctctgccatatcgtcaatcttctcgaagactggg
KX774505_PreS2_P-RF-B      ctgttcagaacactgcctcttccatatcgtcaatcttgtcgacgactggg
EU939631_PreS2_P-RF-B      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
EU882006_PreS2_P-RF-C      ctgttccgactactgcctctgccatatcgtcaatcttatcgaagactggg
EU939620_PreS2_P-RF-C      ctgctcagaatactgtctctcccatatcgtcaatcttatcgaagactggg
HQ684848_PreS2_P-RF-C      ctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggg
EU939630_PreS2_P-RF-C      ctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggg
EU939623_PreS2_P-RF-C      ctgctcagaatactgtctctgccatatcgtcaatctcatcgaagactggg
FJ562328_PreS2_P-RF-C      ctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggg
FJ562247_PreS2_P-RF-C      ctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggg
GQ377604_PreS2_P-RF-C      ctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggg
GQ377573_PreS2_P-RF-C      ctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggg
GQ377613_PreS2_P-RF-C      ctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggg
GQ377592_PreS2_P-RF-C      ctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggg
EU939621_PreS2_P-RF-C      ctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggg
JQ040174_PreS2_P-RF-C      ctgttcagaatactgtctctgccatatcgtcaatcttatcgaagactggg
GQ377549_PreS2_P-RF-C      ctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggg
GQ377634_PreS2_P-RF-C      ctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggg
GQ377626_PreS2_P-RF-C      ctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggg
GQ377564_PreS2_P-RF-C      ctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggg
GQ377596_PreS2_P-RF-C      ctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggg
GQ377614_PreS2_P-RF-C      ctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggg
HQ684849_PreS2_P-RF-B      ctgttccgactactgcctcacccatatcgtcaatcttatcgaagactggg
KC774178_PreS2_P-RF-B      ctgttccgactactgcctcacccatatcgtcaatcttatcgaagactggg
KC774364_PreS2_P-RF-B      ctgttccgactactgcctcacccatatcgtcaatcttatcgaagactggg
KP148337_PreS2_P-RF-B      ctgttccgactactgtctcacccatatcgtcaatcttctcgaagactggg
JQ412091_PreS2_P-RF-B      ctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggg
GQ377630_PreS2_P-RF-B      ctgttccgactactgcctcacccatatcgtcaatcttcttgaggactggg
GQ377635_PreS2_P-RF-B      ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggg
MG826150_PreS2_P-RF-B      ctgctcagaatactgtctcagccatatcgtcaatctcatcgacgactggg
MK052976_PreS2_P-RF-B      ctgctcagaatactgtctctgccatatcgtcaaccttatcgaagactggg
MG826145_PreS2_P-RF-B      ctgctcagaatactgtatcggccatatcgtcaatcttatcgaagactggg
MH746813_PreS2_P-RF-B      ctgctcagaatactgtatcggccatatcgtcaatcttatcgaagactggg
MH746811_PreS2_P-RF-B      ctgctcagaatactgtatcgaccatatcgtcaatcttatcgaagactggg
MH746812_PreS2_P-RF-B      ctgctcagaatactgtatcgaccatatcgtcaatcttatcgaagactggg
GQ377595_PreS2_P-RF-B      ctgctcagaatactgtatcggccatatcgtcaatcttatcgaagactggg
MH094410_PreS2_P-RF-B      ctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggg
MG826151_PreS2_P-RF-B      ctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggg
EU939629_PreS2_P-RF-B      ctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggg
KC793112_PreS2_P-RF-B      ctgctcagaatactgtctcagccatatcgtcaatctcatcgaagactggg
JQ801477_PreS2_P-RF-B      ctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggg
MK052967_PreS2_P-RF-B      ctgctcagaatactgtctctgccatatcgtcaaccttatcgaagactggg
MK052968_PreS2_P-RF-B      ctgctcagaatactgtctctgccatatcgtcaaccttatcgaagactggg
MK052970_PreS2_P-RF-B      ctgctcagaatactgtctctgccatatcgtcaaccttatcgaagactggg
EU939627_PreS2_P-RF-B      ctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggg
KJ410497_PreS2_P-RF-B      ctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggg
EU660227_PreS2_P-RF-B      ctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggg
KC774414_PreS2_P-RF-B      ctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggg
                            *  **  *                          *          ** *

KJ803822_PreS2_P-RF-C      ggccctgcaccgaacatggagaacacaacatcaggattcctaggaccccc
HE981179_PreS2_P-RF-F      ggccctgctatgaacatggacaacatcacatcaggactcctaggacccct
KJ586803_PreS2_P-RF-A      ggccctgctatgaacatggagaacatcacatcaggattcctaggacccct
GQ161806_PreS2_P-RF-E      gaccytgcaccgaacatggaaagcatcacatcaggattcctaggacccct
FN594767_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KX660685_PreS2_P-RF-D      gaccttgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683641_PreS2_P-RF-D      gaccttgcgccgaacatggagaacatcacatcaggattcctaggacccct
JX036359_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN257154_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683675_PreS2_P-RF-D      gaccatgcgccgaacatggagaacatcacatcaggattcctaagacccct
KX357641_PreS2_P-RF-D      gaccctgctctgaacatggagaacatcacatcaggactcctaggacccct
X68292_PreS2_P-RF-DA       gaccctgtgacgatcatggagaacatcacatcaggattcctaggacccct
AY341335_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN257189_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB674434_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
MF925397_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN257204_PreS2_P-RF-D      gaccctgcgctgaacatggaaaacatcacatcaggattcctcgcacccct
JN257191_PreS2_P-RF-D      gaccytgcactgaacatggaaaacatcacatcaggaytcctaggacccct
JN642160_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MF925396_PreS2_P-RF-D      gaccttgtgcagaacatggagaacatcacatcaggactcctaggacccct
KJ803771_PreS2_P-RF-D      gtccctgcgatgaacatggagaacatcacatcaggattcctaggacccct
X80925_PreS2_P-RF-DE       gaccctgcgctgaacatggagaacatcacatcagacttcctaggacccct
JN664946_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MF925371_PreS2_P-RF-D      gtccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
EU594406_PreS2_P-RF-D      gaccctgcactgaacatggagaacatcacatcaggattcctaggacccct
JQ687532_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MF925360_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MF925401_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN688717_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN507835_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KM524357_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KR905422_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KT366503_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MF925388_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MF925392_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN040803_PreS2_P-RF-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
X65259_PreS2_P-RF-DA       gaccctgcactgaacatggagaacatcacatcaggattcctaggacccct
JX036330_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JF754616_PreS2_P-RF-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
JF754613_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN040798_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcccaggacccct
