HBVdb

Dataset for nucleotide sequence PreS1 of genotype RF

[Download (right click)] [Edit] [Sequences] [Repertoires]

1362 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


KJ586810_PreS1_P-RF-A      atggga-------gcacctctatcaacgactcgaaggggcatgggac---
HE981179_PreS1_P-RF-F      atggga-------gcacctctctcaacgacaagaaggggcatgggac---
KJ586803_PreS1_P-RF-A      atggga-------gcacctctctcaacga---------------------
FJ361772_PreS1_P-RF-G      atggga-------gctccgctttccaaatctcgacgaggcatgggga---
MG826145_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
MH746813_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
MH746811_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
MH746812_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
EU835240_PreS1_P-RF-G      atggga-------ggttggtcttccacacctcggaaaggcatgggga---
FJ023666_PreS1_P-RF-G      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
EU833891_PreS1_P-RF-G      atggga-------ggtccgtcttccaaacctcggaaaggcatgggga---
FJ882610_PreS1_P-RF-G      atggga-------ggtccgtcttccaaacctcggaaaggcatgggga---
FJ882614_PreS1_P-RF-G      atggga-------ggtccgtcttccaaacctcggaaaggcatgggga---
FJ882611_PreS1_P-RF-G      atggga-------ggttggtcttccacacctcggaaaggcatgggga---
FJ023665_PreS1_P-RF-G      atggga-------ggttggtcttccacacctcggaaaggcatgggga---
FJ023670_PreS1_P-RF-G      atggga-------ggttggtcttccacacctcggaaaggcatgggga---
FJ023664_PreS1_P-RF-G      atggga-------ggttggtcttccamacctcggaaaggcatgggga---
FJ023668_PreS1_P-RF-G      atggga-------ggttggtcttccacacctcggaaaggcatgggga---
FJ023673_PreS1_P-RF-G      atggga-------ggttggtcttccacacctcggaaaggcatgggga---
FJ023667_PreS1_P-RF-G      atggga-------ggttggtcttccacacctcggaaaggcatgggga---
FJ882617_PreS1_P-RF-G      atggga-------ggttggtcttccacacctcggaaaggcatgggga---
FJ882612_PreS1_P-RF-G      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
FJ882618_PreS1_P-RF-G      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
FJ882613_PreS1_P-RF-G      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
MK534663_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MH368022_PreS1_P-RF-G      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
MZ439798_PreS1_P-RF-G      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
FJ023659_PreS1_P-RF-B      atggga-------aggtgt---tccaccactcggaaaggcatgggga---
FJ023662_PreS1_P-RF-G      atgggt-------tgttgg---tcaaaacctcggaaaggcatgggga---
MK534669_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FR714490_PreS1_P-RF-G      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KC172106_PreS1_P-RF-G      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KY470996_PreS1_P-RF-G      -------------------------aaacctcggaaaggcatgggga---
KY471004_PreS1_P-RF-G      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KY471007_PreS1_P-RF-G      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KY470999_PreS1_P-RF-G      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KY471000_PreS1_P-RF-G      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KY471002_PreS1_P-RF-G      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KY470998_PreS1_P-RF-G      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KY471001_PreS1_P-RF-G      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KY471003_PreS1_P-RF-G      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KY471006_PreS1_P-RF-G      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KY470997_PreS1_P-RF-G      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KY471005_PreS1_P-RF-G      atgaga-------ggttggtcttccaaacctcggaaaggcatgggga---
KP148441_PreS1_P-RF-G      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KP148449_PreS1_P-RF-G      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KP148442_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KP148450_PreS1_P-RF-G      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KP148447_PreS1_P-RF-G      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KP148586_PreS1_P-RF-G      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
AB194949_PreS1_P-RF-A      atggga-------ggttcgtcaccaaaacctcgcaaaggcatgggga---
GQ161753_PreS1_P-RF-A      atggga-------g------------------------------------
GQ161767_PreS1_P-RF-A      atggga-------ggttggttaccaaaacctcgcaaaggcatgggga---
HF571060_PreS1_P-RF-A      atggga-------ggttggttaccaaaacctcgcaaaggcatgggga---
GQ161837_PreS1_P-RF-A      atggga-------ggttggttaccaaaacctcgcaaaggcatgggga---
GQ161838_PreS1_P-RF-A      atggga-------ggttggttaccaaaacctcgcaaaggcatgggga---
JQ707426_PreS1_P-RF-G      atggga-------ggttggtcatcaaaacctcgcaaaggcatgggga---
KP274926_PreS1_P-RF-G      atggga-------ggttggtcatcaaaacctcgcaaaggcatgggga---
JF440021_PreS1_P-RF-A      atggga-------ggttggtcatcaaaacctcgcaaaggcatgggga---
JF439776_PreS1_P-RF-A      atggga-------ggttggtcatcaaaacctcgcaaaggcatgggga---
JF440019_PreS1_P-RF-A      atggga-------ggttggtcatcaaaacctcgcaaaggcatgggga---
JF440022_PreS1_P-RF-A      atggga-------ggttggtcatcaaaacctcgcaaaggcatgggga---
MF925386_PreS1_P-RF-A      atggga-------ggttggtcatcaaaacctcgcaaaggcatgggga---
AB933283_PreS1_P-RF-A      atggga-------ggttggtcatcaaaacctcgcaaaggcatgggga---
AB453985_PreS1_P-RF-A      atggga-------ggttggtcatccaaacctcgcaaaggcatgggga---
AB222708_PreS1_P-RF-A      atggga-------ggttggtcatcaaaacctcgcaaaggcatgggga---
AB933282_PreS1_P-RF-A      atggga-------ggttggtcatcaaaacctcgcaaaggcatgggga---
GQ331048_PreS1_P-RF-A      atggga-------ggttggtcatcaacacctcgcaaaggcatgggga---
KF214656_PreS1_P-RF-A      atggga-------ggttggtcatcaaaacctcgcaaaggcatgggga---
HM146131_PreS1_P-RF-A      atggga-------ggttggtcatcaaaacctcgcaaaggcatgggga---
AY233277_PreS1_P-RF-A      atggga-------ggttggtcaacaaaacctcgcaaaggcatgggga---
AY161145_PreS1_P-RF-A      atggga-------ggttggacatcaaaacctcgcaaaggcatgggga---
AY161146_PreS1_P-RF-A      atggga-------ggttggacatcaaaacctcgcaaaggcatgggga---
AY161140_PreS1_P-RF-A      atggga-------ggttggtcatcaaaacctcgcaaaggcatgggga---
AY161141_PreS1_P-RF-A      atggga-------ggttggtcatcaaaacctcgcaaaggcatgggga---
MF488705_PreS1_P-RF-A      atggga-------ggttggtcatcaaaacctcgcaaaggcatgggga---
MF925404_PreS1_P-RF-A      atggga-------ggttggtcatcaaaacctcgcaaaggcatgggga---
MT426089_PreS1_P-RF-A      atggga-------ggttggtcatcaaaacctcgcaaaggcatgggga---
KX765835_PreS1_P-RF-G      atggga-------ggttggtcttccaaacctcgagaaggcatgggga---
EU833890_PreS1_P-RF-G      atggggctttcttggacggtccc-----tctcgagtgg-----ggaa---
AB933279_PreS1_P-RF-A      atggggctttcttggacggtccc-----tctcgagtgg-----ggaa---
AB933280_PreS1_P-RF-A      atggggctttcttggacggtccc-----tctcgagtgg-----ggaa---
AB933281_PreS1_P-RF-A      atggggctttcttggacggtccc-----tctcgagtgg-----ggaa---
EF464099_PreS1_P-RF-A      atggggctttcttggacggtccc-----tctcgagtgg-----ggaa---
JQ272887_PreS1_P-RF-G      atgggactttcttggacggtccc-----tctcgagtgg-----ggaa---
KF219922_PreS1_P-RF-G      atggggctttcttggacggtccc-----tctcgagtgg-----ggaa---
HE981180_PreS1_P-RF-G      atggggctttcctggacggtccc-----tctcgagtgg-----ggaa---
JQ272886_PreS1_P-RF-G      atggggctttcttggacggtccc-----tctcgagtgg-----ggaa---
KJ803822_PreS1_P-RF-C      atggga-------ggtcggtattccacacctcgaaaaggcatgggga---
FN594767_PreS1_P-RF-D      atgggg-------ctttcttggacggtccctctcgaatg---gggga---
GQ161806_PreS1_P-RF-E      atgggg-------ctttcttggacggtccctctcgaatg---gggga---
KU679954_PreS1_P-RF-C      atggga-------ggttggtcttccaagcctcggaaaggcatgggga---
KU679942_PreS1_P-RF-C      atggga-------ggttggtcttccaagcctcggaaaggcatgggga---
KU679943_PreS1_P-RF-B      atggga-------ggttggtcttccaagcctcggaaaggcatgggga---
KF873527_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgcaaaggcatgggga---
KU679956_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KU679958_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KF873522_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KU679941_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KF873523_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KF873524_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KF873521_PreS1_P-RF-B      atggga-------ggttggtcctccaaacctcggaaaggcatgggga---
KU679955_PreS1_P-RF-C      atggga-------ggttggtcctccaaacctcggaaaggcatgggga---
KU679950_PreS1_P-RF-C      atggga-------ggttggtcctccaaacctcggaaaggcatgggga---
KF873511_PreS1_P-RF-C      atggga-------ggttggacctccaaacctcggaaaggcatgggga---
KF873513_PreS1_P-RF-C      atggga-------ggttggacctccaaacctcggaaaggcatgggga---
KF873515_PreS1_P-RF-C      atggga-------ggttggacctccaaacctcggaaaggcatgggga---
KU679948_PreS1_P-RF-C      atggga-------ggttggtcctccaaacctcggaaaggcatgggga---
KU679944_PreS1_P-RF-B      atggga-------ggttggtcctccaaacctcggaaaggcatgggga---
KF873519_PreS1_P-RF-C      atggga-------ggttggtcctccaaacctcggaaaggcatgggga---
KU679953_PreS1_P-RF-B      atggga-------ggttggtcctccaaacctcggaaaggcatgggga---
KU679946_PreS1_P-RF-B      atggga-------ggttggtcctccaaacctcggaaaggcatgggga---
KF873517_PreS1_P-RF-B      atggga-------ggttggtcctccaaacctcggaaaggcatgggga---
KF873518_PreS1_P-RF-C      atggga-------ggttggtcctccaaacctcggaaaggcatgggga---
KF873530_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KU679952_PreS1_P-RF-C      akggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KF873537_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KU679945_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KF873538_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KF873542_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KF873543_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KF873540_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KF873531_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KF873532_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KF873533_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KF873534_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KF873535_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KU679939_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KU679940_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
MF925402_PreS1_P-RF-B      ----------------------------------------atggggc---
KF053166_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KJ803827_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MF925389_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JX036330_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcacgggga---
AB674504_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JX036359_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcacgggga---
JX036358_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KX660685_PreS1_P-RF-D      atggga-------ggttggacttccaaacctcgacaaggcatgggga---
MN683641_PreS1_P-RF-D      atggga-------ggttggacttccaaacctcgacaaggcatgggga---
KY470853_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683675_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KY470844_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KY470856_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KY470843_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KY470846_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KY470847_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KY470849_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KY470850_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KY470855_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KY470854_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN650068_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcaccaaggcatgggga---
MT645070_PreS1_P-RF-D      atggga-------ggttggtcttcgaaacctcgacaaggcatgggga---
MN683620_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
DQ478890_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatggtga---
MN650069_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcgtgggga---
AY057948_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683716_PreS1_P-RF-D      atggga-------ggttggtctgccaaacctcgacaaggcatgggga---
KT991427_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ562263_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KT991424_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774490_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683712_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683721_PreS1_P-RF-D      atggga-------ggttggacttccaaacctcgacaaggcatgggga---
KX660686_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683707_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683588_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683580_PreS1_P-RF-D      atggga-------ggttggacttccaaacctcgacaaggcatgggga---
MN683678_PreS1_P-RF-D      atggga-------ggttggacttccaaacctcgacaaggcatgggga---
MN683628_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KP276256_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683725_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683722_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KX660684_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683706_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683687_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683688_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN650076_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
HM750145_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683671_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683673_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683677_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683692_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683627_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683699_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
HM750149_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
HM750144_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN650083_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN650082_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN650080_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN650081_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN650084_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683718_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683715_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774485_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AY817511_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcggcaaggcatgggga---
MN683720_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683700_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683587_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683696_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683719_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN650085_PreS1_P-RF-D      atggga-------ggttggtcttccaaacatcgacaagggatgggga---
KX660689_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683711_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KX354997_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KP276253_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774456_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
HM750150_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
HM750147_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
HM750146_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
HM750143_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN650087_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN650079_PreS1_P-RF-D      atggga-------ggttggtcatccaaacctcgacaaggcatgggga---
FJ349241_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683691_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683695_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683690_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683686_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683693_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683724_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683689_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683694_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
HM750142_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683703_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
HM750148_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774482_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN650078_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaagaaaggcga---
MN650074_PreS1_P-RF-D      atggga-------ggcaggtcttccaaacctcgacaaggcatgggga---
MN683680_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683697_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683685_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN650075_PreS1_P-RF-D      atggga-------ggttggtcgtccaaacctcgacaaggcatgggga---
MN683584_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683679_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683723_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN650072_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN650077_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN650086_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN650073_PreS1_P-RF-D      atggag-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683581_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683618_PreS1_P-RF-D      atggga-------ggttggacttccaaacctcgacaaggcatgggga---
MN683730_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683622_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683623_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683624_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683655_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683582_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774431_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683634_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774479_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AY817513_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT645062_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KT991419_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774478_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774480_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KF917451_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT645063_PreS1_P-RF-D      atggca-------ggatgatcttccaaacctcgactaggcgtgcgga---
KT991421_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774448_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KX660677_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683668_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774486_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774499_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683612_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683616_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683625_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683609_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774487_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683656_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683657_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683597_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683652_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683596_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AY817512_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AY817510_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
DQ478887_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774424_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
DQ478892_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774489_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JF491456_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JF491448_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AY817509_PreS1_P-RF-D      acggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683645_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683592_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683594_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683572_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KP276255_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
DQ478889_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683683_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683640_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN657316_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774463_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683717_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683571_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774494_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683713_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683714_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT645065_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683663_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683635_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683659_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683658_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683632_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683661_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT645060_PreS1_P-RF-D      atggga-------ggttgatcttccaaacctcgacaaggcatgggga---
MN683684_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683654_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683642_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683630_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN657317_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683660_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU519422_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683672_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KP276254_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774432_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683626_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683637_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683643_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683644_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683647_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683649_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683590_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774497_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774434_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JX429898_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774472_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683651_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683653_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774430_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774468_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683638_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683621_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683617_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683636_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683669_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683586_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT645066_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683670_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774433_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT645049_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
DQ478897_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774423_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774471_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KY629632_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgtcaaggcatgggga---
MN683662_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774449_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AY862866_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AY862864_PreS1_P-RF-D      ----------------------------------------atgggga---
AY862865_PreS1_P-RF-D      atagga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774453_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AB270535_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KY670781_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KT991420_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KT991423_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ562278_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KT991417_PreS1_P-RF-D      atggga-------ggttggtcttccagacctcgacaaggcatgggga---
MT645067_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JX036332_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683579_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774461_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgtcaaggcatgggga---
KC774425_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgtcaaggcatgggga---
KC774428_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgtcaaggcatgggga---
KC774454_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU787435_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
DQ478898_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774492_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774452_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
DQ478886_PreS1_P-RF-D      atggga-------ggtcggtattcccaacctcgacaaggcatgggga---
KC774481_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683676_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774483_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JF491455_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU519423_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683674_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774484_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774498_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774442_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JF491451_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683639_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683611_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774475_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774439_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683610_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AY800249_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JF491449_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774470_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774458_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774474_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774447_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU787434_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AY817515_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774457_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774495_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774422_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774420_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774426_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683574_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KX660675_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683607_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683613_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683614_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683615_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683666_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774466_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KX660674_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KX660680_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683664_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683665_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683603_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN657315_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774488_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774493_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774476_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774435_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774455_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774443_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683619_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683605_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MN683650_PreS1_P-RF-D      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ562223_PreS1_P-RF-C      ----------------------------------------atggggc---
GQ377627_PreS1_P-RF-C      ----------------------------------------atggggc---
JN664935_PreS1_P-RF-D      ----------------------------------------atggggc---
EF103284_PreS1_P-RF-A      ----------------------------------------atggggc---
EF103282_PreS1_P-RF-A      ----------------------------------------atggggc---
EF103283_PreS1_P-RF-A      ----------------------------------------atggggc---
EU185780_PreS1_P-RF-A      ----------------------------------------atggggc---
KC012653_PreS1_P-RF-A      ----------------------------------------atggggc---
DQ464164_PreS1_P-RF-D      ----------------------------------------atggggc---
DQ464167_PreS1_P-RF-D      ----------------------------------------atggggc---
DQ464165_PreS1_P-RF-D      ----------------------------------------atggggc---
DQ464166_PreS1_P-RF-D      ----------------------------------------atggggc---
AF297619_PreS1_P-RF-D      ----------------------------------------atgggga---
AY236161_PreS1_P-RF-D      ----------------------------------------atggggc---
AF297620_PreS1_P-RF-D      ----------------------------attcgcaaaggcatggggc---
AB188243_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ349221_PreS1_P-RF-D      ----------------------------------------atggggc---
MK052957_PreS1_P-RF-D      ----------------------------------------atggggt---
MK052969_PreS1_P-RF-D      ----------------------------------------atggggc---
X68292_PreS1_P-RF-DA       ----------------------------------------atggggc---
MZ097806_PreS1_P-RF-D      ----------------------------------------atggggc---
KJ647349_PreS1_P-RF-D      ----------------------------------------atggggc---
KM386676_PreS1_P-RF-D      ----------------------------------------atggggc---
MW601264_PreS1_P-RF-D      ----------------------------------------atggggc---
MZ097745_PreS1_P-RF-D      ----------------------------------------atggggc---
KM577666_PreS1_P-RF-D      ----------------------------------------atggggc---
X65259_PreS1_P-RF-DA       ----------------------------------------atggggc---
KM359442_PreS1_P-RF-D      ----------------------------------------atggggc---
MK598656_PreS1_P-RF-D      ----------------------------------------atggggc---
MK598653_PreS1_P-RF-D      ----------------------------------------atggggc---
MK598652_PreS1_P-RF-D      ----------------------------------------atggggc---
MK598654_PreS1_P-RF-D      ----------------------------------------atggggc---
MW601296_PreS1_P-RF-D      ----------------------------------------atggggc---
JN688715_PreS1_P-RF-D      ----------------------------------------atggggc---
MW601310_PreS1_P-RF-D      ----------------------------------------atggggc---
MZ097777_PreS1_P-RF-D      ----------------------------------------atggggc---
MH464835_PreS1_P-RF-D      ----------------------------------------atggggcnnn
AJ627221_PreS1_P-RF-D      ----------------------------------------atggggc---
MW601227_PreS1_P-RF-D      ----------------------------------------atggggc---
MZ097716_PreS1_P-RF-D      ----------------------------------------atggggc---
AJ627217_PreS1_P-RF-D      ----------------------------------------atggggc---
MZ097766_PreS1_P-RF-D      ----------------------------------------atggggc---
MW601284_PreS1_P-RF-D      ----------------------------------------atggggc---
MZ097758_PreS1_P-RF-D      ----------------------------------------atggggc---
MW601241_PreS1_P-RF-D      ----------------------------------------atggggc---
MZ097724_PreS1_P-RF-D      ----------------------------------------atggggc---
MW601317_PreS1_P-RF-D      ----------------------------------------atggggc---
EU594435_PreS1_P-RF-D      ----------------------------------------atggggc---
MK618438_PreS1_P-RF-D      ----------------------------------------atggggc---
MK618440_PreS1_P-RF-D      ----------------------------------------atggggc---
MK618442_PreS1_P-RF-D      ----------------------------------------atggggc---
MN507850_PreS1_P-RF-D      ----------------------------------------atggggc---
MW601260_PreS1_P-RF-D      ----------------------------------------atggggc---
MZ097740_PreS1_P-RF-D      ----------------------------------------atggggc---
MK618444_PreS1_P-RF-D      ----------------------------------------atggggc---
MK618445_PreS1_P-RF-D      ----------------------------------------atggggc---
DQ111987_PreS1_P-RF-D      ----------------------------------------atggggc---
EU594436_PreS1_P-RF-D      ----------------------------------------atggggc---
MH724239_PreS1_P-RF-D      ----------------------------------------atggggc---
KX827302_PreS1_P-RF-D      ----------------------------------------atggggc---
MT426112_PreS1_P-RF-D      ----------------------------------------atggggc---
MH724243_PreS1_P-RF-D      ----------------------------------------atggggc---
AB270538_PreS1_P-RF-D      ----------------------------------------atggggc---
MG877711_PreS1_P-RF-D      ----------------------------------------atggggc---
JF440013_PreS1_P-RF-D      ----------------------------------------atggggc---
JF440011_PreS1_P-RF-D      ----------------------------------------atggggc---
JF440017_PreS1_P-RF-D      ----------------------------------------atgggga---
JF439999_PreS1_P-RF-D      ----------------------------------------atggggc---
JF440012_PreS1_P-RF-D      ----------------------------------------atggggc---
JF440010_PreS1_P-RF-D      ----------------------------------------atggggc---
JF440006_PreS1_P-RF-D      ----------------------------------------atggggc---
JF440001_PreS1_P-RF-D      ----------------------------------------atggggc---
JF440000_PreS1_P-RF-D      ----------------------------------------atggggc---
JF439994_PreS1_P-RF-D      ----------------------------------------atggggc---
JF440009_PreS1_P-RF-D      ----------------------------------------atggggc---
JF440007_PreS1_P-RF-D      ----------------------------------------atggggc---
JF439998_PreS1_P-RF-D      ----------------------------------------atggggc---
JF440004_PreS1_P-RF-D      ----------------------------------------atggggc---
JF440005_PreS1_P-RF-D      ----------------------------------------atggggc---
JF439996_PreS1_P-RF-D      ----------------------------------------atggggc---
JF440002_PreS1_P-RF-D      ----------------------------------------atggggc---
JF440003_PreS1_P-RF-D      ----------------------------------------atggggc---
JF440014_PreS1_P-RF-D      ----------------------------------------atggggc---
JF440015_PreS1_P-RF-D      ----------------------------------------atggggc---
JF439995_PreS1_P-RF-D      ----------------------------------------atggggc---
MK618439_PreS1_P-RF-D      ----------------------------------------atggggc---
KJ647351_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ349212_PreS1_P-RF-D      ----------------------------------------atggggc---
JN688689_PreS1_P-RF-D      ----------------------------------------atggggc---
KC774450_PreS1_P-RF-D      ----------------------------------------atgggaggtt
MZ097667_PreS1_P-RF-D      ----------------------------------------atggggc---
MT426113_PreS1_P-RF-D      ----------------------------------------atggggc---
KJ586811_PreS1_P-RF-D      ----------------------------------------atggggc---
AB210819_PreS1_P-RF-D      ----------------------------------------atggggc---
JX898690_PreS1_P-RF-D      ----------------------------------------atggggc---
JX898693_PreS1_P-RF-D      ----------------------------------------atggggc---
JX898695_PreS1_P-RF-D      ----------------------------------------atggggc---
JX898696_PreS1_P-RF-D      ----------------------------------------atggggc---
MT426110_PreS1_P-RF-D      ----------------------------------------atggggc---
JX898698_PreS1_P-RF-D      ----------------------------------------atggggc---
JX898699_PreS1_P-RF-D      ----------------------------------------atggggc---
MT426111_PreS1_P-RF-D      ----------------------------------------atggggc---
MF967563_PreS1_P-RF-D      ----------------------------------------atggggc---
U95551_PreS1_P-RF-DE       ----------------------------------------atggggc---
JX898686_PreS1_P-RF-D      ----------------------------------------atggggc---
JX898687_PreS1_P-RF-D      ----------------------------------------atggggc---
JX898688_PreS1_P-RF-D      ----------------------------------------atggggc---
AJ344117_PreS1_P-RF-D      ----------------------------------------atggggc---
MH724240_PreS1_P-RF-D      ----------------------------------------atggggc---
AB188245_PreS1_P-RF-D      ----------------------------------------atggggc---
JN664943_PreS1_P-RF-D      ----------------------------------------atggggc---
GU563560_PreS1_P-RF-D      ----------------------------------------atggggc---
MF488702_PreS1_P-RF-D      ----------------------------------------atggggc---
MW601235_PreS1_P-RF-D      ----------------------------------------atggggc---
MZ097721_PreS1_P-RF-D      ----------------------------------------atggggc---
KM577665_PreS1_P-RF-D      ----------------------------------------atggggc---
KM577667_PreS1_P-RF-D      ----------------------------------------atggggc---
KT366492_PreS1_P-RF-D      ----------------------------------------atggggc---
MH464851_PreS1_P-RF-D      ----------------------------------------atggggcnnn
KM524359_PreS1_P-RF-D      ----------------------------------------atggggc---
AY373430_PreS1_P-RF-D      ----------------------------------------atggggc---
AY233295_PreS1_P-RF-D      ----------------------------------------atggggc---
AY233293_PreS1_P-RF-D      ----------------------------------------atggggc---
KM577663_PreS1_P-RF-D      ----------------------------------------atggggc---
KM577664_PreS1_P-RF-D      ----------------------------------------atggggc---
EF103285_PreS1_P-RF-D      ----------------------------------------atggggc---
KT366504_PreS1_P-RF-D      ----------------------------------------atggggc---
AB583679_PreS1_P-RF-D      ----------------------------------------atggggc---
GQ183486_PreS1_P-RF-D      ----------------------------------------atggggc---
MH724222_PreS1_P-RF-D      ----------------------------------------atggggc---
MH464846_PreS1_P-RF-D      ----------------------------------------atggggcnnn
MH464850_PreS1_P-RF-D      ----------------------------------------atggggcnnn
MH464852_PreS1_P-RF-D      ----------------------------------------atggggcnnn
MT210033_PreS1_P-RF-D      ----------------------------------------atggggc---
KU668440_PreS1_P-RF-D      ----------------------------------------atggggc---
JN664929_PreS1_P-RF-D      ----------------------------------------atggggc---
MK541689_PreS1_P-RF-D      ----------------------------------------atggggc---
JN664934_PreS1_P-RF-D      ----------------------------------------atggggc---
MF488699_PreS1_P-RF-D      ----------------------------------------atggggc---
AB033558_PreS1_P-RF-D      ----------------------------------------atggggc---
GQ205379_PreS1_P-RF-D      ----------------------------------------atggggc---
KT366505_PreS1_P-RF-D      ----------------------------------------atggggc---
MK516279_PreS1_P-RF-D      ----------------------------------------atggggc---
MK516280_PreS1_P-RF-D      ----------------------------------------atggggc---
JN664925_PreS1_P-RF-D      ----------------------------------------atggggc---
JN664933_PreS1_P-RF-D      ----------------------------------------atggggc---
