HBVdb

Dataset for nucleotide sequence PreC of genotype RF

[Download (right click)] [Edit] [Sequences] [Repertoires]

1005 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


KF219922_PreC_P-RF-GH      atgtaactttttcac---------ctctgcctaatcatct---cttgttc
JQ272886_PreC_P-RF-GF      atgtaactttttcac---------ctctgcctaatcatct---cttgttc
HE981179_PreC_P-RF-FG      atgcaactttttcac---------ctctgcctaatcatct---tttgttc
HE981180_PreC_P-RF-GF      atgcaactttttcac---------ctctgcctaatcatct---tttgttc
JQ272887_PreC_P-RF-GF      atgtaactatttcac---------ctctgcctaatcatct---cttgttc
KJ586803_PreC_P-RF-AF      atgcaactttttcac---------ctctgcctaatcatct---tttgttc
MF488699_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
EU833890_PreC_P-RF-GA      aagcaactttttcac---------ctctgcctaatcatct---cttgttc
AB933283_PreC_P-RF-AG      atgtaactttttcac---------ctctgcctaatcatct---cttgttc
JF440019_PreC_P-RF-AG      ----------------------------gcctaatcatct---catgttc
JF440021_PreC_P-RF-AG      ----------------------------gcctaatcatct---catgttc
JF440022_PreC_P-RF-AG      ----------------------------gcctaatcatct---catgttc
AB933282_PreC_P-RF-AG      atgtaactttttcac---------ctctgcctaatcatct---cttgttc
EU833889_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KP274926_PreC_P-RF-GA      atgtaactttttcac---------ctctgcctaatcatct---cttgttc
EF464099_PreC_P-RF-AG      atgtaactttttcac---------ctctgcctaatcatct---cttgttc
AB933281_PreC_P-RF-AG      atgtaactttttcac---------ctctgcctaatcatct---cttgttc
AB933279_PreC_P-RF-AG      atgtaactttttcac---------ctctgcctaatcatct---cttgttc
AB933280_PreC_P-RF-AG      atgtaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707468_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707426_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707424_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707459_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707473_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707465_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707464_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707463_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707461_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707457_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707458_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707460_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707462_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707466_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707467_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707469_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707470_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707448_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707474_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707421_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707430_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707432_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707445_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707450_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707456_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707471_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707472_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707475_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JQ707441_PreC_P-RF-GA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774323_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KJ803771_PreC_P-RF-DB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU679952_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctartcatct---crtgttc
HQ700580_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MF925382_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
EF494378_PreC_P-RF-CA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KF873530_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JQ027310_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KJ803785_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MG826150_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ032343_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ386674_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
EU939623_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
GQ377592_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
EU939620_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ562328_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KJ803822_PreC_P-RF-CB      atgcaactttttcac---------ctcctcctaatcatct---catgttc
EU660227_PreC_P-RF-BC      ttgcaactttttcac---------ctctgcctaatcatct---cttgttc
EU939621_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KJ803791_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
GQ377604_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
EU882006_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GQ377556_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
EU939630_PreC_P-RF-CB      atgcaactttttcac---------tcctgcctaatcatct---catgttc
MG826151_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU939631_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
EU939632_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ562229_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KM213033_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KJ803798_PreC_P-RF-CB      atgcaacttcttcac---------ctctgcctaatcatct---catgttc
KJ803782_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MK052970_PreC_P-RF-BD      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KJ410497_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---ctggttc
GQ377595_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JF436919_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ032337_PreC_P-RF-CB      atgcaactttttcac---------ctctgtctaatcatct---catgttc
KJ803803_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HQ684848_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaataaaat---catgttc
EU939627_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JX661498_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctagtcatct---cttgttc
GQ377626_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ562247_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774414_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GQ377590_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KJ173279_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KJ173280_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GQ377594_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GQ377564_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GQ377539_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KJ173358_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MK052968_PreC_P-RF-BD      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GQ377614_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GQ377613_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GQ377602_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GQ377573_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GQ377565_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MK052967_PreC_P-RF-BD      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GQ377634_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KP148337_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC315400_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KJ803802_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GQ377549_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GQ377596_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MG826146_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MG826147_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KY470865_PreC_P-RF-GC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KY470858_PreC_P-RF-GC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KY470871_PreC_P-RF-GC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU787444_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KF214680_PreC_P-RF-GC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ562267_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
EU916228_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ562287_PreC_P-RF-CB      aagcaactttttcac---------ctttgcctaatcattt---cctgttc
KX774505_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB241109_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB014375_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ562227_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU589337_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KU576837_PreC_P-RF-BC      ctgcaactttttcac---------ctctgcctaatcatct---catgttc
KU577083_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AF461361_PreC_P-RF-CB      atgcatctttctcac---------ctctgcctaatcatct---catgttc
FJ562277_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ562271_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ386593_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963930_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963931_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963932_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963933_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963934_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963935_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963936_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963938_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963939_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963940_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963941_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963942_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963943_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963944_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JQ040130_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU939629_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AB642096_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU939602_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU939589_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
GQ377633_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU871994_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU871995_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU871991_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU871987_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU871985_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU871992_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU871993_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU871996_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU872014_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU872015_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU871981_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU871983_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU871986_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU871999_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU871984_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU871988_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU871989_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU871990_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KR013806_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ562305_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AF411409_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB198084_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GU357843_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ562336_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU939565_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JQ040146_PreC_P-RF-CB      atgcaaatttttcac---------ctctgcctaatcatct---catgttc