AB674436_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN642137_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN257216_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN642139_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB330368_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN257206_PreS2_P-RF-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN257207_PreS2_P-RF-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
MF925384_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB674433_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB674432_PreS2_P-RF-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
KF471643_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN642127_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN257174_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN257164_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN257210_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN642141_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN642152_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KY470853_PreS2_P-RF-D      gaccctgcgctgaacatggagaaaatcacatcaggattcctaaaacccct
JX036357_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FN594770_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaagattcctaggacccct
KY470844_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaacacccct
KY470843_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaacacccct
KY470846_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaacacccct
KY470847_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaacacccct
KY470849_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaacacccct
KY470850_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaacacccct
KY470855_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaacacccct
KY470856_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaacacccct
KY470854_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaacacccct
FJ904430_PreS2_P-RF-D      gaccttgcgccgaacatggagaacatcacatcaggattcctaggacccct
KM606741_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FJ349207_PreS2_P-RF-D      ggccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AM494716_PreS2_P-RF-D      gaccctgcactgaacatggagaacatcacatcaggattcctaggacccct
FJ904436_PreS2_P-RF-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
FJ904414_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FJ904416_PreS2_P-RF-D      gaccctgcactgaacatggagaacatcacatcaggattcctaggacccct
FJ904417_PreS2_P-RF-D      gaccctgcactgaacatggagaacatcacatcaggattcctaggacccct
DQ991753_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FJ904441_PreS2_P-RF-D      gaccctgcgttgaacatggagaacatcacatcaggattcctaggacccct
KX357627_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KP168421_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FN594771_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FJ904425_PreS2_P-RF-D      gaccctgcgttgaacatggagaacatcacatcaggattcctaggacccct
KX357624_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KX357631_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FJ904405_PreS2_P-RF-D      gaccttgcgctgaacatggagaacatcacatcaggactcctaggacccct
KP995112_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KP168420_PreS2_P-RF-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
KU736916_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FJ904398_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FJ904442_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KU711666_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FN594769_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FJ904401_PreS2_P-RF-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
FJ904404_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FJ904396_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FJ904400_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KU736917_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KU736914_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KU736915_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MH685719_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KX827299_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
GU177079_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FJ904403_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KX357628_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KM606751_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FJ904444_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KF170740_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
GQ161754_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FJ904447_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FJ904440_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FJ904394_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KX357636_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KX357634_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FJ904407_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FJ904408_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FJ904409_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KX357629_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KX357626_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KX357625_PreS2_P-RF-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
KU736923_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FJ904406_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KM606750_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KX357635_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KX357623_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KX357633_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KX357630_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KP168416_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KP168417_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KP168418_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KU736921_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KU736922_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KJ647356_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683620_PreS2_P-RF-D      gaccttgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683662_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683581_PreS2_P-RF-D      gaccctgcgccgaatatggagaacatcacatcaggattcctaggacccct
MN683730_PreS2_P-RF-D      gaccatgcgccgaacatggagaacatcacatcaggattcctaggacccct
KY629632_PreS2_P-RF-D      gaccctgcgccgaacatggagaacattacatcaggactcctagcacccct
KT991420_PreS2_P-RF-D      gaccttgcgccgaacatggagaacatcacatcaggattcctaggacccct
KT991423_PreS2_P-RF-D      gaccttgcgccgaacatggagaacatcacatcaggattcctaggacccct
FJ562278_PreS2_P-RF-D      gaccytgcgccgaacatggagaacatcacatcaggattcctaggacccct
KT991417_PreS2_P-RF-D      gaccttgtgccgaacatggagaacatcacatcaggattcctaggacccct
MN683624_PreS2_P-RF-D      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