JN664915_PreS1_P-RF-D      ----------------------------------------atggggc---
KC875339_PreS1_P-RF-D      ----------------------------------------atggggc---
KC875338_PreS1_P-RF-D      ----------------------------------------atggggc---
GQ205387_PreS1_P-RF-D      ----------------------------------------atggggc---
GQ205378_PreS1_P-RF-D      ----------------------------------------atggggc---
GQ205386_PreS1_P-RF-D      ----------------------------------------atggggc---
GQ205377_PreS1_P-RF-D      ----------------------------------------atggggc---
DQ315779_PreS1_P-RF-D      ----------------------------------------atggggc---
JN664940_PreS1_P-RF-D      ----------------------------------------atggggc---
KX357641_PreS1_P-RF-D      ----------------------------------------atggggc---
FN594770_PreS1_P-RF-D      ----------------------------------------atggggc---
KF779353_PreS1_P-RF-D      atggga-------ggttggtcatcaaaagcatctacaagcatgggga---
HQ700492_PreS1_P-RF-D      ----------------------------------------atggggc---
KF170740_PreS1_P-RF-D      ----------------------------------------atggggc---
HQ700494_PreS1_P-RF-D      ----------------------------------------atggggc---
J02202_PreS1_P-RF-DE       ----------------------------------------atggggc---
HQ700579_PreS1_P-RF-D      ----------------------------------------atggggc---
HQ700585_PreS1_P-RF-D      ----------------------------------------atggggc---
AB048702_PreS1_P-RF-D      ----------------------------------------atggggc---
AB048703_PreS1_P-RF-D      ----------------------------------------atggggc---
MH481860_PreS1_P-RF-D      ----------------------------------------atggggc---
MH481859_PreS1_P-RF-D      ----------------------------------------atggggc---
MH481862_PreS1_P-RF-D      ----------------------------------------atggggc---
MH481858_PreS1_P-RF-D      ----------------------------------------atggggc---
MH481861_PreS1_P-RF-D      ----------------------------------------atggggc---
HQ700536_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ692536_PreS1_P-RF-D      ----------------------------------------atggggc---
HQ700493_PreS1_P-RF-D      ----------------------------------------atggggc---
HQ700535_PreS1_P-RF-D      ----------------------------------------atggggc---
HQ700534_PreS1_P-RF-D      ----------------------------------------atggggc---
HQ700541_PreS1_P-RF-D      ----------------------------------------atggggc---
HQ700540_PreS1_P-RF-D      ----------------------------------------atggggc---
HQ700539_PreS1_P-RF-D      ----------------------------------------atggggc---
HQ700538_PreS1_P-RF-D      ----------------------------------------atggggc---
HQ700537_PreS1_P-RF-D      ----------------------------------------atggggc---
HQ700533_PreS1_P-RF-D      ----------------------------------------atggggc---
HQ700500_PreS1_P-RF-D      ----------------------------------------atggggc---
HQ700524_PreS1_P-RF-D      ----------------------------------------atggggc---
HQ700525_PreS1_P-RF-D      ----------------------------------------atggggc---
AB033559_PreS1_P-RF-D      ----------------------------------------atggggc---
HQ700582_PreS1_P-RF-D      ----------------------------------------atggggc---
HQ700503_PreS1_P-RF-D      ----------------------------------------atggggc---
HQ700497_PreS1_P-RF-D      ----------------------------------------atggggc---
HQ700581_PreS1_P-RF-D      ----------------------------------------atggggc---
HQ700583_PreS1_P-RF-D      ----------------------------------------atggggc---
HQ700501_PreS1_P-RF-D      ----------------------------------------atggggc---
HQ700584_PreS1_P-RF-D      ----------------------------------------atggggc---
KJ470898_PreS1_P-RF-D      ----------------------------------------atggggc---
MF618346_PreS1_P-RF-D      ----------------------------------------atggggc---
KF192840_PreS1_P-RF-D      ----------------------------------------atggggc---
KF192835_PreS1_P-RF-D      ----------------------------------------atggggc---
KF192833_PreS1_P-RF-D      ----------------------------------------atggggc---
KF192836_PreS1_P-RF-D      ----------------------------------------atggggc---
KF192837_PreS1_P-RF-D      ----------------------------------------atggggc---
KF192838_PreS1_P-RF-D      ----------------------------------------atggggc---
KF192839_PreS1_P-RF-D      ----------------------------------------atggggc---
KF192841_PreS1_P-RF-D      ----------------------------------------atggggc---
MF618347_PreS1_P-RF-D      ----------------------------------------atggggc---
KJ470897_PreS1_P-RF-D      ----------------------------------------atggggc---
KJ470891_PreS1_P-RF-D      ----------------------------------------atggggc---
KJ470884_PreS1_P-RF-D      ----------------------------------------atggggc---
KJ470886_PreS1_P-RF-D      ----------------------------------------atggggc---
KJ470888_PreS1_P-RF-D      ----------------------------------------atggggc---
KJ470890_PreS1_P-RF-D      ----------------------------------------atggggc---
KJ470887_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ904397_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ904437_PreS1_P-RF-D      ----------------------------------------atggggc---
KP168421_PreS1_P-RF-D      ----------------------------------------atggggc---
KU736916_PreS1_P-RF-D      ----------------------------------------atggggc---
KP168420_PreS1_P-RF-D      ----------------------------------------atggggc---
MT426114_PreS1_P-RF-D      ----------------------------------------atggggc---
KU736915_PreS1_P-RF-D      ----------------------------------------atggggc---
KU736914_PreS1_P-RF-D      ----------------------------------------atggggc---
KU736917_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ904436_PreS1_P-RF-D      ----------------------------------------atggggc---
FN594769_PreS1_P-RF-D      ----------------------------------------atggggc---
FN594771_PreS1_P-RF-D      ----------------------------------------atggggc---
GQ161754_PreS1_P-RF-D      ----------------------------------------atggggc---
DQ991753_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ349207_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ904425_PreS1_P-RF-D      ----------------------------------------atggggc---
MH685719_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ904416_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ904417_PreS1_P-RF-D      ----------------------------------------atggggc---
KM606741_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ904430_PreS1_P-RF-D      ----------------------------------------atggggc---
AM494716_PreS1_P-RF-D      ----------------------------------------atggggc---
KX357631_PreS1_P-RF-D      ----------------------------------------atggggc---
KP288875_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ904405_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ904401_PreS1_P-RF-D      ----------------------------------------atggggc---
KX357627_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ904442_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ904414_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ904441_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ904396_PreS1_P-RF-D      ----------------------------------------atggggc---
KX357624_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ904440_PreS1_P-RF-D      ----------------------------------------atggggc---
GU177079_PreS1_P-RF-D      atggga-------ggttggttaccaaaacctcgcaaaggcatgggga---
KX827299_PreS1_P-RF-D      ----------------------------------------atggagc---
FJ904400_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ904398_PreS1_P-RF-D      ----------------------------------------atggggc---
MT591274_PreS1_P-RF-D      ----------------------------------------atggggc---
MT591275_PreS1_P-RF-D      ----------------------------------------atggggc---
KU711666_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ904404_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ904403_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ904444_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ904394_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ904406_PreS1_P-RF-D      ----------------------------------------atggggc---
KP995112_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ904407_PreS1_P-RF-D      ----------------------------------------atggggc---
KX357628_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ904447_PreS1_P-RF-D      ----------------------------------------atggggc---
KM606750_PreS1_P-RF-D      ----------------------------------------atggggc---
KM606751_PreS1_P-RF-D      ----------------------------------------atggggc---
KX357636_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ904408_PreS1_P-RF-D      ----------------------------------------atggggc---
FJ904409_PreS1_P-RF-D      ----------------------------------------atggggc---
MT591280_PreS1_P-RF-D      ----------------------------------------atggggc---
KX357629_PreS1_P-RF-D      ----------------------------------------atggggc---
KX357626_PreS1_P-RF-D      ----------------------------------------atggggc---
KU736923_PreS1_P-RF-D      ----------------------------------------atggggc---
KX357634_PreS1_P-RF-D      ----------------------------------------atggggc---
KP168416_PreS1_P-RF-D      ----------------------------------------atggggc---
KP168417_PreS1_P-RF-D      ----------------------------------------atggggc---
KU736921_PreS1_P-RF-D      ----------------------------------------atggggc---
KP168418_PreS1_P-RF-D      ----------------------------------------atggggc---
KU736922_PreS1_P-RF-D      ----------------------------------------atggggc---
KX357625_PreS1_P-RF-D      ----------------------------------------atggggc---
KX357630_PreS1_P-RF-D      ----------------------------------------atggggc---
KX357635_PreS1_P-RF-D      ----------------------------------------atggggc---
KX357623_PreS1_P-RF-D      ----------------------------------------atggggc---
KX357633_PreS1_P-RF-D      ----------------------------------------atggggc---
JX036357_PreS1_P-RF-D      ----------------------------------------atggggc---
KJ647356_PreS1_P-RF-D      ----------------------------------------atggggc---
JN257154_PreS1_P-RF-D      ----------------------------------------atggggc---
AY341335_PreS1_P-RF-D      ----------------------------------------atggggc---
AB330368_PreS1_P-RF-D      ----------------------------------------atggggc---
JN257191_PreS1_P-RF-D      ----------------------------------------atggggc---
JN040803_PreS1_P-RF-D      ----------------------------------------atggggc---
MZ097814_PreS1_P-RF-D      ----------------------------------------atggggc---
JN642160_PreS1_P-RF-D      ----------------------------------------atggggc---
JN257189_PreS1_P-RF-D      ----------------------------------------atggggc---
KJ803771_PreS1_P-RF-D      ----------------------------------------atggggc---
JN257204_PreS1_P-RF-D      ----------------------------------------atggggc---
JF754613_PreS1_P-RF-D      ----------------------------------------atggggc---
MF925396_PreS1_P-RF-D      ----------------------------------------atggggc---
JN040798_PreS1_P-RF-D      ----------------------------------------atggggc---
JF754616_PreS1_P-RF-D      ----------------------------------------atggggc---
MZ097822_PreS1_P-RF-D      ----------------------------------------atggggc---
MF925397_PreS1_P-RF-D      ----------------------------------------atggggc---
AB674432_PreS1_P-RF-D      ----------------------------------------atggggc---
AB674436_PreS1_P-RF-D      ----------------------------------------atggggc---
MF925371_PreS1_P-RF-D      ----------------------------------------atggggc---
MF925360_PreS1_P-RF-D      ----------------------------------------atggggc---
JN664946_PreS1_P-RF-D      ----------------------------------------atggggc---
JN688717_PreS1_P-RF-D      ----------------------------------------atggggc---
MN507835_PreS1_P-RF-D      ----------------------------------------atggggc---
MF925401_PreS1_P-RF-D      ----------------------------------------atggggc---
KM524357_PreS1_P-RF-D      ----------------------------------------atggggc---
KR905422_PreS1_P-RF-D      ----------------------------------------atggggc---
KT366503_PreS1_P-RF-D      ----------------------------------------atggggc---
MF925388_PreS1_P-RF-D      ----------------------------------------atggggc---
MF925392_PreS1_P-RF-D      ----------------------------------------atggggc---
X80925_PreS1_P-RF-DE       ----------------------------------------atggggc---
EU594406_PreS1_P-RF-D      ----------------------------------------atggggc---
JQ687532_PreS1_P-RF-D      ----------------------------------------atggggc---
MZ097850_PreS1_P-RF-D      ----------------------------------------atggggc---
MZ097826_PreS1_P-RF-D      ----------------------------------------atggggc---
MZ097680_PreS1_P-RF-D      ----------------------------------------atggggc---
JN642137_PreS1_P-RF-D      ----------------------------------------atggggc---
MZ097652_PreS1_P-RF-D      ----------------------------------------atggggc---
MZ097703_PreS1_P-RF-D      ----------------------------------------atggggc---
JN257216_PreS1_P-RF-D      ----------------------------------------atggggc---
JN257206_PreS1_P-RF-D      ----------------------------------------atggggc---
MZ097838_PreS1_P-RF-D      ----------------------------------------atggggc---
MZ097687_PreS1_P-RF-D      ----------------------------------------atggggc---
MF925384_PreS1_P-RF-D      ----------------------------------------atggggc---
KF471643_PreS1_P-RF-D      ----------------------------------------atggggc---
JN642127_PreS1_P-RF-D      ----------------------------------------atggggc---
AB674433_PreS1_P-RF-D      ----------------------------------------atggggc---
JN642139_PreS1_P-RF-D      ----------------------------------------atggggc---
JN642141_PreS1_P-RF-D      ----------------------------------------atggggc---
JN642152_PreS1_P-RF-D      ----------------------------------------atggggc---
JN257174_PreS1_P-RF-D      ----------------------------------------atggggc---
MW601230_PreS1_P-RF-D      ----------------------------------------atggggc---
MZ097719_PreS1_P-RF-D      ----------------------------------------atggggc---
JN257164_PreS1_P-RF-D      ----------------------------------------atggggc---
JN257210_PreS1_P-RF-D      ----------------------------------------atggggc---
EF494378_PreS1_P-RF-C      atggga-------ggttattcctcaaaacctcgaaaaggcatgggga---
JQ801476_PreS1_P-RF-C      atgggg-------ctttcttggacggtccctctcgagtg---gggaa---
AB241109_PreS1_P-RF-C      atggga-------ggttattcttccaaacctcgaaaaggcatgggga---
HQ700519_PreS1_P-RF-C      atggga-------ggttggtcctccaaacctcggaaaggcatgggga---
HQ700521_PreS1_P-RF-C      atggga-------ggttggtcctccaaacctcggaaaggcatgggga---
JX504540_PreS1_P-RF-C      atggga-------ggtcggacttccaaacctcgacaaggcatgggga---
HQ700520_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggcaaggcatgggga---
JF436919_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MG826147_PreS1_P-RF-C      atggga-------ggcccgtcttccaaacctcgacaaggcatgggga---
MG826141_PreS1_P-RF-C      atggga-------ggcccgtcttccaaacctcgacaaggcatgggga---
MG826142_PreS1_P-RF-C      atggga-------ggcccgtcttccaaacctcgacaaggcatgggga---
JF436923_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MF925382_PreS1_P-RF-C      atggga-------ggttggtcttcaaaacctcgacaaggcatgggga---
AB031265_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KJ803798_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
FR714496_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
MK534615_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534706_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MK534632_PreS1_P-RF-C      atggga-------ggttattctgcaaaacctcgcaaaggcatgggga---
MK534725_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534724_PreS1_P-RF-C      atggga-------ggttggtcttcgaaacctcgaaaaggcatgggga---
MK534717_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534613_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534735_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534665_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534713_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KJ803785_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534679_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MZ439673_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534574_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MF925381_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JQ027310_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534560_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
GQ924618_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MF925370_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT645015_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KJ410506_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534682_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
HQ700518_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
HQ700530_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
HQ700523_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
HQ700531_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
HQ700532_PreS1_P-RF-C      at----------------------caaacctcggaaaggcatgggga---
AP011102_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
AB493842_PreS1_P-RF-C      atggga-------ggttggtcttcaaaacctcggaaaggcatgggga---
AB105172_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
AP011103_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
AB493840_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
AB493838_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
AB493847_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
GQ358155_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
AB493837_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
GQ358156_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
HQ700527_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
HQ700528_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534719_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KT003704_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggcacggaatgggga---
KP148352_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
AP011104_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgcaaaggcatgggga---
AP011105_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgcaaaggcatgggga---
LC416040_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgcaaaggcatgggga---
AB033557_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
AY206374_PreS1_P-RF-C      atggga-------ggttggtctgccaaacctcggaaaggcatgggga---
GQ377560_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KC774198_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774201_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774193_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774323_PreS1_P-RF-C      atggga-------ggttggtcttcaaaacctcgacaaggcatgggga---
KC774291_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774307_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JQ040146_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ032337_PreS1_P-RF-C      atggga-------ggcccgtcttccaaacctcgacgaggcatgggga---
GU357843_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JQ040175_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT645029_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacacggcatgggga---
FJ386633_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ386646_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU717211_PreS1_P-RF-C      atggga-------ggttggtcatccaaacctcgaaaaggcatgggga---
EU589337_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ032343_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774324_PreS1_P-RF-C      atggga-------ggtccgtcttccaaacctcgacgaggcatgggga---
HQ700547_PreS1_P-RF-C      atggga-------ggttggtcttccaaaccacgaaaaggcatgggga---
AB367393_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ715345_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ715346_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ715347_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AF411409_PreS1_P-RF-C      atggga-------ggttggtcgtccaaacctcgacacggcatgggga---
MW887644_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KJ173279_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KJ173350_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ562302_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
GU385774_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JX661498_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426459_PreS1_P-RF-C      -------------------------aatcctcgacaaggcatgcgga---
MT426514_PreS1_P-RF-C      ----------------------atcaaacctcgacaaggcatgggga---
MT426530_PreS1_P-RF-C      atggga-------ggttggtcttgcaaacctcgacaaggcatgggga---
MT426466_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426532_PreS1_P-RF-C      atgcga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426522_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426543_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426533_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426523_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426502_PreS1_P-RF-C      ----------------------accaaacctcgacaaggcatgggga---
MT426499_PreS1_P-RF-C      ----------------------accaaacctcgacaaggcatgggga---
MT426508_PreS1_P-RF-C      ----------------------atcaaacctcgacaaggcatgggga---
MT426512_PreS1_P-RF-C      ----------------------accaaacctcgacaaggcatgggga---
MT426503_PreS1_P-RF-C      ----------------------accaaacctcgacaaggcatgggga---
MT426509_PreS1_P-RF-C      ----------------------accaaacctcgacaaggcatgggga---
MT426500_PreS1_P-RF-C      ----------------------accaaacctcgacaaggcatgggga---
MT426505_PreS1_P-RF-C      ----------------------accaaacctcgacaaggcatgggga---
MT426506_PreS1_P-RF-C      ----------------------accaaacctcgacaaggcatgggga---
MT426511_PreS1_P-RF-C      ----------------------accaaacctcgacaaggcatgggga---
MT426513_PreS1_P-RF-C      ----------------------accaaacctcgacaaggcatgggga---
MT426538_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426539_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426540_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426535_PreS1_P-RF-C      atggga-------ggttgatcttccaaacctcgacaaggcatgggga---
MT426471_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426479_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426469_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426462_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426457_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426559_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426546_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426544_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426534_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426465_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426464_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426515_PreS1_P-RF-C      at----------------------caaacctcgacaaggcatgggga---
MT426562_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426556_PreS1_P-RF-C      atggga-------ggttggtctcccaaacctcgacaaggcatgggga---
MT426549_PreS1_P-RF-C      atggga-------ggttggacttccaaacctcgacaaggcatgggga---
MT426525_PreS1_P-RF-C      atggga-------ggttggtctttcaaacctcgacaaggcatgggga---
MT426481_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426480_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426470_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426467_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426460_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426504_PreS1_P-RF-C      at----------------------caaacctcgacaaggcatgggga---
MT426564_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426560_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426557_PreS1_P-RF-C      atggga-------ggttgctcttccaaacctcgacaaggcatgggga---
MT426555_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426541_PreS1_P-RF-C      atggga-------ggttggtcttgcaaacctcgacaaggcatgggga---
MT426526_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426507_PreS1_P-RF-C      a----------------------ccaaacctcgacaaggcatgggga---
MT426501_PreS1_P-RF-C      a----------------------ccaaacctcgacaaggcatgggga---
MT426536_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426524_PreS1_P-RF-C      atggga-------ggttgctcttccaaacctcgacaaggcatgggga---
MT426492_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426558_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426575_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426488_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426486_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426483_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426563_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426547_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426487_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426496_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426572_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426554_PreS1_P-RF-C      atgcga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426491_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426489_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426485_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426482_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426478_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426473_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426463_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426461_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426456_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426455_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426519_PreS1_P-RF-C      at----------------------caaacctcgacaaggcatgggga---
MT426518_PreS1_P-RF-C      at----------------------caaacctcgacaaggcatgggga---
MT426517_PreS1_P-RF-C      at----------------------caaacctcgacaaggcatgggga---
MT426573_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426569_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426565_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426553_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426545_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426542_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426537_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426531_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426527_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426472_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426520_PreS1_P-RF-C      ----------------------atcaaacctcgacaaggcatgggga---
MT426550_PreS1_P-RF-C      atggga-------ggttggtcttccaaatctcgacaaggcatgggga---
MT426576_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426574_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426571_PreS1_P-RF-C      atggga-------cgttggtcttccaaacctcgacaaggcatgggga---
MT426570_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426568_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426567_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426566_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426561_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426551_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426529_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426528_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT426521_PreS1_P-RF-C      ----------------------atcaaacctcgacaaggcatgggga---
MT426468_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426475_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426476_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426477_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426484_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426490_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426493_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426494_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426495_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426497_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426498_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MT426510_PreS1_P-RF-C      ----------------------accaaacctcgacaaggcatgggga---
EU871995_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU871990_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU871988_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU871999_PreS1_P-RF-C      atagga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU871996_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU871987_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU871984_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU871985_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU871981_PreS1_P-RF-C      atagga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU871983_PreS1_P-RF-C      atagga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU871986_PreS1_P-RF-C      atagga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU871989_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU871992_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU871993_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU871991_PreS1_P-RF-C      atagga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU871994_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JF436922_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KR013816_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ386593_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
GQ377548_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
GQ377633_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AB670303_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU964351_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KJ173329_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ562227_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EF494376_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
EU939589_PreS1_P-RF-C      atggga-------ggtcggtattccaaacctcgacaaggcatgggga---
MG826149_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KR013806_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU939551_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
KJ173358_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AF461361_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
GQ377581_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
GQ377534_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
KJ173325_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KJ173326_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU939565_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
GQ377520_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ787446_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ787480_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KJ173299_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KJ173300_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774328_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
GQ377516_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KM875422_PreS1_P-RF-C      at----------------------caaacctcgacaaggcatgggga---
AB198084_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
M38454_PreS1_P-RF-CB       atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU963883_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ386649_PreS1_P-RF-C      atggga-------ggtcggtcttccaaacctcgacaaggcatgggga---
FJ386578_PreS1_P-RF-C      atggga-------ggtcggtcttccaaacctcgacaaggcatgggga---
FJ386585_PreS1_P-RF-C      atggga-------ggtcggtcttccaaacctcgacaaggcatgggga---
MK321265_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK720627_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK720628_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774230_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
GQ377544_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
LC279263_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
LC279264_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
LC279265_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
LC279266_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
LC279267_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MG893561_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774317_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774322_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JX026887_PreS1_P-RF-C      atggga-------ggttggtcgtccaaacctcgacaaggcatgggga---
FJ562287_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU963993_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU963990_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU963991_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU963994_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU963995_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU963998_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU963999_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU964001_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU964003_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ386581_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AY123424_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU871997_PreS1_P-RF-C      atggga-------ggtcggtcttccaaacctcgacaaggcatgggga---
KY881840_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774183_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774186_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
LC458432_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JX429896_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774294_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KY470893_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AP011108_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KX096713_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
X75656_PreS1_P-RF-CB       atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KU695742_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
HQ700580_PreS1_P-RF-C      a----------------------------ctcggaaaggcatgggga---
HQ700498_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
HQ700499_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
HQ700554_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
KU695745_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
HQ700560_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
HQ700557_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
HQ700462_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
HQ700485_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
HQ700542_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
HQ700509_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
HQ700515_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
HQ700507_PreS1_P-RF-C      atggga-------ggtaggtcttccaaacctcgaaaaggcatgggga---
HQ700508_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
KU695746_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggca---
KU695744_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
HQ700505_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
KU695741_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
KU695743_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
KJ598675_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MG826146_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
FJ562294_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MG826144_PreS1_P-RF-C      atggga-------ggttggtcttcaaaacctcggaaaggcatgggga---
HQ700526_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
FJ562317_PreS1_P-RF-C      atggga-------ggtccggcttccaaacctcgacgaggcatgggga---
MW887645_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgccaaggcatgggga---
AB367800_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
GQ475335_PreS1_P-RF-C      atggga-------ggttggtcttcaaaacctcgacaaggcatgggga---
MT645039_PreS1_P-RF-C      atggga-------ggttggtcgtccaaacctcgacgaggcatgggga---
JX036329_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcacgggga---
JX036328_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcacgggga---
GQ377522_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgtcaaggcatgggga---
KC774344_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
Y18857_PreS1_P-RF-CB       atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
AB195950_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AB195951_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ562226_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
KC774188_PreS1_P-RF-C      atggga-------ggttggtcatccaaacctcgacgaggcatgggga---
JX661485_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AB300369_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KR013843_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ562267_PreS1_P-RF-C      atggga-------ggttgggcctccaaacctcgacaaggcatgggga---
MT645071_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JQ040148_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU939547_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
EU939668_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
AB049609_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JQ040142_PreS1_P-RF-C      atggga-------ggttggtcttccaaaccccgacaaggcatgggga---
JX661486_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MG893554_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MG893555_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JQ732168_PreS1_P-RF-C      atggga-------ggttggtcgtccaaacctcgacaaggcatgggga---
AB367419_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AB205152_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KJ173320_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KJ173322_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ386586_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT645069_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KY363263_PreS1_P-RF-C      atggga-------ggttcgtcttccaaacctcgacaaggcatgggga---
MT645048_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU939577_PreS1_P-RF-C      -------------------------aaacctcgacaaggcatgggga---
MK534585_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcggaaaggcatgggga---
JF828936_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JF828935_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JF828938_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JF828933_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JF828934_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU919167_PreS1_P-RF-C      a----------------------ccaaacctcgacaaggcatgggga---
KC774212_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU939606_PreS1_P-RF-C      a----------------------ccaaacctcgacaaggcatgggga---
FJ386635_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JN400086_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AB642096_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