EU939581_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB195939_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB195940_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB195941_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB195955_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB195956_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB195957_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KM875422_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774188_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB367393_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU871997_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AY123424_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KY881840_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
M38454_PreC_P-RF-CB        atgcaactttttcac---------ctctgcctaatcatct---catgttc
JX429896_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JX661494_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774246_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JX026887_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ386633_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KJ173299_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KJ173300_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KY470893_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ562302_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
LC458432_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
LC279263_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
LC279264_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
LC279265_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
LC279266_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
LC279267_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GQ377544_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GQ377581_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GQ377516_PreC_P-RF-CB      aggcaactttttcac---------ctctgcctaatcatct---catgttc
GQ377520_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GQ377534_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774294_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MG893561_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KJ173325_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KJ173326_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ787446_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ787480_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KR013816_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JQ040175_PreC_P-RF-CB      atgcaaatttttcac---------ctctgcctaatcatct---catgttc
KC774183_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774186_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AY167095_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB367400_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MK321265_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MK720627_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MK720628_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774230_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774258_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KJ173320_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KJ173322_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ386578_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ386585_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ386649_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774324_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963990_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963991_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963993_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963994_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963995_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963998_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963999_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU964001_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU964003_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KJ173329_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KJ173330_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774317_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774322_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KJ173350_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GQ377548_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774328_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HQ700554_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KJ803827_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MH368022_PreC_P-RF-GC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ023665_PreC_P-RF-GC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ882613_PreC_P-RF-GC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ882617_PreC_P-RF-GC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU833891_PreC_P-RF-GC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ882612_PreC_P-RF-GC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ882618_PreC_P-RF-GC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ023666_PreC_P-RF-GC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ882611_PreC_P-RF-GC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ882610_PreC_P-RF-GC      atgcacctttttcac---------ctctgcctaatcatct---catgttc
FJ882614_PreC_P-RF-GC      atgcamctttttcac---------ctctgcctaatcatct---catgttc
FJ023664_PreC_P-RF-GC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ023667_PreC_P-RF-GC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ023673_PreC_P-RF-GC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ023670_PreC_P-RF-GC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ023659_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FR714496_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KP148442_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MH746811_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FR714490_PreC_P-RF-GB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC172106_PreC_P-RF-GB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MG826145_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MH746813_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MH746812_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HQ700520_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ386643_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cwtgttc
KR013948_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KU576102_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU576103_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB105172_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AP011103_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AP011102_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB493842_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB493840_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GQ358155_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB493837_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GQ358156_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB493838_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB493847_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU695742_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KJ598675_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU679945_PreC_P-RF-CB      aygcaactttttcac---------ctctgcctaatcatct---cttgttc
KF873537_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KF873540_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KF873542_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KF873538_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KF873543_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU576384_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
EU589339_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
DQ089798_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GQ475335_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ562317_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KF873533_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KF873534_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KF873531_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KF873532_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU679940_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KF873535_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU679939_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AP011108_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HQ700509_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HQ700507_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctgatcatct---catgttc
HQ700508_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU695744_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU695746_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU695741_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU695743_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HQ700505_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU679956_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KF873527_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU679954_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU679942_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU679943_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---cmtgttc
KU695745_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HQ700557_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HQ700542_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HQ700462_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
HQ700485_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
X75656_PreC_P-RF-CB        atgcaactttttcac---------ctctgcctaatcatct---catgttc
HQ700498_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HQ700499_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HQ700560_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU679958_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catrttc
HQ700518_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HQ700527_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HQ700528_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HQ700523_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HQ700530_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HQ700531_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HQ700532_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HQ700519_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HQ700521_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KF873521_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU679955_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU679950_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KF873522_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KF873523_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KF873524_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU679941_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU679946_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU679944_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU679948_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU679953_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KF873519_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KF873517_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KF873518_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KF873515_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KF873511_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KF873513_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KY363272_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KY363273_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ361772_PreC_P-RF-GC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MG826141_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MG826142_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KX660686_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ386646_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
EU939668_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KT003704_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KP148352_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AP011104_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AP011105_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