KC774484_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774498_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774431_PreS2_P-RF-D      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
KC774449_PreS2_P-RF-D      gaccttgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683582_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683655_PreS2_P-RF-D      gaccttgcgccgaacatggagaacataacatcaggattcctaggacccct
MN683634_PreS2_P-RF-D      gaccttgcgccgaacatggagaacatcacatcaggattcctaggacccct
KT991421_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KT991419_PreS2_P-RF-D      gaccttgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774478_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774480_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774452_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctcggacccct
AY862865_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
AY862864_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
AY862866_PreS2_P-RF-D      gaccctgcgccgagcatggagaacatcacatcaggattcctaggacccct
MN683618_PreS2_P-RF-D      gaccttgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774479_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KY670781_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774463_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774489_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683571_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683592_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683594_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683609_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774487_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
JX036332_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
JF491448_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683622_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
JF491455_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
AY817513_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
AY817509_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
AB270535_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683627_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN650068_PreS2_P-RF-D      gaccctgcgccgaacatggagaacataacatcaggattcctaggacccct
KC774442_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
EU787435_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
DQ478898_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774492_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KX660677_PreS2_P-RF-D      gaccctgcgccgatcatggagaacatcacatcaggattcctaggacccct
MN683668_PreS2_P-RF-D      gaccctgcgccgatcatggagaacatcacatcaggattcctaggacccct
KF917451_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683713_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683714_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774490_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774481_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
AY817510_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683645_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683640_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683623_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683610_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683579_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683574_PreS2_P-RF-D      gaccttgcgccgaacatggagaacatcacatcaggattcctaggacccct
KU519423_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatccggattcctaggacccct
MN683674_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatccggattcctaggacccct
KC774486_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774483_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774474_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774454_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774453_PreS2_P-RF-D      gaccttgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774439_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KP276254_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KP276255_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
JF491449_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774470_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774458_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774428_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683717_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683597_PreS2_P-RF-D      gaccctgcgccgaatatggagaacatcacatcaggattcctaggacccct
MN683652_PreS2_P-RF-D      gaccctgcgccgaatatggagaacatcacatcaggattcctaggacccct
MN683684_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683676_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatccggattcctaggacccct
MN683657_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683656_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683654_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683639_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683625_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683611_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683603_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683596_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683572_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KX660675_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683607_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683613_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683614_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683615_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683666_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774461_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774447_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
DQ478889_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
AY817512_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
AY800249_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774435_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774455_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774443_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683683_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683626_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774466_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683621_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683637_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774448_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
JF491451_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683619_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774488_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774493_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774422_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggactcctaggacccct
EU787434_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