DQ089798_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AB367400_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774305_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AY247030_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774234_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU916232_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU964306_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU964316_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU964005_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU964006_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU964007_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU964008_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU964009_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU964010_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU964303_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU964304_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU964305_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU964307_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU964308_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU964309_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU964310_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU964311_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU964312_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU964314_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU964315_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU964317_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU964313_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ562305_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
AY040627_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AF233236_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774222_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JX661494_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JX661487_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MG893559_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ562314_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MT645035_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
GQ377607_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AB195940_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AB195941_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AF330110_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AY167095_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AB195956_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AB195957_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AB195939_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
AB195955_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774246_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774258_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
HM750133_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU787444_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KJ173349_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU916239_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU916241_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU916240_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
GQ377611_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU963862_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU963868_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU963869_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU963856_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU963857_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU963858_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU963860_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU963861_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU963863_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU963864_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU963865_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU963866_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU963867_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU963870_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KU963859_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
Y18856_PreS1_P-RF-CB       atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ715387_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ715385_PreS1_P-RF-C      atgggg-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ715384_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ715411_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ715412_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ715413_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
FJ715414_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KM213033_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774349_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774332_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774263_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774341_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KF053186_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KJ803778_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KF053179_PreS1_P-RF-B      atggga-------ggttggtcctccaaacctcgtcaaggcatgggga---
KJ803772_PreS1_P-RF-B      atggga-------ggttggtcctccaaacctcgtcaaggcatgggga---
KJ717794_PreS1_P-RF-C      atggga-------ggttggtcctccaaacctcgtcaaggcatgggga---
KJ803788_PreS1_P-RF-C      atggga-------ggttggtcctccaaacctcgtcaaggcatgggga---
EU882006_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU939629_PreS1_P-RF-B      atggga-------ggtcggtattccaaacctcgacaaggcatgggga---
EU939631_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
HQ684849_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JQ412091_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
KC774178_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774364_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
GQ377635_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
GQ377630_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KP148337_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KJ717800_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
KJ803791_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
FJ386674_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
KC315400_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
KF053188_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
KJ803782_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
KJ717814_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
KJ803802_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
KJ717832_PreS1_P-RF-C      atggga-------ggtccgtcttccaaacctcgaaaaggcatgggga---
KJ803804_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KJ717815_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
KJ803803_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
KJ717816_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
GQ377590_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
EU939620_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
HQ684848_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
EU939630_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
FJ562247_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
FJ562328_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgagaaggcatgggga---
EU939623_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
GQ377604_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
GQ377626_PreS1_P-RF-C      atggga-------ggttggtcttacaaacctcgaaaaggcatgggat---
GQ377573_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
GQ377613_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
GQ377592_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
GQ377634_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
EU939621_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
GQ377564_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
JQ040174_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
GQ377549_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
GQ377596_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
GQ377614_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
KF053160_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
KJ803753_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
FJ562229_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
EU522070_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgcaaaggcatgggga---
GQ377539_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
EU881995_PreS1_P-RF-C      atggga-------ggcccgtcttccaaacctcgaaaaggcatgggga---
EU919166_PreS1_P-RF-C      atggga-------ggtcggacttccaaacctcgaaaaggcatgggga---
GQ377556_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
GQ377565_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MG826148_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
GQ377594_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
GQ377602_PreS1_P-RF-C      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
KC793112_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MG826150_PreS1_P-RF-B      atggga-------ggcccgtcttccaaacctcgacaaggcatgggga---
MG826151_PreS1_P-RF-B      atggga-------ggcccgtcttccaaacctcgacaaggcatgggga---
MK534730_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534701_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534714_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534722_PreS1_P-RF-B      atgggc-------ggttggtcttccaaaccgcgacaaggcatgggga---
MK534686_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534653_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534681_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534721_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534630_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534641_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534695_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534716_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534637_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534620_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MK534635_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534668_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534723_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MT645045_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MK534587_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534734_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
GQ377595_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MK534660_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534598_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534646_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534664_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534670_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK052976_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MK534582_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534594_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
EU660227_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534589_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MH094410_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MK534609_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
JQ801477_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MK052967_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MK052968_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MK052970_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MK534558_PreS1_P-RF-B      atggga-------cgttggtcttccaaacctcgaaaaggcatgggga---
MK534728_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534655_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534606_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534555_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MK534610_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534688_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MK534672_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534662_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534569_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MK534729_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534590_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534617_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534618_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534623_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534687_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MK534689_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534690_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534562_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534584_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534654_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534675_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534559_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MK534712_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534616_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534718_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534726_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534607_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KJ410497_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
EU939627_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MT645056_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MK534700_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534684_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
KC774414_PreS1_P-RF-B      atggga-------ggttggtcctccaaacctcgaaaaggcatgggga---
MK534566_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MK534648_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MK534736_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MK534715_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534633_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MK534556_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MK534651_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MK534579_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MK534731_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534567_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534563_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MK534564_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MK534568_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgaaaaggcatgggga---
MK534580_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534583_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534685_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534577_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534561_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534625_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
MK534639_PreS1_P-RF-B      atggga-------ggttggtcttccaaacctcgacaaggcatgggga---
                                                                             

KJ586810_PreS1_P-RF-A      ------------------------------agaatctctctgtacccaat
HE981179_PreS1_P-RF-F      ------------------------------agaatctctctgtgcccaat
KJ586803_PreS1_P-RF-A      ---------------------------------------------ccaat
FJ361772_PreS1_P-RF-G      ------------------------------cgaatctttctgttcccaat
MG826145_PreS1_P-RF-B      ------------------------------cgaatctttctgttcccaat
MH746813_PreS1_P-RF-B      ------------------------------cgaatctttctgttcccaat
MH746811_PreS1_P-RF-B      ------------------------------cgaatctttctgttcccaat
MH746812_PreS1_P-RF-B      ------------------------------cgaatctttctgttcccaat
EU835240_PreS1_P-RF-G      ------------------------------cgaatctttctgtacccaat
FJ023666_PreS1_P-RF-G      ------------------------------cgaatctttcggtacccaat
EU833891_PreS1_P-RF-G      ------------------------------cgaatctttctgtacccaat
FJ882610_PreS1_P-RF-G      ------------------------------cgaatctttctgtacccaat
FJ882614_PreS1_P-RF-G      ------------------------------cgaatctttctgtacccaat
FJ882611_PreS1_P-RF-G      ------------------------------cgaatctttctgtacccaat
FJ023665_PreS1_P-RF-G      ------------------------------cgaatctttctgtacccaat
FJ023670_PreS1_P-RF-G      ------------------------------cgaatctttctgtacccaat
FJ023664_PreS1_P-RF-G      ------------------------------cgaatctttctgtacccaat
FJ023668_PreS1_P-RF-G      ------------------------------cgaatctttctgtacccaat
FJ023673_PreS1_P-RF-G      ------------------------------cgaatctttctgtacccaat
FJ023667_PreS1_P-RF-G      ------------------------------cgaatctttctgtacccaat
FJ882617_PreS1_P-RF-G      ------------------------------cgaatctttctgtacccaat
FJ882612_PreS1_P-RF-G      ------------------------------cgaatctttctgtacccaat
FJ882618_PreS1_P-RF-G      ------------------------------cgaatctttctgtacccaat
FJ882613_PreS1_P-RF-G      ------------------------------cgaatctttctgtacccaat
MK534663_PreS1_P-RF-C      ------------------------------cgaacctttctgttcccaat
MH368022_PreS1_P-RF-G      ------------------------------cgaatctttctgttcccaat
MZ439798_PreS1_P-RF-G      ------------------------------cgaatctttctgttcccaat
FJ023659_PreS1_P-RF-B      ------------------------------cgaatctttctgttcccaat
FJ023662_PreS1_P-RF-G      ------------------------------cgaatctttctgttcccaat
MK534669_PreS1_P-RF-C      ------------------------------cgaatctttcggttcccaat
FR714490_PreS1_P-RF-G      ------------------------------cgaatctttctgttcccaat
KC172106_PreS1_P-RF-G      ------------------------------cgaatctttctgttcccaat
KY470996_PreS1_P-RF-G      ------------------------------caaatctttctgttcccaat
KY471004_PreS1_P-RF-G      ------------------------------caaatctttctgttcccaat
KY471007_PreS1_P-RF-G      ------------------------------cgaatctttctgtccccaat
KY470999_PreS1_P-RF-G      ------------------------------cgaatctttctgttcccaat
KY471000_PreS1_P-RF-G      ------------------------------cgaatctttctgttcccaat
KY471002_PreS1_P-RF-G      ------------------------------cgaatctttctgttcccaat
KY470998_PreS1_P-RF-G      ------------------------------cgaatctttctgttcccaat
KY471001_PreS1_P-RF-G      ------------------------------cgaatctttctgttcccaat
KY471003_PreS1_P-RF-G      ------------------------------cgaatctttctgttcccaat
KY471006_PreS1_P-RF-G      ------------------------------cgaatctttctgttcccaat
KY470997_PreS1_P-RF-G      ------------------------------cgaatctttctgttcccaat
KY471005_PreS1_P-RF-G      ------------------------------cgaatctttctgttcccaat
KP148441_PreS1_P-RF-G      ------------------------------cgaatctttctgttcccagt
KP148449_PreS1_P-RF-G      ------------------------------cgaatctttctgttcccaat
KP148442_PreS1_P-RF-B      ------------------------------cgaatctttctgttcccaat
KP148450_PreS1_P-RF-G      ------------------------------cgaatctttctggtcccaat
KP148447_PreS1_P-RF-G      ------------------------------cgaatctttctgttcccaat
KP148586_PreS1_P-RF-G      ------------------------------cgaatctttctgttcccaat
AB194949_PreS1_P-RF-A      ------------------------------caaatctttctgttcccaat
GQ161753_PreS1_P-RF-A      ------------------------------cgaatctttctgttcccaac
GQ161767_PreS1_P-RF-A      ------------------------------cgaatctatctgttcccaac
HF571060_PreS1_P-RF-A      ------------------------------cgaatctatctgttcccaac
GQ161837_PreS1_P-RF-A      ------------------------------cgaatctatctgttcccaat
GQ161838_PreS1_P-RF-A      ------------------------------cgaatctatctgttcccaat
JQ707426_PreS1_P-RF-G      ------------------------------cgaatctttctgttcccaac
KP274926_PreS1_P-RF-G      ------------------------------cgaatctttctgttcccaat
JF440021_PreS1_P-RF-A      ------------------------------cgaatctttctgttcccaac
JF439776_PreS1_P-RF-A      ------------------------------cgaatctttctgttcccaac
JF440019_PreS1_P-RF-A      ------------------------------cgaatctttctgttcccaac
JF440022_PreS1_P-RF-A      ------------------------------cgaatctttctgttcccaac
MF925386_PreS1_P-RF-A      ------------------------------cgaatctttctgttcccaac
AB933283_PreS1_P-RF-A      ------------------------------cgaatctttctgttcccaac
AB453985_PreS1_P-RF-A      ------------------------------cgaatctttctgttcccaac
AB222708_PreS1_P-RF-A      ------------------------------cgaatctttctgttcccaac
AB933282_PreS1_P-RF-A      ------------------------------cgaatctttctgttcccaac
GQ331048_PreS1_P-RF-A      ------------------------------cgaatctttctgttcccaac
KF214656_PreS1_P-RF-A      ------------------------------cgaacctttctgttcccaac
HM146131_PreS1_P-RF-A      ------------------------------cgaatctttctgttcccaac
AY233277_PreS1_P-RF-A      ------------------------------cgaatctttctgttcccaac
AY161145_PreS1_P-RF-A      ------------------------------cgaacctttctgttcccaac
AY161146_PreS1_P-RF-A      ------------------------------cgaacctttctgttcccaac
AY161140_PreS1_P-RF-A      ------------------------------cgaacctttctgttcccaac
AY161141_PreS1_P-RF-A      ------------------------------cgaacctttctgttcccaac
MF488705_PreS1_P-RF-A      ------------------------------cgaacctatctgttcccaac
MF925404_PreS1_P-RF-A      ------------------------------cgaacctttctgttcccaac
MT426089_PreS1_P-RF-A      ------------------------------cgaacctttctgttcccaac
KX765835_PreS1_P-RF-G      ------------------------------cgaacctttccgtccccaat
EU833890_PreS1_P-RF-G      ------------------------------agaacctttccaccagcaat
AB933279_PreS1_P-RF-A      ------------------------------agaacctttccaccagcaat
AB933280_PreS1_P-RF-A      ------------------------------agaacctttccaccagcaat
AB933281_PreS1_P-RF-A      ------------------------------agaacctttccaccagcaat
EF464099_PreS1_P-RF-A      ------------------------------agaacctttccaccagcaat
JQ272887_PreS1_P-RF-G      ------------------------------agaacctttccaccagcaat
KF219922_PreS1_P-RF-G      ------------------------------agaacctttccaccagcaat
HE981180_PreS1_P-RF-G      ------------------------------agaacctttccaccagcaat
JQ272886_PreS1_P-RF-G      ------------------------------agaacctttccaccagcaat
KJ803822_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
FN594767_PreS1_P-RF-D      ------------------------------agaatcattccaccaccaat
GQ161806_PreS1_P-RF-E      ------------------------------agaatcattccaccaccaat
KU679954_PreS1_P-RF-C      ------------------------------cgaatctttctgttccaaat
KU679942_PreS1_P-RF-C      ------------------------------cgaatctttctgttccaaat
KU679943_PreS1_P-RF-B      ------------------------------cgaatctttctgttccaaat
KF873527_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU679956_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU679958_PreS1_P-RF-C      ------------------------------cgaatctttctgtgcccaat
KF873522_PreS1_P-RF-C      ------------------------------cgaatctttctgtgcccaat
KU679941_PreS1_P-RF-C      ------------------------------cgaatctttctgtgcccaat
KF873523_PreS1_P-RF-C      ------------------------------cgaatctttctgtgcccaat
KF873524_PreS1_P-RF-C      ------------------------------cgaatctttctgtgcccaat
KF873521_PreS1_P-RF-B      ------------------------------cgaatctttctgttcccaat
KU679955_PreS1_P-RF-C      ------------------------------cgaatctttckgttcccaat
KU679950_PreS1_P-RF-C      ------------------------------cgaatctttctgttccaaat
KF873511_PreS1_P-RF-C      ------------------------------cgaatctttctgttccaaat
KF873513_PreS1_P-RF-C      ------------------------------cgaatctttctgttccaaat
KF873515_PreS1_P-RF-C      ------------------------------cgaatctttctgttccaaat
KU679948_PreS1_P-RF-C      ------------------------------cgaatctttctgttccaaat
KU679944_PreS1_P-RF-B      ------------------------------cgaatctttctgttccaaat
KF873519_PreS1_P-RF-C      ------------------------------cgaatctttctgttccaaat
KU679953_PreS1_P-RF-B      ------------------------------cgaatctttctgttccaaat
KU679946_PreS1_P-RF-B      ------------------------------cgaatctttctgttccaaat
KF873517_PreS1_P-RF-B      ------------------------------cgaatctttctgttccaaat
KF873518_PreS1_P-RF-C      ------------------------------cgaatctttctgttccaaat
KF873530_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU679952_PreS1_P-RF-C      ------------------------------cgaatctttckgttcccaat
KF873537_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU679945_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KF873538_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KF873542_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KF873543_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KF873540_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KF873531_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KF873532_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KF873533_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KF873534_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KF873535_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU679939_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU679940_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MF925402_PreS1_P-RF-B      ------------------------------agaatctttccaccagcaat
KF053166_PreS1_P-RF-B      ------------------------------cgaacctttctgttcccaat
KJ803827_PreS1_P-RF-B      ------------------------------cgaacctttctgttcccaat
MF925389_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
JX036330_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
AB674504_PreS1_P-RF-D      ------------------------------cgaacctttctgttcccaat
JX036359_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
JX036358_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KX660685_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683641_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KY470853_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683675_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KY470844_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KY470856_PreS1_P-RF-D      ------------------------------cgaatctttccgttcccaat
KY470843_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KY470846_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KY470847_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KY470849_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KY470850_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KY470855_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KY470854_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN650068_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MT645070_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683620_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
DQ478890_PreS1_P-RF-D      ------------------------------cgaatctttctgttctcaat
MN650069_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
AY057948_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683716_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KT991427_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
FJ562263_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KT991424_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774490_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683712_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683721_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KX660686_PreS1_P-RF-D      ------------------------------cgaatctgtctgttcccaat
MN683707_PreS1_P-RF-D      ------------------------------cgaatctgtctgttcccaat
MN683588_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683580_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683678_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683628_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KP276256_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683725_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683722_PreS1_P-RF-D      ------------------------------cgaatctctcggttcccaat
KX660684_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683706_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683687_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683688_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN650076_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
HM750145_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683671_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683673_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683677_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683692_PreS1_P-RF-D      ------------------------------cgaatctgtctgttcccaat
MN683627_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683699_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
HM750149_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
HM750144_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN650083_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN650082_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN650080_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN650081_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN650084_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683718_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683715_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774485_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
AY817511_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683720_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683700_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683587_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683696_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683719_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN650085_PreS1_P-RF-D      ------------------------------cgaatctctctgttcccaat
KX660689_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683711_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KX354997_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KP276253_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774456_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
HM750150_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
HM750147_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
HM750146_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
HM750143_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN650087_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN650079_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
FJ349241_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683691_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683695_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683690_PreS1_P-RF-D      ------------------------------cgaatctgtctgttcccaat
MN683686_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683693_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683724_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683689_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683694_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
HM750142_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683703_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
HM750148_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774482_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN650078_PreS1_P-RF-D      ------------------------------cgaatctctctgttcccaat
MN650074_PreS1_P-RF-D      ------------------------------cgaatctctctgttcccaat
MN683680_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683697_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683685_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN650075_PreS1_P-RF-D      ------------------------------cgaatctctctgttcccaat
MN683584_PreS1_P-RF-D      ------------------------------cgaatctctctgttcccaat
MN683679_PreS1_P-RF-D      ------------------------------cgaatctctctgttcccaat
MN683723_PreS1_P-RF-D      ------------------------------cgaatctctctgttcccaat
MN650072_PreS1_P-RF-D      ------------------------------cgaatctctctgttcccaat
MN650077_PreS1_P-RF-D      ------------------------------cgaatctctctgttcccaat
MN650086_PreS1_P-RF-D      ------------------------------cgaatctctctgttcccaat
MN650073_PreS1_P-RF-D      ------------------------------cgaatctctctgttcccaat
MN683581_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683618_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683730_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683622_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683623_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683624_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683655_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683582_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774431_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683634_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774479_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
AY817513_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MT645062_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KT991419_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774478_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774480_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KF917451_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MT645063_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KT991421_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774448_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KX660677_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683668_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774486_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774499_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683612_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683616_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683625_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683609_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774487_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683656_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683657_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683597_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683652_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683596_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
AY817512_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
AY817510_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
DQ478887_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774424_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
DQ478892_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774489_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
JF491456_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
JF491448_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
AY817509_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683645_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683592_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683594_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683572_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KP276255_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
DQ478889_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683683_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683640_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN657316_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774463_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683717_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683571_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774494_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683713_PreS1_P-RF-D      ------------------------------cgaatctgtctgttcccaat
MN683714_PreS1_P-RF-D      ------------------------------cgaatctgtctgttcccaat
MT645065_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683663_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683635_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683659_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683658_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683632_PreS1_P-RF-D      ------------------------------cgaatctgtccgttcccaat
MN683661_PreS1_P-RF-D      ------------------------------cgaatctgtctgttcccaat
MT645060_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683684_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683654_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683642_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683630_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN657317_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683660_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KU519422_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683672_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KP276254_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774432_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683626_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683637_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683643_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683644_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683647_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683649_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683590_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774497_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774434_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
JX429898_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774472_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683651_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683653_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774430_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774468_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683638_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683621_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683617_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683636_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683669_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683586_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MT645066_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683670_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774433_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MT645049_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
DQ478897_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774423_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774471_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KY629632_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683662_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774449_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
AY862866_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
AY862864_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
AY862865_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774453_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
AB270535_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KY670781_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KT991420_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KT991423_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
FJ562278_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KT991417_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MT645067_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
JX036332_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683579_PreS1_P-RF-D      ------------------------------cgaatctttctgttccaaat
KC774461_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774425_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774428_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774454_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
EU787435_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
DQ478898_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774492_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774452_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
DQ478886_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774481_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683676_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774483_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