LC416040_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KJ803788_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HQ700526_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ386635_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU939577_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GU385774_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JX661486_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctagtcatct---cttgttc
FJ562314_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MG893559_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JQ040142_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JQ040148_PreC_P-RF-CB      atgcaaatttttcac---------ctctgcctaatcatct---catgttc
GQ377635_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JX661485_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MG893554_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MG893555_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU717211_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KY363262_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KY363263_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JX504540_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AB367419_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB300369_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
Y18856_PreC_P-RF-CB        atgcaaatttttcac---------ctctgcctaatcatct---catgttc
KJ803772_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ386586_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU939547_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KJ803778_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU939551_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KY470845_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KY470848_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KY470851_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KY470852_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KY470853_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KY470844_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KY470843_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KY470846_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KY470847_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KY470849_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KY470850_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KY470855_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KY470854_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KY470856_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KJ410506_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JF436923_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JN104438_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JN104442_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB031265_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MF925389_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JQ801477_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JN664935_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MF925381_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KJ803753_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JQ801476_PreC_P-RF-CG      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MF925370_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU964351_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KX660685_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU964366_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KU964367_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KU964370_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KU964372_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KU964374_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KU964379_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KU964380_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AB205152_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KX096713_PreC_P-RF-CA      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KY670781_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774234_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU916232_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU964315_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU964308_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU964010_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU964005_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU964007_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU964008_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU964009_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU964303_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU964304_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU964305_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU964306_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU964307_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU964309_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU964310_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU964311_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU964312_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU964313_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU964314_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU964316_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU964317_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU964006_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MG826144_PreC_P-RF-CB      atgcaactttttcac---------ctttgcctaatcatct---catgttc
KX765835_PreC_P-RF-GC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AY206374_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB367800_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MG826149_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774305_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB670303_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774193_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774291_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774307_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774449_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HQ684849_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ562263_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KT991424_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KT991427_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KR013843_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774485_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KJ803804_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU939606_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774198_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774201_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB033557_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KY629632_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KP276253_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774482_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
HM750148_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AY057948_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KX660689_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KX660684_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AY817511_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KX354997_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HM750144_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HM750142_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
DQ478890_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KP276256_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HM750150_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HM750147_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HM750145_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ349241_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774456_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HM750143_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HM750149_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HM750146_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JX661487_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctagtcatct---cttgttc
EU881995_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB049609_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ715347_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ715345_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ715346_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963883_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HQ700547_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GQ377560_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774490_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KX660682_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774497_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774489_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774487_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774479_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774475_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774499_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774480_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774495_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774484_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774494_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774498_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774492_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774488_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774493_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774478_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774483_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
EU787435_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU522070_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB674504_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GQ924618_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MG826148_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU519423_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774453_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774212_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JQ040174_PreC_P-RF-CB      atgcaaatttttcac---------ctctgcctaatcatct---catgttc
AY040627_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774481_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctagtcatct---catgttc
JQ732168_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ562226_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774263_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774332_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774341_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KT991420_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ562278_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KT991417_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KT991423_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KT991419_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JF491451_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JF491455_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KX660674_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KX660680_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
Y18857_PreC_P-RF-CB        atgcaaatttttcac---------ctctgcctagtcatct---catgttc
MH094410_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcattt---catgttc
GQ377611_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GQ377522_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JF828933_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JF828934_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JF828935_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JF828936_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JF828938_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
DQ478886_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KJ410520_PreC_P-RF-CB      atgcaactttttcac---------ctcggcataatcatct---catgttc