AY817515_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774457_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683650_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774495_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774420_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774426_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774475_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KX660674_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
DQ478886_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774476_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KX660680_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683605_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683664_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683665_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683635_PreS2_P-RF-D      gaccctgcgcagaacatggagaacatcacatcaggattcctaggacccct
MN683659_PreS2_P-RF-D      gaccctgcgcagaacatggagaacatcacatcaggattcctaggacccct
MN683658_PreS2_P-RF-D      gaccctgcgcagaacatggagaacatcacatcaggattcctaggacccct
MN683678_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683670_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683663_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683643_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683644_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683647_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683649_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683642_PreS2_P-RF-D      gaccctgcgccgaacatggacaacatcacatcaggattcctaggacccct
MN683638_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683617_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683616_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683612_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683590_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683586_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN657317_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683632_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683660_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683661_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN657316_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN657315_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683580_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KU519422_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683672_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774494_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774434_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774433_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774432_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774430_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774468_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774425_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774424_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
JX429898_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774472_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774497_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774499_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683630_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683651_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683653_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
JF491456_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
DQ478897_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774423_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
KC774471_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683636_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
MN683669_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
DQ478887_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
DQ478892_PreS2_P-RF-D      gaccctgcgccgaacatggagaacatcacatcaggattcctaggacccct
HQ700492_PreS2_P-RF-D      gtccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FJ904437_PreS2_P-RF-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB674504_PreS2_P-RF-D      gaccctgtgctgaacatggagaacatcacatcaggattcctaggacccct
DQ478890_PreS2_P-RF-D      gaccctgtgcggaacatggaaaacatcacatcacgattcctaggacccct
MN683588_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683712_PreS2_P-RF-D      gaccctgcgatgaacatggagaacatcacatcaggattcctaggacccct
KT991427_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683721_PreS2_P-RF-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683722_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KX660686_PreS2_P-RF-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683707_PreS2_P-RF-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683716_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN650076_PreS2_P-RF-D      gaccctgcgctgaacatggagaacataacatcaggattcctaggacccct
MN683671_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683673_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683692_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683628_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KX660684_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683706_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KT991424_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
HM750144_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN650069_PreS2_P-RF-D      gaccctgcgttgaacatggagaacatcacatcaggattcctaggacccct
MN683677_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683720_PreS2_P-RF-D      gaccctgcactgaacatggagaacatcacatcaggattcctaggacccct
MN683718_PreS2_P-RF-D      gaccctgcgcggaacatggagaacatcacatcaggattcctaggacccct
MN683688_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN650083_PreS2_P-RF-D      gaccctgcgctgaacatggagaacattacatcaggattcctaggacccct
MN650081_PreS2_P-RF-D      gaccctgcgctgaacatggagaacattacatcaggattcctaggacccct
MN650082_PreS2_P-RF-D      gaccctgcgctgaacatggagaacattacatcaggattcctaggacccct
MN650084_PreS2_P-RF-D      gaccctgcgctgaacatggagaacattacatcaggattcctaggacccct
MN650080_PreS2_P-RF-D      gaccctgcgctgaacatggagaacattacatcaggattcctaggacccct
KX660689_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683711_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KC774485_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
HM750146_PreS2_P-RF-D      gaccctgcgctgaaaatggagaacatcacatcaggattcctaggacccct
HM750145_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
HM750143_PreS2_P-RF-D      gaccctgcgatgaacatggagaacatcacatcaggattcctaggacccct
FJ562263_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AY817511_PreS2_P-RF-D      gaccctgcgatgaacatggagaacatcacatcaggattcctaggacccct
AY057948_PreS2_P-RF-D      gaccctgcactgaacatggagaacatcacatcaggattcctaggacccct
MN683700_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683694_PreS2_P-RF-D      gaccctgcgcagaacatggagaacatcacatcaggattcctaggacccct
HM750147_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
HM750148_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KC774482_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683699_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683703_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683697_PreS2_P-RF-D      gaccctgcgctgaatatggagaacatcacatcaggattcctaggacccct