JF491455_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KU519423_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683674_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774484_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774498_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774442_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
JF491451_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683639_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683611_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774475_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774439_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683610_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
AY800249_PreS1_P-RF-D      ------------------------------cgaatctttctgtacccaat
JF491449_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774470_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774458_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774474_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774447_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
EU787434_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
AY817515_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774457_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774495_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774422_PreS1_P-RF-D      ------------------------------cgaatctttctgtacccaat
KC774420_PreS1_P-RF-D      ------------------------------cgaatctttctgtacccaat
KC774426_PreS1_P-RF-D      ------------------------------cgaatctttctgtacccaat
MN683574_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KX660675_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683607_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683613_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683614_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683615_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683666_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774466_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KX660674_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KX660680_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683664_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683665_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683603_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN657315_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774488_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774493_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774476_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774435_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774455_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
KC774443_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683619_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683605_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
MN683650_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaat
FJ562223_PreS1_P-RF-C      ------------------------------agaatctttccaccagcaat
GQ377627_PreS1_P-RF-C      ------------------------------agaatctttccaccagcaat
JN664935_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
EF103284_PreS1_P-RF-A      ------------------------------agaatctgtccaccagcaat
EF103282_PreS1_P-RF-A      ------------------------------agaatctttccaccagcaat
EF103283_PreS1_P-RF-A      ------------------------------agaatctttccaccagcaat
EU185780_PreS1_P-RF-A      ------------------------------agaatctttccaccagcaat
KC012653_PreS1_P-RF-A      ------------------------------agaatctttccaccagcaat
DQ464164_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
DQ464167_PreS1_P-RF-D      ------------------------------agaatctttcacccagcaat
DQ464165_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
DQ464166_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
AF297619_PreS1_P-RF-D      ------------------------------cgaatctttcaccaggcaat
AY236161_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
AF297620_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
AB188243_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FJ349221_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MK052957_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MK052969_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
X68292_PreS1_P-RF-DA       ------------------------------agaatctatccaccagcaat
MZ097806_PreS1_P-RF-D      ------------------------------agaatctctccaccagcaat
KJ647349_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KM386676_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MW601264_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MZ097745_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KM577666_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
X65259_PreS1_P-RF-DA       ------------------------------agaatctttccaccagcaat
KM359442_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MK598656_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MK598653_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MK598652_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MK598654_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MW601296_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN688715_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MW601310_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MZ097777_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MH464835_PreS1_P-RF-D      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnagaatctttccaccagcaat
AJ627221_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MW601227_PreS1_P-RF-D      ------------------------------agaatctctccaccagcaat
MZ097716_PreS1_P-RF-D      ------------------------------agaatctctccaccagcaat
AJ627217_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MZ097766_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MW601284_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MZ097758_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MW601241_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MZ097724_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MW601317_PreS1_P-RF-D      ------------------------------agaatctctccaccagcaat
EU594435_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MK618438_PreS1_P-RF-D      ------------------------------agaatctctccaccagcaat
MK618440_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MK618442_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MN507850_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MW601260_PreS1_P-RF-D      ------------------------------agaatctgtccaccagcaat
MZ097740_PreS1_P-RF-D      ------------------------------agaatctgtccaccagcaat
MK618444_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MK618445_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
DQ111987_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
EU594436_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MH724239_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KX827302_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MT426112_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MH724243_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
AB270538_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MG877711_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JF440013_PreS1_P-RF-D      ------------------------------agaatcttcccaccagcaat
JF440011_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JF440017_PreS1_P-RF-D      ------------------------------cgaatctttctgttcccaac
JF439999_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JF440012_PreS1_P-RF-D      ------------------------------ggaatctttccaccagcaat
JF440010_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JF440006_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JF440001_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JF440000_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JF439994_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JF440009_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JF440007_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JF439998_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JF440004_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JF440005_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JF439996_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JF440002_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JF440003_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JF440014_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JF440015_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JF439995_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MK618439_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaac
KJ647351_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FJ349212_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN688689_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KC774450_PreS1_P-RF-D      ggtcttccaaacctcgtcaaggcatggggacgaatctttccaccagcaat
MZ097667_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MT426113_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KJ586811_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
AB210819_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JX898690_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JX898693_PreS1_P-RF-D      ------------------------------agaatctttctaccagcaat
JX898695_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JX898696_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MT426110_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JX898698_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JX898699_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MT426111_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MF967563_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
U95551_PreS1_P-RF-DE       ------------------------------agaatctttccaccagcaat
JX898686_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JX898687_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JX898688_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
AJ344117_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MH724240_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
AB188245_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN664943_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
GU563560_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MF488702_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MW601235_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MZ097721_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KM577665_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KM577667_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KT366492_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MH464851_PreS1_P-RF-D      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnagaatctttccaccagcaat
KM524359_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
AY373430_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
AY233295_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
AY233293_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KM577663_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KM577664_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
EF103285_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KT366504_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
AB583679_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
GQ183486_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MH724222_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MH464846_PreS1_P-RF-D      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnagaatctttccaccagcaat
MH464850_PreS1_P-RF-D      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnagaatctttccaccagcaat
MH464852_PreS1_P-RF-D      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnagaatctttccaccagcaat
MT210033_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KU668440_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN664929_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MK541689_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN664934_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MF488699_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
AB033558_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
GQ205379_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KT366505_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MK516279_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MK516280_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN664925_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN664933_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN664915_PreS1_P-RF-D      ------------------------------agaacctttccaccagcaat
KC875339_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KC875338_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
GQ205387_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
GQ205378_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
GQ205386_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
GQ205377_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
DQ315779_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN664940_PreS1_P-RF-D      ------------------------------agaatctttctaccagcaat
KX357641_PreS1_P-RF-D      tttcttggacggtccccctcgaatgggggaaaaatcattccaccagcaat
FN594770_PreS1_P-RF-D      tttcttggacggtccctctcgaatgggggaagaatcattccaccagcaat
KF779353_PreS1_P-RF-D      ------------------------------cgaatctttctgctcccaat
HQ700492_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KF170740_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
HQ700494_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
J02202_PreS1_P-RF-DE       ------------------------------agaatctttccaccagcaat
HQ700579_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
HQ700585_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
AB048702_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
AB048703_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MH481860_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MH481859_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MH481862_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MH481858_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MH481861_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
HQ700536_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FJ692536_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
HQ700493_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
HQ700535_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
HQ700534_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
HQ700541_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
HQ700540_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
HQ700539_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
HQ700538_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
HQ700537_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
HQ700533_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
HQ700500_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
HQ700524_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
HQ700525_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
AB033559_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
HQ700582_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
HQ700503_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
HQ700497_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
HQ700581_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
HQ700583_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
HQ700501_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
HQ700584_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KJ470898_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MF618346_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KF192840_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KF192835_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KF192833_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KF192836_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KF192837_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KF192838_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KF192839_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KF192841_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MF618347_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KJ470897_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KJ470891_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KJ470884_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KJ470886_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KJ470888_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KJ470890_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KJ470887_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FJ904397_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FJ904437_PreS1_P-RF-D      ------------------------------agaatctttgcaccagcaat
KP168421_PreS1_P-RF-D      tttcttggacggtccctctcgaatgggggaagaatcatgccaccagcaat
KU736916_PreS1_P-RF-D      tttcttggacggtccctctcgaatgggggaagaatcattccaccaccaat
KP168420_PreS1_P-RF-D      tttcttggacggtccctctcaaatgggggaagaatcattccaccagcaat
MT426114_PreS1_P-RF-D      tttcttggacggtccctctcgaatgggggaagaatcattccaccagcaat
KU736915_PreS1_P-RF-D      tttcttggacggtccccctcgaatgggggaagaatcattccaccagcaat
KU736914_PreS1_P-RF-D      tttcttggacggtccccctcgaatgggggaagaatcattccaccagcaat
KU736917_PreS1_P-RF-D      tttcttggacggtccccctcgaatgggggaagaatcattccaccagcaat
FJ904436_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FN594769_PreS1_P-RF-D      tttcttggacggtccctctcgaatgggggaagaatcattccaccagcaat
FN594771_PreS1_P-RF-D      tttcttggacggtccctctcgaatgggggaagaatcattccaccagcaat
GQ161754_PreS1_P-RF-D      tttcttggacggtccctctcgaatgggggaagaatcattccaccagcaat
DQ991753_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FJ349207_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FJ904425_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MH685719_PreS1_P-RF-D      tttcttggacggtccctctcgaatgggggaagaatcattccaccagcaat
FJ904416_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FJ904417_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KM606741_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FJ904430_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
AM494716_PreS1_P-RF-D      ------------------------------agaatctctccaccagcaat
KX357631_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KP288875_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FJ904405_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaac
FJ904401_PreS1_P-RF-D      ag------------------aacatggagaagaatctttccaccagcaat
KX357627_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FJ904442_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FJ904414_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FJ904441_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FJ904396_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KX357624_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FJ904440_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
GU177079_PreS1_P-RF-D      ------------------------------caaatctttctgttcccaat
KX827299_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FJ904400_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FJ904398_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MT591274_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MT591275_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KU711666_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FJ904404_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FJ904403_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FJ904444_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FJ904394_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FJ904406_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KP995112_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FJ904407_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KX357628_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FJ904447_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KM606750_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KM606751_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KX357636_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FJ904408_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
FJ904409_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MT591280_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KX357629_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KX357626_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KU736923_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KX357634_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KP168416_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KP168417_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KU736921_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KP168418_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KU736922_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KX357625_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KX357630_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KX357635_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KX357623_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KX357633_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JX036357_PreS1_P-RF-D      ------------------------------agaatctttccaccagcagt
KJ647356_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN257154_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
AY341335_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
AB330368_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN257191_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN040803_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MZ097814_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN642160_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN257189_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KJ803771_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN257204_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JF754613_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MF925396_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN040798_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JF754616_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MZ097822_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MF925397_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
AB674432_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
AB674436_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MF925371_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MF925360_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN664946_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN688717_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MN507835_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MF925401_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KM524357_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KR905422_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KT366503_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MF925388_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MF925392_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
X80925_PreS1_P-RF-DE       ------------------------------agaatctttccaccagcaat
EU594406_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JQ687532_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MZ097850_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MZ097826_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MZ097680_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN642137_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MZ097652_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MZ097703_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN257216_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN257206_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MZ097838_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MZ097687_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MF925384_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
KF471643_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN642127_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
AB674433_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN642139_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN642141_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN642152_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN257174_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MW601230_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
MZ097719_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN257164_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
JN257210_PreS1_P-RF-D      ------------------------------agaatctttccaccagcaat
EF494378_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
JQ801476_PreS1_P-RF-C      ------------------------------agaacctttccaccagcaat
AB241109_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
HQ700519_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
HQ700521_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
JX504540_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
HQ700520_PreS1_P-RF-C      ------------------------------cgaatctgtctgttcccaat
JF436919_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MG826147_PreS1_P-RF-C      ------------------------------cgaacctttctgttcccaat
MG826141_PreS1_P-RF-C      ------------------------------cgaacctttctgttcccaat
MG826142_PreS1_P-RF-C      ------------------------------cgaacctttctgttcccaat
JF436923_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MF925382_PreS1_P-RF-C      ------------------------------cgaacctttccgttcccaat
AB031265_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KJ803798_PreS1_P-RF-C      ------------------------------cgaatctttctgtccccaat
FR714496_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MK534615_PreS1_P-RF-B      ------------------------------cgaacctttctgttcccaat
MK534706_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
MK534632_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MK534725_PreS1_P-RF-C      ------------------------------cgaacctttctgttcccaat
MK534724_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
MK534717_PreS1_P-RF-C      ------------------------------cgaacctttctgttcccaat
MK534613_PreS1_P-RF-C      ------------------------------cgaacctttcagttcccaat
MK534735_PreS1_P-RF-C      ------------------------------cgaacctttcagttcccaat
MK534665_PreS1_P-RF-C      ------------------------------cgaacctttctgttcccaat
MK534713_PreS1_P-RF-C      ------------------------------cgaacctttctgttcccaat
KJ803785_PreS1_P-RF-C      ------------------------------cgaacctttccgttcccaat
MK534679_PreS1_P-RF-C      ------------------------------caaatctctctgtccccaat
MZ439673_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MK534574_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MF925381_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
JQ027310_PreS1_P-RF-C      ------------------------------cgaacctttctgttcccaat
MK534560_PreS1_P-RF-C      ------------------------------cgaacctttctgtacccaat
GQ924618_PreS1_P-RF-C      ------------------------------cgaacctttctgttcccaat
MF925370_PreS1_P-RF-C      ------------------------------cgaacctttctgttcccaat
MT645015_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KJ410506_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MK534682_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
HQ700518_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
HQ700530_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
HQ700523_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
HQ700531_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
HQ700532_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
AP011102_PreS1_P-RF-C      ------------------------------cgaatctgtctgttcccaat
AB493842_PreS1_P-RF-C      ------------------------------cgaatctgtctgttcccaat
AB105172_PreS1_P-RF-C      ------------------------------cgaatctgtctgttcccaat
AP011103_PreS1_P-RF-C      ------------------------------cgaatctgtctgttcccaat
AB493840_PreS1_P-RF-C      ------------------------------cgaatctgtctgttcccaat
AB493838_PreS1_P-RF-C      ------------------------------cgaatctgtctgttcccaat
AB493847_PreS1_P-RF-C      ------------------------------cgaatctgtctgttcccaat
GQ358155_PreS1_P-RF-C      ------------------------------cgaatctgtctgtccccaat
AB493837_PreS1_P-RF-C      ------------------------------cgaatctgtctgttcccaat
GQ358156_PreS1_P-RF-C      ------------------------------cgaatctgtctgttcccaat
HQ700527_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
HQ700528_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MK534719_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KT003704_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KP148352_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
AP011104_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
AP011105_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
LC416040_PreS1_P-RF-C      ------------------------------cgaatctgtctgttcccaat
AB033557_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
AY206374_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
GQ377560_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KC774198_PreS1_P-RF-C      ------------------------------caaatctttccgttcccaat
KC774201_PreS1_P-RF-C      ------------------------------caaatctttccgttcccaat
KC774193_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KC774323_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KC774291_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KC774307_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
JQ040146_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
FJ032337_PreS1_P-RF-C      ------------------------------caaatcttgctgttcccaat
GU357843_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
JQ040175_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT645029_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
FJ386633_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
FJ386646_PreS1_P-RF-C      ------------------------------caaatctttccgttcccaat
EU717211_PreS1_P-RF-C      ------------------------------cgaatctttcggttcccaat
EU589337_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
FJ032343_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
KC774324_PreS1_P-RF-C      ------------------------------caaatcttgctgttcccaat
HQ700547_PreS1_P-RF-C      ------------------------------cgaatctttctgttccaaat
AB367393_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
FJ715345_PreS1_P-RF-C      ------------------------------caaatctatctgttcccaat
FJ715346_PreS1_P-RF-C      ------------------------------caaatctatctgttcccaat
FJ715347_PreS1_P-RF-C      ------------------------------caaatctatctgttcccaat
AF411409_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MW887644_PreS1_P-RF-C      ------------------------------caaatctttccgttcccaat
KJ173279_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KJ173350_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
FJ562302_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
GU385774_PreS1_P-RF-C      ------------------------------cgaatctttcggttcccaat
JX661498_PreS1_P-RF-C      ------------------------------cgaatctttccgttcccaat
MT426459_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426514_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426530_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426466_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426532_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MT426522_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MT426543_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MT426533_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426523_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426502_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426499_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426508_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426512_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426503_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426509_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426500_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426505_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426506_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426511_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426513_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426538_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426539_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426540_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426535_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426471_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426479_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426469_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426462_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426457_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426559_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426546_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426544_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426534_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MT426465_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426464_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426515_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426562_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426556_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426549_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426525_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426481_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426480_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426470_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426467_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426460_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426504_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426564_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426560_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426557_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426555_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426541_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MT426526_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426507_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426501_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426536_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426524_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426492_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426558_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MT426575_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426488_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426486_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426483_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426563_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426547_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426487_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426496_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426572_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426554_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426491_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426489_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426485_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426482_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426478_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426473_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426463_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426461_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426456_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426455_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426519_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426518_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426517_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426573_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426569_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426565_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426553_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426545_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426542_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426537_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426531_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426527_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426472_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426520_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426550_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426576_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426574_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426571_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426570_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426568_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426567_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426566_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426561_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426551_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426529_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426528_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426521_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426468_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426475_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426476_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426477_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426484_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426490_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426493_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426494_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426495_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426497_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426498_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MT426510_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
EU871995_PreS1_P-RF-C      ------------------------------cgaatctttctgttccaaat
EU871990_PreS1_P-RF-C      ------------------------------cgaatctttctgtcccaaat
EU871988_PreS1_P-RF-C      ------------------------------cgaatctttctgtcccaaat
EU871999_PreS1_P-RF-C      ------------------------------cgaatctttctgttccaaat
EU871996_PreS1_P-RF-C      ------------------------------cgaatctttctgttccaaat
EU871987_PreS1_P-RF-C      ------------------------------cgaatctttctgtcccaaat
EU871984_PreS1_P-RF-C      ------------------------------cgaatctttctgttccaaat
EU871985_PreS1_P-RF-C      ------------------------------cgaatctttctgttccaaat
EU871981_PreS1_P-RF-C      ------------------------------cgaatctttctgttccaaat
EU871983_PreS1_P-RF-C      ------------------------------cgaatctttctgttccaaat
EU871986_PreS1_P-RF-C      ------------------------------cgaatctttctgttccaaat
EU871989_PreS1_P-RF-C      ------------------------------cgaatctttctgttccaaat
EU871992_PreS1_P-RF-C      ------------------------------cgaatctttctgttccaaat
EU871993_PreS1_P-RF-C      ------------------------------cgaatctttctgttccaaat
EU871991_PreS1_P-RF-C      ------------------------------cgaatctttctgttccaaat
EU871994_PreS1_P-RF-C      ------------------------------cgaatctttctgtcccaaat
JF436922_PreS1_P-RF-C      ------------------------------caaatctttccgttcccaat
KR013816_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
FJ386593_PreS1_P-RF-C      ------------------------------caaatctttctgtgcccaat
GQ377548_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
GQ377633_PreS1_P-RF-C      ------------------------------cgaatctttcggttcccaat
AB670303_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
KU964351_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
KJ173329_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
FJ562227_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
EF494376_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
EU939589_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MG826149_PreS1_P-RF-C      ------------------------------caaatctttctgttccaaat
KR013806_PreS1_P-RF-C      ------------------------------caaatctatctgttcccaat
EU939551_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KJ173358_PreS1_P-RF-C      ------------------------------cgaatctttctgttccaaat
AF461361_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
GQ377581_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
GQ377534_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
KJ173325_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
KJ173326_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
EU939565_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
GQ377520_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
FJ787446_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
FJ787480_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
KJ173299_PreS1_P-RF-C      ------------------------------caaatctatctgttcccaat
KJ173300_PreS1_P-RF-C      ------------------------------caaatctatctgttcccaat
KC774328_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
GQ377516_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
KM875422_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
AB198084_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
M38454_PreS1_P-RF-CB       ------------------------------cgaatctttctgttcccaat
KU963883_PreS1_P-RF-C      ------------------------------caaatctgtctgttcccaat
FJ386649_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
FJ386578_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
FJ386585_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MK321265_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MK720627_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MK720628_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
KC774230_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
GQ377544_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
LC279263_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
LC279264_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
LC279265_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
LC279266_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
LC279267_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MG893561_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
KC774317_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
KC774322_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
JX026887_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
FJ562287_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU963993_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
KU963990_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
KU963991_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
KU963994_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
KU963995_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
KU963998_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
KU963999_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
KU964001_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
KU964003_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
FJ386581_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
AY123424_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
EU871997_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KY881840_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KC774183_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
KC774186_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
LC458432_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
JX429896_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KC774294_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
KY470893_PreS1_P-RF-C      ------------------------------caaatctttcggttcccaat
AP011108_PreS1_P-RF-C      ------------------------------cgaatctgtctgttcccaat
KX096713_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
X75656_PreS1_P-RF-CB       ------------------------------cgaatctttctgttcccaat
KU695742_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
HQ700580_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
HQ700498_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
HQ700499_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
HQ700554_PreS1_P-RF-C      ------------------------------cgaatctttcagttcccaat
KU695745_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
HQ700560_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
HQ700557_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
HQ700462_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
HQ700485_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
HQ700542_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
HQ700509_PreS1_P-RF-C      ------------------------------cgaatctttctgtacccaat
HQ700515_PreS1_P-RF-C      ------------------------------cgaatctttcggtacccaat
HQ700507_PreS1_P-RF-C      ------------------------------cgaatctttctgtacccaat
HQ700508_PreS1_P-RF-C      ------------------------------cgaatctttctgtacccaat
KU695746_PreS1_P-RF-C      ------------------------------cgaatctttctgtacccaat
KU695744_PreS1_P-RF-C      ------------------------------cgaatctttctgtacccaat
HQ700505_PreS1_P-RF-C      ------------------------------cgaatctttctgtacccaat
KU695741_PreS1_P-RF-C      ------------------------------cgaatctttctgtacccaat
KU695743_PreS1_P-RF-C      ------------------------------cgaatctttctgtacccaat
KJ598675_PreS1_P-RF-C      ------------------------------cgaatctctctgttccaaat
MG826146_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
FJ562294_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
MG826144_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
HQ700526_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
FJ562317_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MW887645_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
AB367800_PreS1_P-RF-C      ------------------------------cgaatctttcggttcccaat
GQ475335_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MT645039_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
JX036329_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
JX036328_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
GQ377522_PreS1_P-RF-C      ------------------------------cgaatctttctgttcctaat
KC774344_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
Y18857_PreS1_P-RF-CB       ------------------------------cgaatctttctgttcccaat
AB195950_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
AB195951_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
FJ562226_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KC774188_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
JX661485_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
AB300369_PreS1_P-RF-C      ------------------------------cgaacctttctgttcccaat
KR013843_PreS1_P-RF-C      ------------------------------cgaatctttcggttcccaat
FJ562267_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MT645071_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
JQ040148_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
EU939547_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
EU939668_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
AB049609_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
JQ040142_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
JX661486_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MG893554_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MG893555_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
JQ732168_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
AB367419_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
AB205152_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KJ173320_PreS1_P-RF-C      ------------------------------cgaatctatctgttcccaat
KJ173322_PreS1_P-RF-C      ------------------------------cgaatctatctgttcccaat
FJ386586_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MT645069_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KY363263_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MT645048_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
EU939577_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MK534585_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
JF828936_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
JF828935_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
JF828938_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
JF828933_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
JF828934_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
EU919167_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KC774212_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
EU939606_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaac
FJ386635_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaac
JN400086_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
AB642096_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
DQ089798_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
AB367400_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KC774305_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
AY247030_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KC774234_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
EU916232_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU964306_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccatt
KU964316_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU964005_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU964006_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU964007_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU964008_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU964009_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU964010_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU964303_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU964304_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU964305_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU964307_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU964308_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU964309_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU964310_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU964311_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU964312_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU964314_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU964315_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU964317_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU964313_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
FJ562305_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
AY040627_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
AF233236_PreS1_P-RF-C      ------------------------------caaatctttctgttcccaat
KC774222_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
JX661494_PreS1_P-RF-C      ------------------------------caaatctttctgttccaaat
JX661487_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MG893559_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
FJ562314_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
MT645035_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
GQ377607_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
AB195940_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
AB195941_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
AF330110_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
AY167095_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
AB195956_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
AB195957_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
AB195939_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
AB195955_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KC774246_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KC774258_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
HM750133_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
EU787444_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KJ173349_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
EU916239_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
EU916241_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
EU916240_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
GQ377611_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU963862_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU963868_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU963869_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU963856_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU963857_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU963858_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU963860_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU963861_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU963863_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU963864_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU963865_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU963866_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU963867_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU963870_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KU963859_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
Y18856_PreS1_P-RF-CB       ------------------------------cgaatctttctgttcccaat
FJ715387_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
FJ715385_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
FJ715384_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
FJ715411_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
FJ715412_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
FJ715413_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
FJ715414_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KM213033_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KC774349_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KC774332_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KC774263_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KC774341_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KF053186_PreS1_P-RF-B      ------------------------------cgaatctttctgttcccaat
KJ803778_PreS1_P-RF-B      ------------------------------cgaatctttctgttcccaat
KF053179_PreS1_P-RF-B      ------------------------------caaatctttccgtccccaat
KJ803772_PreS1_P-RF-B      ------------------------------caaatctttccgtccccaat
KJ717794_PreS1_P-RF-C      ------------------------------caaatctttccgtccccaat
KJ803788_PreS1_P-RF-C      ------------------------------caaatctttccgtccccaat
EU882006_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
EU939629_PreS1_P-RF-B      ------------------------------cgaatctttctgttcccaat
EU939631_PreS1_P-RF-B      ------------------------------cgaatctttctgttcccaat
HQ684849_PreS1_P-RF-B      ------------------------------caaatctttctgttcccaat
JQ412091_PreS1_P-RF-B      ------------------------------cgaatctctctgttcccaat
KC774178_PreS1_P-RF-B      ------------------------------caaatctttctgttcccaat
KC774364_PreS1_P-RF-B      ------------------------------caaatctttctgttcccaat
GQ377635_PreS1_P-RF-B      ------------------------------cgaatctttctgttcccaat
GQ377630_PreS1_P-RF-B      ------------------------------cgaatctttctgttcccaat
KP148337_PreS1_P-RF-B      ------------------------------cgaatctttctgttcccaat
KJ717800_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
KJ803791_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
FJ386674_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
KC315400_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
KF053188_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
KJ803782_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
KJ717814_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
KJ803802_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
KJ717832_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KJ803804_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
KJ717815_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
KJ803803_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
KJ717816_PreS1_P-RF-C      ------------------------------cgaatctttctgttcccaat
GQ377590_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
EU939620_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
HQ684848_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
EU939630_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
FJ562247_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
FJ562328_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
EU939623_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
GQ377604_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
GQ377626_PreS1_P-RF-C      ------------------------------caaatctttctgtcccaaat
GQ377573_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
GQ377613_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
GQ377592_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
GQ377634_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
EU939621_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
GQ377564_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
JQ040174_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
GQ377549_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
GQ377596_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
GQ377614_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
KF053160_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
KJ803753_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
FJ562229_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
EU522070_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
GQ377539_PreS1_P-RF-C      ------------------------------cgaatctttctgtccccaat
EU881995_PreS1_P-RF-C      ------------------------------caaatcttgctgtccccaat
EU919166_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
GQ377556_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
GQ377565_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
MG826148_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
GQ377594_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
GQ377602_PreS1_P-RF-C      ------------------------------caaatctttctgtccccaat
KC793112_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MG826150_PreS1_P-RF-B      ------------------------------cgaacctttctgttcccaat
MG826151_PreS1_P-RF-B      ------------------------------cgaacctttctgttcccaat
MK534730_PreS1_P-RF-B      ------------------------------cgaacctttctgtccccaat
MK534701_PreS1_P-RF-B      ------------------------------cgaacctttctgtccccaat
MK534714_PreS1_P-RF-B      ------------------------------cgaacctttctgttcccaat
MK534722_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534686_PreS1_P-RF-B      ------------------------------cgaacctttctgttcccaat
MK534653_PreS1_P-RF-B      ------------------------------cgaacctttctgttcccaat
MK534681_PreS1_P-RF-B      ------------------------------cgaacctttctgtccccaat
MK534721_PreS1_P-RF-B      ------------------------------cgaacctttctgttcccaat
MK534630_PreS1_P-RF-B      ------------------------------cgaacctttctgttcccaat
MK534641_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534695_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534716_PreS1_P-RF-B      ------------------------------cgaacctttctgtccccaat
MK534637_PreS1_P-RF-B      ------------------------------caaatctgtctgtccccaat
MK534620_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534635_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534668_PreS1_P-RF-B      ------------------------------cgaacctttctgttcccaat
MK534723_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MT645045_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534587_PreS1_P-RF-B      ------------------------------cgaacctttctgtccccaat
MK534734_PreS1_P-RF-B      ------------------------------cgaacctttctgtccccaat
GQ377595_PreS1_P-RF-B      ------------------------------caaatctctctgtccccaat
MK534660_PreS1_P-RF-B      ------------------------------cgaacctttctgttcccaat
MK534598_PreS1_P-RF-B      ------------------------------cgaacctttctgttcccaat
MK534646_PreS1_P-RF-B      ------------------------------cgaacctttctgttcccaat
MK534664_PreS1_P-RF-B      ------------------------------cgaacctttctgttcccaat
MK534670_PreS1_P-RF-B      ------------------------------cgaacctttctgttcccaat
MK052976_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534582_PreS1_P-RF-B      ------------------------------cgaacctttctgttcccaat
MK534594_PreS1_P-RF-B      ------------------------------cgaacctttctgtccccaat
EU660227_PreS1_P-RF-B      ------------------------------cgaatctttctgttcccaat
MK534589_PreS1_P-RF-B      ------------------------------cgaacctttctgttcccaat
MH094410_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534609_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
JQ801477_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK052967_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK052968_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK052970_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534558_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534728_PreS1_P-RF-B      ------------------------------cgaacctttctgttcccaat
MK534655_PreS1_P-RF-B      ------------------------------cgaacctttctgttcccaat
MK534606_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534555_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534610_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534688_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534672_PreS1_P-RF-B      ------------------------------cgaacctttctgttcccaat
MK534662_PreS1_P-RF-B      ------------------------------cgaacctttctgttcccaat
MK534569_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534729_PreS1_P-RF-B      ------------------------------cgaacctttctgtccccaat
MK534590_PreS1_P-RF-B      ------------------------------cgaacctttctgtccccaat
MK534617_PreS1_P-RF-B      ------------------------------cgaacctttctgtccccaat
MK534618_PreS1_P-RF-B      ------------------------------cgaacctttctgtccccaat
MK534623_PreS1_P-RF-B      ------------------------------cgaacctttctgtccccaat
MK534687_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534689_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534690_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534562_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534584_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534654_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534675_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534559_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534712_PreS1_P-RF-B      ------------------------------caaatctttctgttcccaat
MK534616_PreS1_P-RF-B      ------------------------------cgaacctttctgtccccaat
MK534718_PreS1_P-RF-B      ------------------------------cgaacctttctgttcccaat
MK534726_PreS1_P-RF-B      ------------------------------cgaacctttctgttcccaat
MK534607_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
KJ410497_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
EU939627_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MT645056_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534700_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534684_PreS1_P-RF-B      ------------------------------cgaatctttctgtccccaat
KC774414_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534566_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534648_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534736_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534715_PreS1_P-RF-B      ------------------------------cgaacctttctgtccccaat
MK534633_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534556_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534651_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534579_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534731_PreS1_P-RF-B      ------------------------------cgaacctttctgttcccaat
MK534567_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534563_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534564_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534568_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534580_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534583_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534685_PreS1_P-RF-B      ------------------------------caaatctttctgtccccaat
MK534577_PreS1_P-RF-B      ------------------------------cgaacctttctgttcccaat
MK534561_PreS1_P-RF-B      ------------------------------cgaacctttctgtccccaat
MK534625_PreS1_P-RF-B      ------------------------------cgaacctttctgtccccaat
MK534639_PreS1_P-RF-B      ------------------------------cgaacctttctgtccccaat
                                                                          *  

KJ586810_PreS1_P-RF-A      cctctgggattctttccagaccatcagctggatcctctattcagggcaaa
HE981179_PreS1_P-RF-F      ccactgggattctttccagaccatcagctggatcctcttttcagagcaaa
KJ586803_PreS1_P-RF-A      catggggaattctttccagaccatcagctggatcctcttttcagagcaaa
FJ361772_PreS1_P-RF-G      cctctgggattcctccccgatcaccagttggaccctgcattcggagccaa
MG826145_PreS1_P-RF-B      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
MH746813_PreS1_P-RF-B      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
MH746811_PreS1_P-RF-B      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
MH746812_PreS1_P-RF-B      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
EU835240_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcattcggagccaa
FJ023666_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
EU833891_PreS1_P-RF-G      cctctgggattttttggcgatcatcagttggaccctgcgttcagagccaa
FJ882610_PreS1_P-RF-G      cctctgggattttttggcgatcatcagttggaccctgcgttcagagccaa
FJ882614_PreS1_P-RF-G      cctctgggattttttggcgatcatcagttggaccctgcgttcagagccaa
FJ882611_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcagagccaa
FJ023665_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
FJ023670_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
FJ023664_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
FJ023668_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
FJ023673_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
FJ023667_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
FJ882617_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcagagccaa
FJ882612_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcagagccaa
FJ882618_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcagagccaa
FJ882613_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcagagccaa
MK534663_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggacccagcgttcggagccaa
MH368022_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
MZ439798_PreS1_P-RF-G      cctctgggattttttcccgatcatcagttggaccttgcattcagagccaa
FJ023659_PreS1_P-RF-B      cctctgggatttcttcccgatcatcagttggaccctgcattcggagccaa
FJ023662_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
MK534669_PreS1_P-RF-C      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
FR714490_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcattcggagccaa
KC172106_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcattcggagccaa
KY470996_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
KY471004_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
KY471007_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
KY470999_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
KY471000_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
KY471002_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
KY470998_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
KY471001_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
KY471003_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
KY471006_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
KY470997_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
KY471005_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
KP148441_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
KP148449_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
KP148442_PreS1_P-RF-B      cctctgggatttcttcccgatcatcagttggaccctgcgttcagagccaa
KP148450_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcagagccaa
KP148447_PreS1_P-RF-G      cctctgagatttcttcccgatcatcagttggaccctgcgttcggagccaa
KP148586_PreS1_P-RF-G      cctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaa
AB194949_PreS1_P-RF-A      cctctgggattctttcccgatcatcagttggaccctgcattcggagccaa
GQ161753_PreS1_P-RF-A      cctctgggattctttcccgatcatcagttggaccctgcattcggagccaa
GQ161767_PreS1_P-RF-A      cctctgggattctttcccgatcatcagttggaccctgcattcggagccaa
HF571060_PreS1_P-RF-A      cctctgggattctttcccgatcatcagttggaccctgcattcggagccaa
GQ161837_PreS1_P-RF-A      cctctgggattctttcccgatcatcagttggaccctgcattcggagccaa
GQ161838_PreS1_P-RF-A      cctctgggattctttcccgatcatcagttggaccctgcattcggagccaa
JQ707426_PreS1_P-RF-G      cctctgggattctttcccgatcatcagttggaccctgcattcggagccaa
KP274926_PreS1_P-RF-G      cctctgggattctttcccgatcatcagttggaccctgcattcggagccaa
JF440021_PreS1_P-RF-A      cctctgggattctttcccgatcatcagttggaccctgcattcggagccaa
JF439776_PreS1_P-RF-A      cctctgggattctttcccgatcatcagttggaccctgcattcggagccaa
JF440019_PreS1_P-RF-A      cctctgggattctttcccgatcatcagttggaccctgcattcggagccaa
JF440022_PreS1_P-RF-A      cctctgggattctttcccgatcatcagttggaccctgcattcggagccaa
MF925386_PreS1_P-RF-A      cctctgggattctttcccgatcatcagttggaccctgcattcggagccaa
AB933283_PreS1_P-RF-A      cctctgggattctttcccgatcatcagttggaccctgcattcggagccaa
AB453985_PreS1_P-RF-A      cctctgggattctttcccgatcatcagttggaccctgcattcggagccaa
AB222708_PreS1_P-RF-A      cctctgggattctttcccgatcatcagttggaccctgcattcggagccaa
AB933282_PreS1_P-RF-A      cctctgggattctttcccgatcatcagttggaccctgcattcggagccaa
GQ331048_PreS1_P-RF-A      cctctgggattctttcccgatcatcagttggaccctgcattcggagccaa
KF214656_PreS1_P-RF-A      cctctgggattctttcccgatcatcaattggaccctgcattcggagccaa
HM146131_PreS1_P-RF-A      cctctgggattctttcccgatcatcagttggaccctgcattcggagccaa
AY233277_PreS1_P-RF-A      cctctgggattctttcccgatcatcagttggaccctgcattcggagccaa
AY161145_PreS1_P-RF-A      cctctgggattctttcccgatcatcagttggaccctgcattcggagccaa
AY161146_PreS1_P-RF-A      cctctgggattctttcccgatcatcagttggaccctgcattcggagccaa
AY161140_PreS1_P-RF-A      cctctgggattctttcccgatcatcagttggaccctgcattcaaagccaa
AY161141_PreS1_P-RF-A      cctctgggattctttcccgatcatcagttggaccctgcattcaaagccaa
MF488705_PreS1_P-RF-A      cctctgggattctttcccgatcatcagttggaccctgcattcggagccaa
MF925404_PreS1_P-RF-A      cctctgggattctttcccgatcatcagttggaccctgcattcggagccaa
MT426089_PreS1_P-RF-A      cctctgggattctttcccgatcatcagttggaccctgcattcggagccaa
KX765835_PreS1_P-RF-G      cctctgggattctttcccgatcaccagttggacccagcattcagagccaa
EU833890_PreS1_P-RF-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
AB933279_PreS1_P-RF-A      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
AB933280_PreS1_P-RF-A      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
AB933281_PreS1_P-RF-A      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
EF464099_PreS1_P-RF-A      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
JQ272887_PreS1_P-RF-G      cctctgggattctttccagatcaccagttggatcctgcattcagggcaaa
KF219922_PreS1_P-RF-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
HE981180_PreS1_P-RF-G      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
JQ272886_PreS1_P-RF-G      cctctaggattccttcccgatcaccagttggaccctgcattcagagcaaa
KJ803822_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
FN594767_PreS1_P-RF-D      cctctgggattttttcccgaccaccagttggatccagcattcagagcaaa
GQ161806_PreS1_P-RF-E      cctctgggattttttcccgaccaccagttggatccagcattcagagcaaa
KU679954_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
KU679942_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
KU679943_PreS1_P-RF-B      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
KF873527_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
KU679956_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
KU679958_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccckgcgttcggagccaa
KF873522_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU679941_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KF873523_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KF873524_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KF873521_PreS1_P-RF-B      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
KU679955_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
KU679950_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KF873511_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KF873513_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KF873515_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU679948_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU679944_PreS1_P-RF-B      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KF873519_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU679953_PreS1_P-RF-B      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU679946_PreS1_P-RF-B      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KF873517_PreS1_P-RF-B      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KF873518_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KF873530_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggacccggcgttcggggccaa
KU679952_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KF873537_PreS1_P-RF-C      cctctgggattttttcccgatcaccagttggaccckgcgttcggagccaa
KU679945_PreS1_P-RF-C      cctctgggattttttcccgatcaccagttggaccctgcgttcggagccaa
KF873538_PreS1_P-RF-C      cctctgggattttttcccgatcaccagttggaccctgcgttcggagccaa
KF873542_PreS1_P-RF-C      cctctgggattttttcccgatcaccagttggaccctgcgttcggagccaa
KF873543_PreS1_P-RF-C      cctctgggattttttcccgatcaccagttggaccctgcgttcggagccaa
KF873540_PreS1_P-RF-C      cctctgggattttttcccgatcaccagttggaccctgcgttcggagccaa
KF873531_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KF873532_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KF873533_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KF873534_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KF873535_PreS1_P-RF-C      cctctgggattttttcccgatcaccagttggaccctgcattcggagccaa
KU679939_PreS1_P-RF-C      cctctgggattttttcccgatcaccagttggaccctgcattcggagccaa
KU679940_PreS1_P-RF-C      cctctgggattttttcccgatcaccagttggaccctgcattcggagccaa
MF925402_PreS1_P-RF-B      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KF053166_PreS1_P-RF-B      cctctgggattcttccccggtcaccagttggacccggcgttcggagccaa
KJ803827_PreS1_P-RF-B      cctctgggattcttccccggtcaccagttggacccggcgttcggagccaa
MF925389_PreS1_P-RF-D      cctctgggattctttcccggtcaccagttggaccccgcattcggagccaa
JX036330_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgtttggagccaa
AB674504_PreS1_P-RF-D      cctctgggattctttcccagtcaccagttggacccggcgttcggagccaa
JX036359_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgtttggagccaa
JX036358_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KX660685_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683641_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KY470853_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683675_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
KY470844_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KY470856_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KY470843_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KY470846_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KY470847_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KY470849_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KY470850_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KY470855_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KY470854_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN650068_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT645070_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
MN683620_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
DQ478890_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
MN650069_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AY057948_PreS1_P-RF-D      cctctgggattctttcccgatcaccatttggaccctgcgttcggagccaa
MN683716_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
KT991427_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ562263_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KT991424_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774490_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
MN683712_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683721_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KX660686_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683707_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683588_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683580_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683678_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683628_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KP276256_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683725_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683722_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KX660684_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgtttggagccaa
MN683706_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgtttggagccaa
MN683687_PreS1_P-RF-D      cctctgggattcttccccgatcaccagttggaccctgcgttcggagccaa
MN683688_PreS1_P-RF-D      cctctgggattcttccccgatcaccagttggaccctgcgttcggagccaa
MN650076_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
HM750145_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgtttggagccaa
MN683671_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgtttggagccaa
MN683673_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgtttggagccaa
MN683677_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgtttggagccaa
MN683692_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgtttggagccaa
MN683627_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683699_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
HM750149_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
HM750144_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
MN650083_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN650082_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN650080_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN650081_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN650084_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683718_PreS1_P-RF-D      cctctgggattccttcccgatcaccagttggaccctgcgttcggagccaa
MN683715_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
KC774485_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