MN683587_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683725_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683719_PreS2_P-RF-D      gaccctgcactgaacatggagaacatcacatcaggattcctaggacccct
MN683715_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683696_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683680_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN650087_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683687_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN650085_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN650072_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN650073_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN650074_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN650075_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN650077_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN650078_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN650086_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KX354997_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KP276253_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KC774456_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
HM750150_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FJ349241_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683686_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683693_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683724_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
HM750142_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
HM750149_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KP276256_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN650079_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683689_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683690_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683691_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683695_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683723_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683584_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683679_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN683685_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KP288875_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
J02202_PreS2_P-RF-DE       gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MF618346_PreS2_P-RF-D      gaccctgcgcagaacatggagaacatcacatcaggattcctaggacccct
KJ470898_PreS2_P-RF-D      gaccttgcgcagaacatggagaacatcacatcaggattcctaggacccct
HQ700494_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB048702_PreS2_P-RF-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
HQ700579_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
HQ700585_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
HQ700536_PreS2_P-RF-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
HQ700535_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MH481862_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MH481861_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MH481860_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MH481858_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MH481859_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
HQ700534_PreS2_P-RF-D      gaccctgcratgaacatggagaacatcacatcaggattcctaggacccct
HQ700541_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
HQ700540_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
HQ700539_PreS2_P-RF-D      gaccytgcgctgaacatggagaacatcacatcaggattcctaggacccct
HQ700493_PreS2_P-RF-D      gaccctgcactgaacatggagaacatcacatcaggattcctaggacccct
AB048703_PreS2_P-RF-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
HQ700538_PreS2_P-RF-D      gaccytgcgctgaacatggagaacatcacatcaggattcctaggacccct
HQ700537_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
HQ700533_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
HQ700582_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
HQ700503_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
HQ700500_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB033559_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
HQ700524_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
HQ700525_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
HQ700497_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
HQ700501_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
HQ700581_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
HQ700583_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
HQ700584_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KJ470897_PreS2_P-RF-D      gaccctgcgcagaacatggagaacatcacatcaggattcctaggacccct
KF192835_PreS2_P-RF-D      gaccctgcgcagaacatggagaacatcacatcaggattcctaggacccct
KF192840_PreS2_P-RF-D      gaccctgcgcagaacatggagaacatcacatcaggattcctaggacccct
KF192833_PreS2_P-RF-D      gaccctgcgcagaacatggagaacatcacatcaggattcctaggacccct
KF192836_PreS2_P-RF-D      gaccctgcgcagaacatggagaacatcacatcaggattcctaggacccct
KF192837_PreS2_P-RF-D      gaccctgcgcagaacatggagaacatcacatcaggattcctaggacccct
KF192838_PreS2_P-RF-D      gaccctgcgcagaacatggagaacatcacatcaggattcctaggacccct
KF192839_PreS2_P-RF-D      gaccctgcgcagaacatggagaacatcacatcaggattcctaggacccct
KF192841_PreS2_P-RF-D      gaccctgcgcagaacatggagaacatcacatcaggattcctaggacccct
MF618347_PreS2_P-RF-D      gaccctgcgcagaacatggagaacatcacatcaggattcctaggacccct
KJ470887_PreS2_P-RF-D      gaccctgcgcagaacatggagaacatcacatcaggattcctaggacccct
FJ692536_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KF779353_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KJ470884_PreS2_P-RF-D      gaccctgcgcagaacatggagaacatcacatcaggattcctaggacccct
KJ470886_PreS2_P-RF-D      gaccctgcgcagaacatggagaacatcacatcaggattcctaggacccct
KJ470888_PreS2_P-RF-D      gaccctgcgcagaacatggagaacatcacatcaggattcctaggacccct
KJ470890_PreS2_P-RF-D      gaccctgcgcagaacatggagaacatcacatcaggattcctaggacccct
KJ470891_PreS2_P-RF-D      gaccctgcgcagaacatggagaacatcacatcaggattcctaggacccct
EU185780_PreS2_P-RF-A      gaccctgtgacgaacatggagaacatcacatcaggactcctaggacccct
KC012653_PreS2_P-RF-A      gaccctgtgacgaacatggagaacatcacatcaggactcctaggacccct
DQ464164_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctacaacccct
DQ464165_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctacaacccct
DQ464166_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctacaacccct
DQ464167_PreS2_P-RF-D      gaccctgcgctgaacatggagagcatcacatcaggattcctacaacccct
AF297619_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AY230120_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AY236161_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AF297620_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JN664935_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
FJ349221_PreS2_P-RF-D      gaccctgtgctgagcatggagaacatcacatcaggattcctaggacccct