AY817511_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683720_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
MN683700_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683587_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683696_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683719_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN650085_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KX660689_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683711_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KX354997_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KP276253_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774456_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
HM750150_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
HM750147_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
HM750146_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
HM750143_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN650087_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
MN650079_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccccgcgttcggagccaa
FJ349241_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggatccagcgttcggagccaa
MN683691_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
MN683695_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
MN683690_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
MN683686_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
MN683693_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
MN683724_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
MN683689_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
MN683694_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
HM750142_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683703_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
HM750148_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774482_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN650078_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN650074_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683680_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683697_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683685_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN650075_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
MN683584_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683679_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683723_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN650072_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN650077_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN650086_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN650073_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683581_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
MN683618_PreS1_P-RF-D      cctctgggattccttcccgatcaccagttggaccctgctttcggagccaa
MN683730_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683622_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683623_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683624_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683655_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683582_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774431_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggatcctgcgttcggagccaa
MN683634_PreS1_P-RF-D      cctctgggattctttcccgatcatcagttggaccctgcgttcggagccaa
KC774479_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AY817513_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT645062_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KT991419_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774478_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
KC774480_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
KF917451_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT645063_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KT991421_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774448_PreS1_P-RF-D      cctctgggattttttcccgatcaccagttggaccctgcgttcggagccaa
KX660677_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683668_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774486_PreS1_P-RF-D      cccctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774499_PreS1_P-RF-D      cccctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683612_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683616_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683625_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
MN683609_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774487_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683656_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683657_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683597_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683652_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683596_PreS1_P-RF-D      cctctgggattttttcccgatcaccagttggacccggcgttcggagccaa
AY817512_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AY817510_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
DQ478887_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774424_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
DQ478892_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774489_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
JF491456_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
JF491448_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AY817509_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683645_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683592_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
MN683594_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
MN683572_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
KP276255_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
DQ478889_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683683_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683640_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN657316_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774463_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683717_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683571_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
KC774494_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
MN683713_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683714_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT645065_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683663_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683635_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683659_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683658_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683632_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683661_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT645060_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683684_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683654_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683642_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683630_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN657317_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683660_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU519422_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683672_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KP276254_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774432_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683626_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683637_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683643_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683644_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683647_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683649_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683590_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774497_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774434_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
JX429898_PreS1_P-RF-D      cccctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774472_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683651_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683653_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774430_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggatcctgcgttcggagccaa
KC774468_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683638_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683621_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683617_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683636_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683669_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683586_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
MT645066_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
MN683670_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774433_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT645049_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
DQ478897_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774423_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774471_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KY629632_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggacccggcattcggagccaa
MN683662_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774449_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AY862866_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggatcctgcgttcggagccaa
AY862864_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggatcctgcgttcggagccaa
AY862865_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggatcctgcgttcggagccaa
KC774453_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
AB270535_PreS1_P-RF-D      cctctgggattttttcccgatcaccagttggaccctgcattcggagccaa
KY670781_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KT991420_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KT991423_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ562278_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KT991417_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT645067_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
JX036332_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683579_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
KC774461_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774425_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
KC774428_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
KC774454_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
EU787435_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
DQ478898_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774492_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774452_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
DQ478886_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774481_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683676_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774483_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
JF491455_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU519423_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683674_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774484_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774498_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774442_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
JF491451_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683639_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
MN683611_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
KC774475_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccccgcgttcggagccaa
KC774439_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683610_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AY800249_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggacccagcgttcggagccaa
JF491449_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774470_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774458_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774474_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774447_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU787434_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AY817515_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774457_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774495_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774422_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774420_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774426_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683574_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KX660675_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683607_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683613_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683614_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683615_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683666_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774466_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KX660674_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KX660680_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683664_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683665_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683603_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN657315_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774488_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774493_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774476_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774435_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774455_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774443_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683619_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683605_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MN683650_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ562223_PreS1_P-RF-C      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
GQ377627_PreS1_P-RF-C      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JN664935_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggatccagccttcagagcaaa
EF103284_PreS1_P-RF-A      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
EF103282_PreS1_P-RF-A      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
EF103283_PreS1_P-RF-A      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
EU185780_PreS1_P-RF-A      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KC012653_PreS1_P-RF-A      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
DQ464164_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
DQ464167_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
DQ464165_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
DQ464166_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
AF297619_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
AY236161_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
AF297620_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
AB188243_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
FJ349221_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcaaagcaaa
MK052957_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggacccagccttcagagcgaa
MK052969_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggacccagccttcagagcgaa
X68292_PreS1_P-RF-DA       cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MZ097806_PreS1_P-RF-D      cccctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KJ647349_PreS1_P-RF-D      cctctgggattcttccccgaccaccagttggatccagccttcagagcaaa
KM386676_PreS1_P-RF-D      cctctgggattctttcccgaacaccagttggatccagccttcagagcaaa
MW601264_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MZ097745_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KM577666_PreS1_P-RF-D      cctctgggattctttcccgaccatcagttggatccagccttcagagcaaa
X65259_PreS1_P-RF-DA       cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KM359442_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MK598656_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MK598653_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MK598652_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MK598654_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MW601296_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JN688715_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MW601310_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MZ097777_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MH464835_PreS1_P-RF-D      cccctgggattctttcccgaccatcagttggatccagccttcagagcaaa
AJ627221_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MW601227_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MZ097716_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
AJ627217_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagccaa
MZ097766_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MW601284_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MZ097758_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MW601241_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MZ097724_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MW601317_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
EU594435_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MK618438_PreS1_P-RF-D      cctctgggaatctttcccgaccaccaggtggatccagccttcagagcaaa
MK618440_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MK618442_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MN507850_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MW601260_PreS1_P-RF-D      cctctgggattctttcccgaccatcagttggatccagccttcagagcaaa
MZ097740_PreS1_P-RF-D      cctctgggattctttcccgaccatcagttggatccagccttcagagcaaa
MK618444_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MK618445_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
DQ111987_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
EU594436_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MH724239_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagccaa
KX827302_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MT426112_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggatccagccttcagagcaaa
MH724243_PreS1_P-RF-D      cctctgggattctttcccgaccaccaattggatccagccttccgagcaaa
AB270538_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MG877711_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JF440013_PreS1_P-RF-D      cctctgggattctttctcgaccaccagttggatccagccttcagagcaaa
JF440011_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JF440017_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JF439999_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JF440012_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JF440010_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JF440006_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JF440001_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JF440000_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JF439994_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JF440009_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JF440007_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JF439998_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JF440004_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JF440005_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JF439996_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JF440002_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JF440003_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JF440014_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JF440015_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JF439995_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MK618439_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KJ647351_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
FJ349212_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JN688689_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KC774450_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MZ097667_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MT426113_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KJ586811_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
AB210819_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagctttcagagcaaa
JX898690_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JX898693_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JX898695_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JX898696_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MT426110_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JX898698_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagcattcagagcaaa
JX898699_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagcattcagagcaaa
MT426111_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MF967563_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
U95551_PreS1_P-RF-DE       cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JX898686_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JX898687_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JX898688_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
AJ344117_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MH724240_PreS1_P-RF-D      cctctgggattccttcccgaccaccagttggatccagccttcagagcaaa
AB188245_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JN664943_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
GU563560_PreS1_P-RF-D      cctctgggattctttcccgaacaccagttggatccagccttcagagcaaa
MF488702_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MW601235_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcaaagcaaa
MZ097721_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcaaagcaaa
KM577665_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KM577667_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KT366492_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MH464851_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KM524359_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
AY373430_PreS1_P-RF-D      cctctgggattctttcacgaccaccagttggatccagccttcagagcaaa
AY233295_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
AY233293_PreS1_P-RF-D      cctctgggattctttcccgaacaccagttggatccagccttcagagcaaa
KM577663_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KM577664_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
EF103285_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KT366504_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
AB583679_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
GQ183486_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MH724222_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MH464846_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MH464850_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MH464852_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MT210033_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KU668440_PreS1_P-RF-D      cctccgggattctttcccgaccaccagttgggtccagccttcagagcaaa
JN664929_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggatccagccttcagagcaaa
MK541689_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JN664934_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MF488699_PreS1_P-RF-D      cccctgggattctttcccgaccaccagttggatccagccttcagagcaaa
AB033558_PreS1_P-RF-D      cccctgggattctttcccgaccaccagttggatccagccttcagagcaaa
GQ205379_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KT366505_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MK516279_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MK516280_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JN664925_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JN664933_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JN664915_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KC875339_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KC875338_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
GQ205387_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
GQ205378_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
GQ205386_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
GQ205377_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
DQ315779_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JN664940_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KX357641_PreS1_P-RF-D      cctctgggattttttcccgaccaccagttggatccagcattcagagcaaa
FN594770_PreS1_P-RF-D      cctctgggattttttcccgaccaccagttggatcccgcattcagagcaaa
KF779353_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggaccctgccttcagagccaa
HQ700492_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagctttcagagcaaa
KF170740_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
HQ700494_PreS1_P-RF-D      cctctgggattccttcccgaccaccagttggatccagccttcagagcaaa
J02202_PreS1_P-RF-DE       cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
HQ700579_PreS1_P-RF-D      cctctrggattctttcccgaccaccagttggatccagccttcagagcaaa
HQ700585_PreS1_P-RF-D      cctctrggattctttcccgaccaccagttggatccagccttcagagcaaa
AB048702_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
AB048703_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MH481860_PreS1_P-RF-D      cctctgggactctttcctgaccaccagttggatccagccttcagagcaaa
MH481859_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MH481862_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MH481858_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MH481861_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
HQ700536_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
FJ692536_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
HQ700493_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
HQ700535_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
HQ700534_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
HQ700541_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
HQ700540_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
HQ700539_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
HQ700538_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
HQ700537_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
HQ700533_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
HQ700500_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
HQ700524_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
HQ700525_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
AB033559_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
HQ700582_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
HQ700503_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
HQ700497_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
HQ700581_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
HQ700583_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
HQ700501_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
HQ700584_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KJ470898_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MF618346_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KF192840_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KF192835_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KF192833_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KF192836_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KF192837_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KF192838_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KF192839_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KF192841_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MF618347_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KJ470897_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KJ470891_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KJ470884_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KJ470886_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KJ470888_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KJ470890_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KJ470887_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
FJ904397_PreS1_P-RF-D      cctctgggattctttcccgaccatcagttggatccagccttcagagcaaa
FJ904437_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KP168421_PreS1_P-RF-D      cctctgggattttttcccgaccaccagttggatccagcattcagagcaaa
KU736916_PreS1_P-RF-D      cctctgggattttttcccgaccaccagttggatccagcattcagagcaaa
KP168420_PreS1_P-RF-D      cctctaggattttttcccgaccaccagttggatccagcattcagagcaaa
MT426114_PreS1_P-RF-D      cctctgggattttttcccgaccaccagttggatccagcattcagagcaaa
KU736915_PreS1_P-RF-D      cctctgggattttttcccgaccaccagttggatccagcattcagagcaaa
KU736914_PreS1_P-RF-D      cctctgggattttttcccgaccaccagttggatccagcattcagagcaaa
KU736917_PreS1_P-RF-D      cctctgggattttttcccgaccaccagttggatccagcattcagagcaaa
FJ904436_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
FN594769_PreS1_P-RF-D      cctctgggattttttcccgaccaccagttggatccagcattcagagcaaa
FN594771_PreS1_P-RF-D      cctctgggattttttcccgaccaccagttggatccagcattcagagcaaa
GQ161754_PreS1_P-RF-D      cctctgggattttttcccgaccaccagttggatccagcattcagagcaaa
DQ991753_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
FJ349207_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
FJ904425_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MH685719_PreS1_P-RF-D      cctctgggattttttcccgaccaccagttggatccagccttcagagcaaa
FJ904416_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
FJ904417_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KM606741_PreS1_P-RF-D      cctctgggattctttcccgaccatcagttggatccagccttcagagcaaa
FJ904430_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
AM494716_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KX357631_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KP288875_PreS1_P-RF-D      cctctgggattcttccccgaccaccagttggatccagccttcagagcaaa
FJ904405_PreS1_P-RF-D      cctctaggattctttcccgaccaccagttggatccagccttcagagcaaa
FJ904401_PreS1_P-RF-D      cctctgggattcttccccgaccaccagttggatccagccttcagagcaaa
KX357627_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
FJ904442_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
FJ904414_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
FJ904441_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
FJ904396_PreS1_P-RF-D      cctctgggattctttcccgaccatcagttggatccagccttcagagcaaa
KX357624_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
FJ904440_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
GU177079_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KX827299_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
FJ904400_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
FJ904398_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MT591274_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MT591275_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KU711666_PreS1_P-RF-D      cctttgggattctttcccgaccaccagttggatccagccttcagagcaaa
FJ904404_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
FJ904403_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
FJ904444_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
FJ904394_PreS1_P-RF-D      cctctgggattctttcccgatcaccagttggatccagccttcagagcaaa
FJ904406_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KP995112_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
FJ904407_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KX357628_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
FJ904447_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KM606750_PreS1_P-RF-D      cctctgggattttttcccgaccaccagttggatccagccttcagagcaaa
KM606751_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KX357636_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
FJ904408_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
FJ904409_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MT591280_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KX357629_PreS1_P-RF-D      cctctgggattctttcccgaacaccagttggatccagccttcagagcaaa
KX357626_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KU736923_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KX357634_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KP168416_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KP168417_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KU736921_PreS1_P-RF-D      cccctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KP168418_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KU736922_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KX357625_PreS1_P-RF-D      cctctgggattctttcccgaacaccagttggatccagccttcagagcaaa
KX357630_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KX357635_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KX357623_PreS1_P-RF-D      cctctgggattctttcccgaccatcagttggatccagccttcagagcaaa
KX357633_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JX036357_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KJ647356_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JN257154_PreS1_P-RF-D      cccctgggattctttcccgaccaccagttggatccagccttcagagcaaa
AY341335_PreS1_P-RF-D      cctctgggattccttcccgaccaccagttggatccagccttcagagcaaa
AB330368_PreS1_P-RF-D      cctctgggagtctttcccgaccaccagttggatccagccttcagagcaaa
JN257191_PreS1_P-RF-D      cctctgggattctttcccgaccaccagctggatccagccttcagagcaaa
JN040803_PreS1_P-RF-D      cctctgggattctttcccgaacaccagttggatccagccttcagagcaaa
MZ097814_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JN642160_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JN257189_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggacccagccttcagagcaaa
KJ803771_PreS1_P-RF-D      cctctggggttctttcccgaccaccaattggatccagccttcagagcaaa
JN257204_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JF754613_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MF925396_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JN040798_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JF754616_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MZ097822_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MF925397_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
AB674432_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggacccagccttcagagcaaa
AB674436_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MF925371_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MF925360_PreS1_P-RF-D      cctctgggattttttcccgaccaccagttggatccagccttcagagcaaa
JN664946_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JN688717_PreS1_P-RF-D      cctctgggattcttccccgaccaccagttggatccagccttcagagcaaa
MN507835_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MF925401_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KM524357_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KR905422_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KT366503_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MF925388_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MF925392_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
X80925_PreS1_P-RF-DE       cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
EU594406_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JQ687532_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MZ097850_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MZ097826_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MZ097680_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagcctttcgagcaaa
JN642137_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MZ097652_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MZ097703_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagcctttcgagcaaa
JN257216_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JN257206_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MZ097838_PreS1_P-RF-D      cctctgggattctttcccgaccatcagttggatccagccttcagagcaaa
MZ097687_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MF925384_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
KF471643_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JN642127_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
AB674433_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggacccagccttcagagcaaa
JN642139_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JN642141_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JN642152_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JN257174_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MW601230_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
MZ097719_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JN257164_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
JN257210_PreS1_P-RF-D      cctctgggattctttcccgaccaccagttggatccagccttcagagcaaa
EF494378_PreS1_P-RF-C      cctctgggattcttccccgaccaccagttggaccctgctttcggagccaa
JQ801476_PreS1_P-RF-C      cctctaggattccttcccgatcaccagttggacccagcattcagagcaaa
AB241109_PreS1_P-RF-C      cctctgggattcttgccagaccatcagttggacccggctttcggagccaa
HQ700519_PreS1_P-RF-C      cctctgggatttttgcccgatcaccagttggaccctgcattcggagccaa
HQ700521_PreS1_P-RF-C      cctctgggatttttgcccgatcaccagttggaccctgtgttcggagccaa
JX504540_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagtcaa
HQ700520_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
JF436919_PreS1_P-RF-C      cctctgggactctttcccgatcaccagttggacccagcgttcggagccaa
MG826147_PreS1_P-RF-C      cctctgggattctttcccagtcaccagttggacccggcgttcggagccaa
MG826141_PreS1_P-RF-C      cctctgggattctttcccagtcaccagttggacccggcgttcggagccaa
MG826142_PreS1_P-RF-C      cctctgggattctttcccagtcaccagttggacccggcgttcggagccaa
JF436923_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggaccctgcattcggagccaa
MF925382_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggacccagcgttcggagccaa
AB031265_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggacccggcattcggagccaa
KJ803798_PreS1_P-RF-C      cctctgggattcttccccgatcatcagttggaccctgcattcagagccaa
FR714496_PreS1_P-RF-C      cctctgggatttcttcccgatcatcagttggacccggcattcggagccaa
MK534615_PreS1_P-RF-B      cctctgggattctttcccggtcaccagttggacccggcattcggagccaa
MK534706_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534632_PreS1_P-RF-C      cctctgggattcttgcccgaccatcagttggaccctgctttcggagccaa
MK534725_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggacccggcgttcggagccaa
MK534724_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggacccggcgttcggagccaa
MK534717_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggacccggcgttcggagccaa
MK534613_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggacccggcgttcggagccaa
MK534735_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggacccggcgttcggagccaa
MK534665_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggacccagcgttcggagccaa
MK534713_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggacccagcgttcggagccaa
KJ803785_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggacccagcgttcggagccaa
MK534679_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggacccggcgttcggagccaa
MZ439673_PreS1_P-RF-C      ccgctgggattctttcccgatcaccagttggacccggcattcagagccaa
MK534574_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggaccctgcattcggagccaa
MF925381_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggacccagcgttcggagccaa
JQ027310_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggacccggcgttcggagccaa
MK534560_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggacccggcgttcagagccaa
GQ924618_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggacccggcgttcggagccaa
MF925370_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggacccagcgttcagagccaa
MT645015_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggacccggcattcggagccaa
KJ410506_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggacccggcattcggagccaa
MK534682_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggacccggcattcggagccaa
HQ700518_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggacccggcattcggagccaa
HQ700530_PreS1_P-RF-C      cctctgggattttttcccgatcaccagttggaccctgcgtttggagccaa
HQ700523_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
HQ700531_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
HQ700532_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AP011102_PreS1_P-RF-C      ccgctgggattctttcccgatcaccagttggacccggcgttcggagccaa
AB493842_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AB105172_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AP011103_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
AB493840_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AB493838_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AB493847_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
GQ358155_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AB493837_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
GQ358156_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
HQ700527_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
HQ700528_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MK534719_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
KT003704_PreS1_P-RF-C      cctctgggattctttcccgaacaccagttggaccctgcgttcggagccaa
KP148352_PreS1_P-RF-C      cctctgggattctttcccgaacaccagttggaccctgcgttcggagccaa
AP011104_PreS1_P-RF-C      cctctgggattctttcccgaacatcagttggaccctgcgttcggagccaa
AP011105_PreS1_P-RF-C      cctctgggattctttcccgaacatcagttggaccctgcgttcggagccaa
LC416040_PreS1_P-RF-C      cctctgggattctttcccgaacatcagttggaccctgcgttcggagccaa
AB033557_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
AY206374_PreS1_P-RF-C      ccgctgggattctttcccgatcaccagttggaccctgcattcggagccaa
GQ377560_PreS1_P-RF-C      ccgctgggattctttcccgatcaccagttggaccttgcattcggagccaa
KC774198_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
KC774201_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
KC774193_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
KC774323_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
KC774291_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
KC774307_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
JQ040146_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcagagccaa
FJ032337_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccttgcgttccgagccaa
GU357843_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
JQ040175_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT645029_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ386633_PreS1_P-RF-C      cctctgggattctttcccgaccaccagttggacccagcgttcggagccaa
FJ386646_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU717211_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU589337_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggacccggcattcggagccaa
FJ032343_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggacccggcattcggagccaa
KC774324_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccttgcgttcagagccaa
HQ700547_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
AB367393_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
FJ715345_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ715346_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ715347_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AF411409_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MW887644_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
KJ173279_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KJ173350_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ562302_PreS1_P-RF-C      cctctgggattctttcccgatcatcagttggaccctgcgttcggagccaa
GU385774_PreS1_P-RF-C      ccgctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
JX661498_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426459_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttgggagccaa
MT426514_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426530_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426466_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426532_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggaccctgcgttcggagccaa
MT426522_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggaccctgcgttcggagccaa
MT426543_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggaccctgcgttcggagccaa
MT426533_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
MT426523_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
MT426502_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426499_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426508_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426512_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426503_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426509_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426500_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426505_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426506_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426511_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426513_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426538_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
MT426539_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426540_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426535_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
MT426471_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426479_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426469_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426462_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426457_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426559_PreS1_P-RF-C      cctctgggattctttcccgatccccagtgggaccctgcgttcggagccaa
MT426546_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
MT426544_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426534_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426465_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426464_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttaggagccaa
MT426515_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426562_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426556_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426549_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426525_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggaccctgcgttcggagccaa
MT426481_PreS1_P-RF-C      cctctgggattctttcccgatcaacagttggaccctgcgttcggagccaa
MT426480_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426470_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426467_PreS1_P-RF-C      cctctgcgattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426460_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426504_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426564_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
MT426560_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426557_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426555_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426541_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426526_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426507_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426501_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426536_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426524_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426492_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426558_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426575_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426488_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426486_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426483_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426563_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426547_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426487_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426496_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426572_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426554_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426491_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426489_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426485_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426482_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426478_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426473_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426463_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426461_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426456_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426455_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426519_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426518_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426517_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426573_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426569_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426565_PreS1_P-RF-C      cttctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426553_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426545_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426542_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426537_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426531_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426527_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426472_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426520_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426550_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426576_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426574_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426571_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426570_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426568_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426567_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426566_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426561_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426551_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426529_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426528_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426521_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426468_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426475_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426476_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426477_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426484_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426490_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426493_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426494_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426495_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426497_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426498_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT426510_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU871995_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU871990_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU871988_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU871999_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU871996_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU871987_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU871984_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU871985_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU871981_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU871983_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU871986_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU871989_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU871992_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU871993_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU871991_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU871994_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
JF436922_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KR013816_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ386593_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
GQ377548_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
GQ377633_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AB670303_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU964351_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
KJ173329_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ562227_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EF494376_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU939589_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MG826149_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
KR013806_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgccttcggagccaa
EU939551_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KJ173358_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
AF461361_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
GQ377581_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
GQ377534_PreS1_P-RF-C      ccgctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KJ173325_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KJ173326_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU939565_PreS1_P-RF-C      ccgctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
GQ377520_PreS1_P-RF-C      ccgctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ787446_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ787480_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KJ173299_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KJ173300_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774328_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
GQ377516_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KM875422_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
AB198084_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
M38454_PreS1_P-RF-CB       cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU963883_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ386649_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ386578_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ386585_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MK321265_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MK720627_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MK720628_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774230_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
GQ377544_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
LC279263_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
LC279264_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
LC279265_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
LC279266_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
LC279267_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MG893561_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774317_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774322_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
JX026887_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ562287_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU963993_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU963990_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU963991_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU963994_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU963995_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU963998_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU963999_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU964001_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU964003_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ386581_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AY123424_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU871997_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KY881840_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774183_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774186_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
LC458432_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
JX429896_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774294_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KY470893_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AP011108_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgctttcggagccaa
KX096713_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
X75656_PreS1_P-RF-CB       cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
KU695742_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
HQ700580_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
HQ700498_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
HQ700499_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
HQ700554_PreS1_P-RF-C      cctctgggattctttcccgatcaycagttggaccctgcgttcggagccaa
KU695745_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
HQ700560_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
HQ700557_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
HQ700462_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
HQ700485_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
HQ700542_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
HQ700509_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
HQ700515_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
HQ700507_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
HQ700508_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU695746_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
KU695744_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
HQ700505_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
KU695741_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
KU695743_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
KJ598675_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MG826146_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ562294_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MG826144_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
HQ700526_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ562317_PreS1_P-RF-C      cccctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MW887645_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AB367800_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttagaccctgcgttcggagccaa
GQ475335_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggggccaa
MT645039_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
JX036329_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgtttggagccaa
JX036328_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgtttggagccaa
GQ377522_PreS1_P-RF-C      catctgggattctttcccgatcaccagttggacccggcgttcggagccaa
KC774344_PreS1_P-RF-C      cccctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
Y18857_PreS1_P-RF-CB       cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AB195950_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
AB195951_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
FJ562226_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774188_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
JX661485_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AB300369_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KR013843_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
FJ562267_PreS1_P-RF-C      cctctgggattcttccccgatcaccagttggacccggcgttcggagccaa
MT645071_PreS1_P-RF-C      ccgctgggattctttcccgatcaccagttggaccctgcgttcagagccaa
JQ040148_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU939547_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
EU939668_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AB049609_PreS1_P-RF-C      cctctgggattctttcccgatcatcaattggacccggcgttcggagccaa
JQ040142_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
JX661486_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MG893554_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgctttcggagccaa
MG893555_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgctttcggagccaa
JQ732168_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggatcctgcgttcggagccaa
AB367419_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AB205152_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
KJ173320_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KJ173322_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ386586_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT645069_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KY363263_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT645048_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU939577_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgctttcggagccaa
MK534585_PreS1_P-RF-C      ccgctgggattttttcccgatcaccagttggaccctgcgttcggagccaa
JF828936_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgctttcggagccaa
JF828935_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgctttcggagccaa
JF828938_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgctttcggagccaa
JF828933_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgctttcggagccaa
JF828934_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgctttcggagccaa
EU919167_PreS1_P-RF-C      cccctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774212_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgtttggagccaa
EU939606_PreS1_P-RF-C      cccctgggattctttcccgatcaccagttggaccctgcattcggagccaa
FJ386635_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
JN400086_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AB642096_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
DQ089798_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AB367400_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774305_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AY247030_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774234_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU916232_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU964306_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU964316_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU964005_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU964006_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU964007_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU964008_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU964009_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU964010_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU964303_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU964304_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU964305_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU964307_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU964308_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU964309_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU964310_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU964311_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU964312_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU964314_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU964315_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU964317_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU964313_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ562305_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AY040627_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgctctcggagccaa
AF233236_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774222_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
JX661494_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
JX661487_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
MG893559_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ562314_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
MT645035_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
GQ377607_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AB195940_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AB195941_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AF330110_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AY167095_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AB195956_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AB195957_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AB195939_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
AB195955_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774246_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774258_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
HM750133_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU787444_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KJ173349_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU916239_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU916241_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU916240_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
GQ377611_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KU963862_PreS1_P-RF-C      cctctgggattctttcccgatcatcagttggaccctgcgttcggagccaa
KU963868_PreS1_P-RF-C      cctctgggattctttcccgatcatcagttggaccctgcgttcggagccaa
KU963869_PreS1_P-RF-C      cctctgggattctttcccgatcatcagttggaccctgcgttcggagccaa
KU963856_PreS1_P-RF-C      cctctgggattctttcccgatcatcagttggaccctgcgttcggagccaa
KU963857_PreS1_P-RF-C      cctctgggattctttcccgatcatcagttggaccctgcgttcggagccaa
KU963858_PreS1_P-RF-C      cctctgggattctttcccgatcatcagttggaccctgcgttcggagccaa
KU963860_PreS1_P-RF-C      cctctgggattctttcccgatcatcagttggaccctgcgttcggagccaa
KU963861_PreS1_P-RF-C      cctctgggattctttcccgatcatcagttggaccctgcgttcggagccaa
KU963863_PreS1_P-RF-C      cctctgggattctttcccgatcatcagttggaccctgcgttcggagccaa
KU963864_PreS1_P-RF-C      cctctgggattctttcccgatcatcagttggaccctgcgttcggagccaa
KU963865_PreS1_P-RF-C      cctctgggattctttcccgatcatcagttggaccctgcgttcggagccaa
KU963866_PreS1_P-RF-C      cctctgggattctttcccgatcatcagttggaccctgcgttcggagccaa
KU963867_PreS1_P-RF-C      cctctgggattctttcccgatcatcagttggaccctgcgttcggagccaa
KU963870_PreS1_P-RF-C      cctctgggattctttcccgatcatcagttggaccctgcgttcggagccaa
KU963859_PreS1_P-RF-C      cctctgggattctttcccgatcatcagttggaccctgcgttcggagccaa
Y18856_PreS1_P-RF-CB       cctctgggattctttcccgatcaccagttggaccctgcgtttggagccaa
FJ715387_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ715385_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ715384_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ715411_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ715412_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ715413_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
FJ715414_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KM213033_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774349_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774332_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggggccaa
KC774263_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774341_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KF053186_PreS1_P-RF-B      cctctgggattctttcccggtcaccagttggacccggcattcggagccaa
KJ803778_PreS1_P-RF-B      cctctgggattctttcccggtcaccagttggacccggcattcggagccaa
KF053179_PreS1_P-RF-B      cctctgggattctttcccgatcaccagttggaccctgcattcaaagccaa
KJ803772_PreS1_P-RF-B      cctctgggattctttcccgatcaccagttggaccctgcattcaaagccaa
KJ717794_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcaaagccaa
KJ803788_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcaaagccaa
EU882006_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU939629_PreS1_P-RF-B      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
EU939631_PreS1_P-RF-B      cctctgggattctttcccgatcaccagttggacccggcgttcggagccaa
HQ684849_PreS1_P-RF-B      cctctgggattctttcccgatcaccagttggaccctgcgttcagagccaa
JQ412091_PreS1_P-RF-B      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774178_PreS1_P-RF-B      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KC774364_PreS1_P-RF-B      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
GQ377635_PreS1_P-RF-B      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
GQ377630_PreS1_P-RF-B      cctctgggattctttcccgatcaccagttggaccctgcattcggagccaa
KP148337_PreS1_P-RF-B      cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
KJ717800_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
KJ803791_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
FJ386674_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
KC315400_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
KF053188_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
KJ803782_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
KJ717814_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
KJ803802_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
KJ717832_PreS1_P-RF-C      cctctgggattctttcccgatcaccagttggaccctgcattcaaagccaa
KJ803804_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggaccctgcattcaaagccaa
KJ717815_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
KJ803803_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
KJ717816_PreS1_P-RF-C      cctctgggattctttcccggtcaccagttggaccctgcattcaaagccaa
GQ377590_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
EU939620_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
HQ684848_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
EU939630_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
FJ562247_PreS1_P-RF-C      cccctgggattctttcccgatcatcagttggaccctgcattcaaagccaa
FJ562328_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
EU939623_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
GQ377604_PreS1_P-RF-C      cctctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
GQ377626_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
GQ377573_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
GQ377613_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
GQ377592_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
GQ377634_PreS1_P-RF-C      cccctgggattctttcccgatcatcagttggaccctgcattcaaagccaa
EU939621_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
GQ377564_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
JQ040174_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
GQ377549_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
GQ377596_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
GQ377614_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
KF053160_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaggccaa
KJ803753_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaggccaa
FJ562229_PreS1_P-RF-C      cccctgggattctttcccgatcatcagttggatcctgcattcaaagccaa
EU522070_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
GQ377539_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
EU881995_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
EU919166_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
GQ377556_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
GQ377565_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MG826148_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
GQ377594_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
GQ377602_PreS1_P-RF-C      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
KC793112_PreS1_P-RF-B      cccctgggattcttccccgatcaccagttggaccctgcgttcggagccaa
MG826150_PreS1_P-RF-B      cctctgggattctttcccagtcaccagttggacccggcgttcggagccaa
MG826151_PreS1_P-RF-B      cctctgggattctttcccagtcaccagttggacccggcgttcggagccaa
MK534730_PreS1_P-RF-B      cctctgggattccttcccgatcaccagttggaccctgcattcaaagccaa
MK534701_PreS1_P-RF-B      cctctgggattctttcccgatcaccagttggaccctgcattcaaagccaa
MK534714_PreS1_P-RF-B      cctctgggattccttcccgatcaccagttggaccctgcattcaaagccaa
MK534722_PreS1_P-RF-B      cctctgggattccttcccgatcaccagttggaccctgcattcaaagccaa
MK534686_PreS1_P-RF-B      cctctgggattccttcccgatcaccagttgggccctgcattcaaagccaa
MK534653_PreS1_P-RF-B      cctctgggattctttcccgatcaccagttggaccctgcattcaaagccaa
MK534681_PreS1_P-RF-B      cctctgggattctttcccgatcaccagttggaccctgcattcaaagccaa
MK534721_PreS1_P-RF-B      cctctgggattctttcccgatcaccagttggaccctgcattcaaagccaa
MK534630_PreS1_P-RF-B      cctctgggattttttcccgatcaccagttggaccctgcattcaaagccaa
MK534641_PreS1_P-RF-B      cctctgggattctttcccgatcaccagttggaccctgcattcaaagccaa
MK534695_PreS1_P-RF-B      cctctgggattctttcccgatcaccagttggaccctgcattcaaagccaa
MK534716_PreS1_P-RF-B      cctctgggattccttcccgatcaccagttggaccctgcattcaaagccac
MK534637_PreS1_P-RF-B      cctctgggatttcttcccgatcaccagttggaccctgcattcaaagccaa
MK534620_PreS1_P-RF-B      cctctgggattctttcccgatcaccagttggacccagcattcaaagccaa
MK534635_PreS1_P-RF-B      cctctgggattctttcccgatcaccagttggacccagcattcaaagccaa
MK534668_PreS1_P-RF-B      cctctgggattctttcccggtcaccagttggacccagcgttcggagccaa
MK534723_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MT645045_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattccgagccaa
MK534587_PreS1_P-RF-B      cccctgggattcctccccgatcatcagttggatcctgcattcaaagccaa
MK534734_PreS1_P-RF-B      cccctgggattcttccccgatcaccagttggaccctgcattcaaagccaa
GQ377595_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggatcctgcattcaaagccaa
MK534660_PreS1_P-RF-B      cctctgggattctttcccggtcaccagttggacccagcgttcggagccaa
MK534598_PreS1_P-RF-B      cctctgggattctttcccggtcaccagttggacccagcgttcggagccaa
MK534646_PreS1_P-RF-B      cctctgggattctttcccggtcaccagttggacccagcgttcggagccaa
MK534664_PreS1_P-RF-B      cctctgggattctttcccggtcaccagttggacccagcgttcggagccaa
MK534670_PreS1_P-RF-B      cctctgggattctttcccggtcaccagttggacccagcgttcggagccaa
MK052976_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534582_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534594_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
EU660227_PreS1_P-RF-B      cctctgggattctttcccgatcatcagttggaccctgcattcaaagccaa
MK534589_PreS1_P-RF-B      cctctgggattctttcccggtcaccagttggaccctgcgttcggagccaa
MH094410_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534609_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
JQ801477_PreS1_P-RF-B      cccctgggattcttccccgatcaccagttggaccctgcattcaaagccaa
MK052967_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK052968_PreS1_P-RF-B      cccctgggattcttccccgatcatcagtcggaccctgcattcaaagccaa
MK052970_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534558_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534728_PreS1_P-RF-B      cctctgggattctttcccgatcatcagttggaccctgcattcaaagccaa
MK534655_PreS1_P-RF-B      cctctgggattctttcccggtcaccagttggaccctgcattcaaagccaa
MK534606_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534555_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534610_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534688_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534672_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534662_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534569_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534729_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534590_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534617_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534618_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534623_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534687_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534689_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534690_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534562_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534584_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534654_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534675_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534559_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534712_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534616_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534718_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534726_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534607_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
KJ410497_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
EU939627_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MT645056_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534700_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534684_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
KC774414_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534566_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534648_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534736_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534715_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534633_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534556_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534651_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534579_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534731_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534567_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534563_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534564_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534568_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534580_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534583_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534685_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534577_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534561_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534625_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
MK534639_PreS1_P-RF-B      cccctgggattcttccccgatcatcagttggaccctgcattcaaagccaa
                           *         *  *       *  **    *  *      *    *  * 

KJ586810_PreS1_P-RF-A      ttccagcagtcccgactgggacttcaacaaaaacaaggacaattggccaa
HE981179_PreS1_P-RF-F      ttccagcagtcccgattgggacttcaacaaaaacaaggacacttggccaa
KJ586803_PreS1_P-RF-A      ttccagcagtcccgattgggacttcaacaaaaacaaggacacttggccaa
FJ361772_PreS1_P-RF-G      ttcaaacaatccagattgggacttcaaccccatcaaggatcaatggtcag
MG826145_PreS1_P-RF-B      ctcacacaatccagattgggacttcaaccccaacaaggaccattggccac
MH746813_PreS1_P-RF-B      ctcacacaatccagattgggacttcaaccccaacaaggaccattggccac
MH746811_PreS1_P-RF-B      ctcacacaatccagattgggacttcaaccccaacaaggaccattggccac
MH746812_PreS1_P-RF-B      ctcacacaatccagattgggacttcaaccccaacaaggaccattggccac
EU835240_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
FJ023666_PreS1_P-RF-G      ctcaaacaatcccgattgggacttcaaccccaacaaggaccattggccac
EU833891_PreS1_P-RF-G      ctcaaacaatccagattgggacttaaaccccaacaaggacccttggccac
FJ882610_PreS1_P-RF-G      ctcaaacaatccagattgggacttaaaccccaacaaggacccttggccac
FJ882614_PreS1_P-RF-G      ctcaaacaatccagattgggacttaaaccccaacaaggacccttggccac
FJ882611_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
FJ023665_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
FJ023670_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
FJ023664_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
FJ023668_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
FJ023673_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
FJ023667_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
FJ882617_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
FJ882612_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaagaccattggccac
FJ882618_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaagaccattggccac
FJ882613_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaagaccattggccac
MK534663_PreS1_P-RF-C      ttcaaacaatccagattgggacttcaaccccaacaaggatcaatggccag