AJ627221_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK541689_PreS2_P-RF-D      gaccttgcaccgaacatggagaacatcacatcaggattcctaggacccct
MF488699_PreS2_P-RF-D      gaccttgcaccgaacatggagaacatcacatcaggattcctaggacccct
JN664929_PreS2_P-RF-D      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
AB033558_PreS2_P-RF-D      gaccttgcaccgaacatggagaacatcacatcaggattcctaggacccct
GQ205379_PreS2_P-RF-D      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
MK516279_PreS2_P-RF-D      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
MK516280_PreS2_P-RF-D      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
KT366505_PreS2_P-RF-D      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
DQ315779_PreS2_P-RF-D      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JN664940_PreS2_P-RF-D      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JN664925_PreS2_P-RF-D      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JN664915_PreS2_P-RF-D      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JN664933_PreS2_P-RF-D      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
KC875339_PreS2_P-RF-D      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
KC875338_PreS2_P-RF-D      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
GQ205377_PreS2_P-RF-D      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
GQ205378_PreS2_P-RF-D      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
GQ205386_PreS2_P-RF-D      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
GQ205387_PreS2_P-RF-D      gaccctgcaccgaacatggagaacatcacatcaggattcctaggacccct
JN688715_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JF440013_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
JF440011_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
JF439999_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
JF440006_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
JF440001_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
JF440000_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
JF440010_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
JF440009_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
JF440004_PreS2_P-RF-D      gaccctgcgctgagcatggagaacatcacatcaggactcctaggacccct
JF440005_PreS2_P-RF-D      gaccctgcgctgagcatggagaacatcacatcaggactcctaggacccct
JF439998_PreS2_P-RF-D      gaccctgtgctgaacatggagaacatcacatcaggactcctaggacccct
JF439995_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
JF439994_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
JF439996_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
JF440002_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
JF440003_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
JF440007_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
JF440012_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
JF440014_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
JF440015_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
JF440017_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
MK052957_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK052969_PreS2_P-RF-D      gaccctgcgctgaacatggaaaacatcacatcaggattcctaggacccct
KM577666_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KM386676_PreS2_P-RF-D      gaccttgcgctgaacatggagaacatcacatcaggactcctaggacccct
AB188243_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KX827302_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KU668440_PreS2_P-RF-D      gaccctgcgcagaacatggagaacatcacatcaggattcctaggacccct
JN664934_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MH464835_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
KM359442_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MG877711_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
FJ349212_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MH724240_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KJ647349_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KM524337_PreS2_P-RF-D      gtccctgcactgaacatggagaacatcacatcaggattcctaggacccct
DQ315777_PreS2_P-RF-D      gtccctgcactgaacatggagaacatcacatcaggattcctaggacccct
KM524336_PreS2_P-RF-D      gtccctgcactgaacatggagaacatcacatcaggattcctaggacccct
MH724243_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB270538_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MH724239_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MF488702_PreS2_P-RF-D      gaccctgcgttgaacatggagaacatcacatcaggattcctaggacccct
MK618439_PreS2_P-RF-D      ggacctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JX898690_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KJ586811_PreS2_P-RF-D      gaccctgcgctcaacatggagaacatcacatcaggattcctaggacccct
MF967563_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JX898698_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JX898699_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JX898686_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JX898687_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JX898688_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
U95551_PreS2_P-RF-DE       gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AB210819_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AJ344117_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JX898693_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
JX898695_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
JX898696_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KM577665_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
GU563560_PreS2_P-RF-D      gaccctgcgctgaacatggcgaacagcatatcaggattcctaggacccct
KM577667_PreS2_P-RF-D      gaccttgcgctgaacatggagaacatcacatcaggattcctaggacccct
MH464851_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
AJ627217_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
KT366492_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggactcctaggacccct
KM524359_PreS2_P-RF-D      gaccctgcgctgaacatggagagcatcacatcaggattcctaggacccct
JN688689_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
AY373430_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK598653_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK598652_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK598654_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK598656_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MN507850_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK618442_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK618440_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK618438_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK618444_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MK618445_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
DQ111987_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
EU594435_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
EU594436_PreS2_P-RF-D      gaccctgcgctgaacatggagaacatcacatcaggattcctaggacccct
MH724222_PreS2_P-RF-D&n