MH368022_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaccaaggatcattggccac
MZ439798_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggacccttggccac
FJ023659_PreS1_P-RF-B      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
FJ023662_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
MK534669_PreS1_P-RF-C      ttcaaacaatccagattgggacttcaaccccaacaaggatcattggccac
FR714490_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
KC172106_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
KY470996_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
KY471004_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
KY471007_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
KY470999_PreS1_P-RF-G      ctcaaacaatccagattgggacctcaaccccaacaaggaccattggccac
KY471000_PreS1_P-RF-G      ctcaaacaatccagattgggacctcaaccccaacaaggaccattggccac
KY471002_PreS1_P-RF-G      ctcaaacaatccagattgggacctcaaccccaacaaggaccattggccac
KY470998_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
KY471001_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
KY471003_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
KY471006_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
KY470997_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
KY471005_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
KP148441_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
KP148449_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
KP148442_PreS1_P-RF-B      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
KP148450_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
KP148447_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
KP148586_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccaacaaggaccattggccac
AB194949_PreS1_P-RF-A      ctcaaacaatccagattgggactacaaccccatcaaagaccactggccac
GQ161753_PreS1_P-RF-A      ctcaaacaacccagattgggacttcaaccccatcaaggaccactggccag
GQ161767_PreS1_P-RF-A      ctcaaacaatcaagattgggacttcaaccacaacaaggaccactggccac
HF571060_PreS1_P-RF-A      ctcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
GQ161837_PreS1_P-RF-A      ctcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
GQ161838_PreS1_P-RF-A      ctcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
JQ707426_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
KP274926_PreS1_P-RF-G      ctcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
JF440021_PreS1_P-RF-A      ctcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
JF439776_PreS1_P-RF-A      ctcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
JF440019_PreS1_P-RF-A      ctcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
JF440022_PreS1_P-RF-A      ctcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
MF925386_PreS1_P-RF-A      ctcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
AB933283_PreS1_P-RF-A      ctcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
AB453985_PreS1_P-RF-A      ctcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
AB222708_PreS1_P-RF-A      ctcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
AB933282_PreS1_P-RF-A      ctcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
GQ331048_PreS1_P-RF-A      ctcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
KF214656_PreS1_P-RF-A      ttcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
HM146131_PreS1_P-RF-A      ttcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
AY233277_PreS1_P-RF-A      ttcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
AY161145_PreS1_P-RF-A      ttcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
AY161146_PreS1_P-RF-A      ttcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
AY161140_PreS1_P-RF-A      ttcaaacaatccagattgggacctcaaccccataaaggaccactggccac
AY161141_PreS1_P-RF-A      ttcaaacaatccagattgggacctcaaccccataaaggaccactggccac
MF488705_PreS1_P-RF-A      ttcaaacaatccagattgggacttcaaccccatcaaggaccaatggccac
MF925404_PreS1_P-RF-A      ttcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
MT426089_PreS1_P-RF-A      ttcaaacaatccagattgggacttcaaccccgtcaaggaccgctggccac
KX765835_PreS1_P-RF-G      ttccaacaatccagattgggacttcaatcccaacaaggatcaatggccag
EU833890_PreS1_P-RF-G      taccaacagtccagattgggacttcaatcccaaaaaggacccttggccag
AB933279_PreS1_P-RF-A      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
AB933280_PreS1_P-RF-A      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
AB933281_PreS1_P-RF-A      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
EF464099_PreS1_P-RF-A      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
JQ272887_PreS1_P-RF-G      ttccagcaatccagattgggacttcaatcccaaaaaggacaattggccag
KF219922_PreS1_P-RF-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
HE981180_PreS1_P-RF-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
JQ272886_PreS1_P-RF-G      taccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
KJ803822_PreS1_P-RF-C      ctcaaacaatccagattgggacttcaaccccaacaaggatcaatggccag
FN594767_PreS1_P-RF-D      caccagaaatccagattgggaccacaatcccaacaaagaccgctggacag
GQ161806_PreS1_P-RF-E      caccagaaatccagattgggaccacaatcccaacaaagaccactggacgg
KU679954_PreS1_P-RF-C      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KU679942_PreS1_P-RF-C      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KU679943_PreS1_P-RF-B      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KF873527_PreS1_P-RF-C      ctcaaacaatccagattgggacttcaaccccaacaaggatcattggccag
KU679956_PreS1_P-RF-C      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KU679958_PreS1_P-RF-C      ctcaaacaatccagattgggatttcaactccaacaagrmtcactggccag
KF873522_PreS1_P-RF-C      ctcaaacaatccagattgggacttcaacyccaacaaggatcactggccag
KU679941_PreS1_P-RF-C      ctcaaacaatccagattgggacttcaacyccaacaaggatcactggccag
KF873523_PreS1_P-RF-C      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KF873524_PreS1_P-RF-C      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KF873521_PreS1_P-RF-B      ctcaaacaatccagattgggacttcaacccgaacaaggatcactggccag
KU679955_PreS1_P-RF-C      ctcaaacaatccagattgggacttcaacccgaacaaggatcactggccag
KU679950_PreS1_P-RF-C      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KF873511_PreS1_P-RF-C      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KF873513_PreS1_P-RF-C      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KF873515_PreS1_P-RF-C      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KU679948_PreS1_P-RF-C      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KU679944_PreS1_P-RF-B      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KF873519_PreS1_P-RF-C      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KU679953_PreS1_P-RF-B      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KU679946_PreS1_P-RF-B      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KF873517_PreS1_P-RF-B      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KF873518_PreS1_P-RF-C      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KF873530_PreS1_P-RF-C      ctcaaacaatccggattgggacttcaaccccaacaaggatcactggccag
KU679952_PreS1_P-RF-C      ttcaaacaatccagattgggacttcaaccccaacaaggatcactggccar
KF873537_PreS1_P-RF-C      ctcaaacaatccagattgggacttcaaccccaacaagratcastggccar
KU679945_PreS1_P-RF-C      ctcaaacaatccagattgggacttcaaccccaacaaggaacactggccag
KF873538_PreS1_P-RF-C      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KF873542_PreS1_P-RF-C      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KF873543_PreS1_P-RF-C      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KF873540_PreS1_P-RF-C      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KF873531_PreS1_P-RF-C      ttcaaamaatccagattgggacttcaaccccaacaaggatcactggccag
KF873532_PreS1_P-RF-C      ttcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KF873533_PreS1_P-RF-C      ttcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KF873534_PreS1_P-RF-C      ttcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KF873535_PreS1_P-RF-C      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KU679939_PreS1_P-RF-C      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KU679940_PreS1_P-RF-C      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MF925402_PreS1_P-RF-B      caccgcaaatccagattgggacttcaatcccaacaagaacatctggccgg
KF053166_PreS1_P-RF-B      ttcaaacaatccagattgggacttcaaccccaacaaggatcaatggccag
KJ803827_PreS1_P-RF-B      ttcaaacaatccagattgggacttcaaccccaacaaggatcaatggccag
MF925389_PreS1_P-RF-D      ttcaaacaatccagattgggacttcaatcccaacctcgattgctggcctg
JX036330_PreS1_P-RF-D      ctcaaacagtccagattgggacttcaaccccaacaaggatcactggccag
AB674504_PreS1_P-RF-D      ttcaaacaatccagattgggacttcaaccccaacaaggatcaatggccag
JX036359_PreS1_P-RF-D      ctcaaacagtccagattgggacttcaaccccaacaaggatcactggccag
JX036358_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccagcaaggatcactggccag
KX660685_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683641_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KY470853_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683675_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KY470844_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KY470856_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KY470843_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KY470846_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KY470847_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KY470849_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KY470850_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KY470855_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KY470854_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN650068_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggcccg
MT645070_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683620_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaatcccaacaaggatcactggccag
DQ478890_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN650069_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
AY057948_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccaa
MN683716_PreS1_P-RF-D      ctcaaacaatccagattgggatttcaaccccaacaaggatcactggccag
KT991427_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
FJ562263_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KT991424_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774490_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683712_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683721_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KX660686_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683707_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683588_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683580_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683678_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683628_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KP276256_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683725_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683722_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KX660684_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683706_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683687_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683688_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN650076_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcattggccag
HM750145_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683671_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcattggccag
MN683673_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcattggccag
MN683677_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcattggccag
MN683692_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683627_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683699_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
HM750149_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcattggccag
HM750144_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN650083_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN650082_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN650080_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcattggccag
MN650081_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcattggccag
MN650084_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcattggccag
MN683718_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683715_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774485_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
AY817511_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683720_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683700_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaatcccaacaaggatcactggccag
MN683587_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683696_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683719_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN650085_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KX660689_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683711_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KX354997_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KP276253_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774456_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
HM750150_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
HM750147_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
HM750146_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
HM750143_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN650087_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN650079_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
FJ349241_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683691_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683695_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683690_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683686_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683693_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683724_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683689_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683694_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
HM750142_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683703_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
HM750148_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774482_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN650078_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN650074_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683680_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683697_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683685_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN650075_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683584_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683679_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683723_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN650072_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN650077_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN650086_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN650073_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683581_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683618_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683730_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683622_PreS1_P-RF-D      ctcaaacaatccagattgggatttcaaccccaacaaggatcattggccag
MN683623_PreS1_P-RF-D      ctcaaacaatccagattgggatttcaaccccaacaaggatcattggccag
MN683624_PreS1_P-RF-D      ctcaaacaatccagattgggatttcaaccccaacaaggatcattggccag
MN683655_PreS1_P-RF-D      cacaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683582_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccgg
KC774431_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683634_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774479_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatccctggccag
AY817513_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MT645062_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcattggccag
KT991419_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774478_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774480_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KF917451_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaatcccaacaaggatcactggccag
MT645063_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KT991421_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774448_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KX660677_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683668_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774486_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774499_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683612_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaatcccaacaaggatcactggccag
MN683616_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaatcccaacaaggatcactggccag
MN683625_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683609_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774487_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683656_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683657_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683597_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcattggccag
MN683652_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcattggccag
MN683596_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
AY817512_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
AY817510_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
DQ478887_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774424_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
DQ478892_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774489_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaatcccaacaaggatcactggccag
JF491456_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
JF491448_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
AY817509_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683645_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683592_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683594_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683572_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KP276255_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
DQ478889_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683683_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683640_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN657316_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774463_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683717_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683571_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774494_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683713_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683714_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MT645065_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683663_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683635_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683659_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683658_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683632_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683661_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MT645060_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683684_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683654_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683642_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683630_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN657317_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683660_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KU519422_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683672_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KP276254_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774432_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683626_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683637_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683643_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683644_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683647_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683649_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683590_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774497_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774434_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
JX429898_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774472_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683651_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683653_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774430_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774468_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683638_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683621_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683617_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683636_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683669_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683586_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MT645066_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683670_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774433_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MT645049_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
DQ478897_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774423_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774471_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KY629632_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683662_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774449_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
AY862866_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccgg
AY862864_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccgg
AY862865_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccgg
KC774453_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcattggccag
AB270535_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KY670781_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KT991420_PreS1_P-RF-D      ctcaaacaatccagattggggcttcaaccccaacaaggatcactggccag
KT991423_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
FJ562278_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KT991417_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MT645067_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcgctggccag
JX036332_PreS1_P-RF-D      ctcaaacaatccagattgggatttcaaccccaacaaggatcactggccag
MN683579_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774461_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774425_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774428_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774454_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
EU787435_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
DQ478898_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774492_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774452_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
DQ478886_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774481_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683676_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774483_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
JF491455_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KU519423_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683674_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774484_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774498_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774442_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
JF491451_PreS1_P-RF-D      ctcaaaccatccagattgggacttcaaccccaacaaggatcactggccag
MN683639_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683611_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774475_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774439_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683610_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
AY800249_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
JF491449_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774470_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774458_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774474_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774447_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
EU787434_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
AY817515_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774457_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774495_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774422_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774420_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774426_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683574_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KX660675_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683607_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683613_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683614_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683615_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683666_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774466_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KX660674_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KX660680_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683664_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683665_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683603_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN657315_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774488_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774493_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774476_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774435_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774455_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
KC774443_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683619_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683605_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
MN683650_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccag
FJ562223_PreS1_P-RF-C      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
GQ377627_PreS1_P-RF-C      cacagcaaatccagattgggacttcaatcccaacaaggacacctggccag
JN664935_PreS1_P-RF-D      caccagaaatccagattgggacttcaatcccaacaaggacacctggccag
EF103284_PreS1_P-RF-A      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
EF103282_PreS1_P-RF-A      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
EF103283_PreS1_P-RF-A      cacagcaaatccagattgggacttcaatcccaacaaggacacctggccag
EU185780_PreS1_P-RF-A      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
KC012653_PreS1_P-RF-A      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
DQ464164_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
DQ464167_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
DQ464165_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaagggcacctggccag
DQ464166_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaagggcacctggccag
AF297619_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
AY236161_PreS1_P-RF-D      caccgcaaatccggattgggacttcaatcccaacaaggacacctggccag
AF297620_PreS1_P-RF-D      cacaacaaatccagattgggacttcaatcccaacaaggaccactggccag
AB188243_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacttggccag
FJ349221_PreS1_P-RF-D      cacagcaaatccagattgggacttcaatcccaacaaggacacctggccag
MK052957_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MK052969_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
X68292_PreS1_P-RF-DA       caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MZ097806_PreS1_P-RF-D      tacagcaaatccagattgggacttcaatcccaacaaggacacctggccag
KJ647349_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
KM386676_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacaactggccag
MW601264_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggcccg
MZ097745_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggcccg
KM577666_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
X65259_PreS1_P-RF-DA       caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
KM359442_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacaactggccag
MK598656_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacagggacgccttgccag
MK598653_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacagggacgccttgccag
MK598652_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacagggacgccttgccag
MK598654_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacagggacgccttgccag
MW601296_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JN688715_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MW601310_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MZ097777_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MH464835_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
AJ627221_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacttggccag
MW601227_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MZ097716_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
AJ627217_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MZ097766_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MW601284_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MZ097758_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MW601241_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MZ097724_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MW601317_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
EU594435_PreS1_P-RF-D      cactgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MK618438_PreS1_P-RF-D      cactgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MK618440_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MK618442_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MN507850_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MW601260_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MZ097740_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MK618444_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MK618445_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
DQ111987_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
EU594436_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MH724239_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacccctggccag
KX827302_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MT426112_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MH724243_PreS1_P-RF-D      caccccaaatccagattgggacttcaatcccaacaaggacacctggccag
AB270538_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacccctggccag
MG877711_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JF440013_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JF440011_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JF440017_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JF439999_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JF440012_PreS1_P-RF-D      caccgcagatccagattgggacttcaatcccaacaaggacacctggccag
JF440010_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JF440006_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JF440001_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JF440000_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JF439994_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JF440009_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JF440007_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JF439998_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JF440004_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JF440005_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JF439996_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JF440002_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JF440003_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JF440014_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JF440015_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JF439995_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MK618439_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
KJ647351_PreS1_P-RF-D      cactgcaaatccagattgggacttcaatcccaacaaggacaactggccag
FJ349212_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacttggccag
JN688689_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccaa
KC774450_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MZ097667_PreS1_P-RF-D      cacagcaaatcaagattgggacttcaatcccaacaaggacacctggccag
MT426113_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
KJ586811_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
AB210819_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JX898690_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JX898693_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JX898695_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JX898696_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MT426110_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JX898698_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JX898699_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MT426111_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MF967563_PreS1_P-RF-D      cacagcaaatccagattgggacttcaatcccaacaaggacacctggccag
U95551_PreS1_P-RF-DE       cacagcaaatccagattgggacttcaatcccaacaaggacacctggccag
JX898686_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JX898687_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
JX898688_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
AJ344117_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MH724240_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
AB188245_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccaa
JN664943_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
GU563560_PreS1_P-RF-D      cactgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MF488702_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MW601235_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MZ097721_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
KM577665_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
KM577667_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggatacctggccag
KT366492_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MH464851_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
KM524359_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
AY373430_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
AY233295_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
AY233293_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
KM577663_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
KM577664_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
EF103285_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
KT366504_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
AB583679_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
GQ183486_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MH724222_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MH464846_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MH464850_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MH464852_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
MT210033_PreS1_P-RF-D      caccgcaaatccagattgggacttcaatcccaacaaggacacctggccag
KU668440_PreS1_P-RF-D      caccagaaatccagattgggacttcaatcccaacaaggacccctggccag
JN664929_PreS1_P-RF-D      caccagaaatccagattgggacttcaatcccaacaaggacacctggccag
MK541689_PreS1_P-RF-D      caccagcaatccagattgggacttcaatcccaacaaggacacctggccag
JN664934_PreS1_P-RF-D      caccagaaatccagattgggacttcaatcccaacaaggacacctggccag
MF488699_PreS1_P-RF-D      caccagaaatccagattgggacttcaatcccaacaaggacacctggccag
AB033558_PreS1_P-RF-D      caccagaaatccagattgggacttcaatcccaacaaggacacctggccag
GQ205379_PreS1_P-RF-D      caccagaaatccagattgggacttcaatcccaacaaggacccctggccag
KT366505_PreS1_P-RF-D      caccagaaatccagattgggacttcaatcccaacaaggacacctggccag
MK516279_PreS1_P-RF-D      caccagaaatccagattgggacttcaatcccaacaaggacacctggccag
MK516280_PreS1_P-RF-D      caccagaaatccagattgggacttcaatcccaacaaggacacctggccag
JN664925_PreS1_P-RF-D      caccagaaatccagattgggacttcaatcccaacaaggacacctggccag
JN664933_PreS1_P-RF-D      caccagaaatccagattgggacttcaatcccaacaaggacacctggccag
JN664915_PreS1_P-RF-D      caccagaaatccagattgggacttcaatcccaacaaggacacctggccag
KC875339_PreS1_P-RF-D      caccagaaatccagattgggacttcaatcccaacaaggacacctggccag
KC875338_PreS1_P-RF-D      caccagaaatccagattgggacttcaatcccaacaaggacacctggccag
GQ205387_PreS1_P-RF-D      caccagaaatccagattgggacttcaatcccaacaaggacacctggccag
GQ205378_PreS1_P-RF-D      caccagaaatccagattgggacttcaatcccaacaaggacacctggccag
GQ205386_PreS1_P-RF-D      caccagaaatccagattgggacttcaatcccaacaaggacacctggccag
GQ205377_PreS1_P-RF-D      caccagaaatccagattgggacttcaatcccaacaaggacacctggccag
DQ315779_PreS1_P-RF-D      caccagaaatccagattgggacttcaatcccaacaaggacacctggccag
JN664940_PreS1_P-RF-D      caccagaaatccagattgggacttcaatcccaacaaggacacctggccag
KX357641_PreS1_P-RF-D      cacaagaaatccagattgggacctcaatcccaacaaggacacctggccag
FN594770_PreS1_P-RF-D      caccagaaatccagattgggaccacaatcccaacaaagaccactggacag
KF779353_PreS1_P-RF-D      ctcaaacaatccagattgggacttcaaccccaacaaggaccactggccag
HQ700492_PreS1_P-RF-D      caccaacaatccagattgggacttcaatcccaacaaggacacctggccag
KF170740_PreS1_P-RF-D      caccaacaatccagattgggacttcaatcccaacaaggacacctggccag
HQ700494_PreS1_P-RF-D      caccaacaatcccgattgggayttcaatcccaacaaggacacctggccag
J02202_PreS1_P-RF-DE       caccaacaatccagattgggacttcaatcccaacaaggacacctggccag
HQ700579_PreS1_P-RF-D      caccaacaatccagattgggacttcaatcccaacaaggacacctggccag
HQ700585_PreS1_P-RF-D      caccaacaatccagattgggacttcaatcccaacaaggacacctggccag
AB048702_PreS1_P-RF-D      caccaacaatccagattgggacttcaatcccaacaaggacacctggccag
AB048703_PreS1_P-RF-D      caccaacaatccagattgggacttcaatcccaacaaggacacctggccag
MH481860_PreS1_P-RF-D      caccaacaatccagattgggacttcaatcccaacaaggacacctggccag
MH481859_PreS1_P-RF-D      caccaacaatccagattgggacttcaatcccaacaaggacacctggccaa
MH481862_PreS1_P-RF-D      caccaacaatccagattgggacttcaatcccaacaaggacacctggccag
MH481858_PreS1_P-RF-D      caccaacaatccagattgggacttcaatcccaacaaggacacctggccag
MH481861_PreS1_P-RF-D      caccaacaatccagattgggacttcaatcccaacaaggacacctggccag
HQ700536_PreS1_P-RF-D      caccaacaatccagattgggacttcaatcccaacaaggacgcctggccag
FJ692536_PreS1_P-RF-D      caccaacaatccagattgggacttcaatcccaacaaggacacctggccag
HQ700493_PreS1_P-RF-D      caccaacaatccagattgggacttcaatcccaacaaggacacctggccag
HQ700535_PreS1_P-RF-D      caccaacaatccagattgggacttcaatcccaacaaggacacctggccag
HQ700534_PreS1_P-RF-D      caccaacaatccagattgggacttcaatcccaacaaggacacctggccag
HQ700541_PreS1_P-RF-D      caccaacaatccagattgggacttcaatcccaacaaggacacctggccag
HQ700540_PreS1_P-RF-D      caccaacaatccagattgggacttcaatcccaacaaggacacctggccag
HQ700539_PreS1_P-RF-D      caccaacaatccagattgggacttcaatcccaacaaggacacctggccag
HQ700538_PreS1_P-RF-D      caccaacaatccagattgggacttcaatcccaacaaggacacctggccag
HQ700537_PreS1_P-RF-D      caccaacaatccagattgggacttcaatcccaacaaggacacctggccag
HQ700533_PreS1_P-RF-D      caccaacaatccagattgggacttcaatcccaacaaggacacctggccag
HQ700500_PreS1_P-RF-D      caccaacaatccagattgggacttcaatcccaacaaggacacctggccag
HQ700524_PreS1_P-RF-D      caccaacaatccagattgggacttcaatcccaacaaggacacctggccag
HQ700525_PreS1_P-RF-D      caccaacaatccagattgggacttcaatcccaacaaggacacctggccag
AB033559_PreS1_P-RF-D      caccaacaatccagattgggacttcaatcccaacaaggacacctggccag
HQ700582_PreS1_P-RF-D      caccaacaat