EU919166_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
EU919167_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774486_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctagtcatct---catgttc
JQ707714_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JF436922_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774476_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctagtcatct---catgttc
KC774222_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774178_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctagtcatct---cttgttc
DQ478898_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB270535_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774364_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774428_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774461_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774442_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774432_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JN400086_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
HM750133_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GQ377607_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ386581_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB195950_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AB195951_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AY817509_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774447_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ562294_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU916239_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU916241_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU916240_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774455_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774452_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774435_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774420_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774443_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774422_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963856_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963857_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963858_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963859_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963860_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963861_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963863_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963864_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963865_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963866_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963867_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963868_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963869_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963870_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU963862_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KF917451_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774470_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774454_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774439_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774434_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
GQ377630_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU835240_PreC_P-RF-GC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AY862865_PreC_P-RF-DC      atgcttctttttcac---------ctctgcctaatcatct---catgttc
AY862864_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AY862866_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AF330110_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774430_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774431_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KX660677_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KX660675_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KT991421_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KP276255_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KP276254_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774468_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774466_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774463_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774349_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774344_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JX429898_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JF491449_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
EU787434_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
DQ478892_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
DQ478889_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
DQ144601_PreC_P-RF-BC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AY817512_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774474_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774458_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774425_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ715413_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcattt---catgttc
FJ715387_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ715384_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AY247030_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ715385_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ715411_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ715412_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ715414_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AY123041_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774457_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AY800249_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774426_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AY817515_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KJ173349_PreC_P-RF-CB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774471_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
DQ478897_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774433_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774472_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AY817510_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
DQ478887_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JF491448_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JF491456_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774423_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774424_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KC774448_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KU519422_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AY817513_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
AY230115_PreC_P-RF-DA      -------tttttcac---------ctctgcctaatcatct---cttgttc
GQ161806_PreC_P-RF-EA      atgcaactttttcac---------ctctgcctaatcatct---cttgtac
JF440017_PreC_P-RF-DA      atgcaactttttnnn---------nnntgcctaatcatct---catgttc
X68292_PreC_P-RF-DA        atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AB453985_PreC_P-RF-AC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MF925386_PreC_P-RF-AC      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AB330368_PreC_P-RF-DA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AB222708_PreC_P-RF-AD      atgcaactttttcac---------ctctgcctaatcatct---cttgtac
EF494376_PreC_P-RF-CA      atgcaactttttcac---------ctctgcctaatcatct---cttgtac
AF297619_PreC_P-RF-DA      atgcaactttttcac---------ctctgcctaatcatct---cttgtac
AF297620_PreC_P-RF-DA      atgcaactttttcac---------ctctgcctaatcatct---cttgtac
JN664933_PreC_P-RF-DA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JN664946_PreC_P-RF-DA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MF488705_PreC_P-RF-AD      atgcaactttttcac---------ctccgcctaatcatct---tttgttc
AB194949_PreC_P-RF-AE      atgcaactttttcac---------ctctgcctaatcatct---cttgtac
HM146131_PreC_P-RF-AD      atgcaactttttcac---------ctctgcctaatcgtct---cttgtac
GQ331048_PreC_P-RF-AE      atgcaactttttcac---------ctctgcctaatcatct---cttgtac
AY161147_PreC_P-RF-DA      atgcaactttttcac---------ctctgcctaatcatct---cttgtac
KJ586810_PreC_P-RF-AF      atgcaactttttcac---------ctctgcctaatcatct---cttgtac
KF214656_PreC_P-RF-AC      atgcaactttttccc---------ctctgcctaatcatct---caagttc
AY233277_PreC_P-RF-AC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MF925404_PreC_P-RF-AC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ349221_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AB674412_PreC_P-RF-DE      atgtaactttttcac---------ctctgcctaatcatct---cttgttc
JN664943_PreC_P-RF-DE      atggaactttttcac---------ctctgcctaatcatct---tttgttc
KU668440_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctagaattct---cttgttc
JN664934_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---tctgttc
JN664929_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---tttgttc
GQ205379_PreC_P-RF-DE      atgcaactttttgac---------ctctgcttaatcatct---tttgttc
AB033558_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---tttgttc
DQ315780_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---tttgttc
KT366505_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---tttgttc
DQ315779_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---tttgttc
JN664940_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---tttgttc
MK516279_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---tttgttc
MK516280_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---tttgttc
MK541689_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---tttgttc
JN664915_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JN664925_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
GQ205377_PreC_P-RF-DE      atgcaactttttgac---------ctctgcctaatcatct---tttgttc
KC875338_PreC_P-RF-DE      atgcaactttttgac---------ctctgcctaatcatct---tttgttc
KC875339_PreC_P-RF-DE      atgcaactttttgac---------ctctgcctaatcatct---tttgttc
GQ205378_PreC_P-RF-DE      atgcaactttttgac---------ctctgcctaatcatct---tttgttc
GQ205387_PreC_P-RF-DE      atgcaactttttgac---------ctctgcctaatcatct---tttgttc
DQ464167_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
DQ464164_PreC_P-RF-DE      atgcaactttttcac---------ctttgcgcaatcatct---cttgttc
DQ464165_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
DQ464166_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JN040803_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JF754613_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MF925401_PreC_P-RF-DB      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MF925396_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MF925360_PreC_P-RF-DB      atgcaactttttcac---------ctctgcctaatcatct---tttgttc
EF103283_PreC_P-RF-AD      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
EF103282_PreC_P-RF-AD      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KM524357_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KT366503_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KR905422_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MF925402_PreC_P-RF-BD      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MF925392_PreC_P-RF-DB      atgcaactttttcac---------ctctgcctaatcatct---tttgttc
MF925371_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MF925388_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JN257154_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ562223_PreC_P-RF-CD      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AB674436_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AB674434_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JN642127_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JN642141_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JN642152_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MF925397_PreC_P-RF-DC      atgcaactttttcac---------ctctgcctaatcatct---catgttc
MF925384_PreC_P-RF-DB      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AY161145_PreC_P-RF-AD      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AY161146_PreC_P-RF-AD      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
GQ377627_PreC_P-RF-CD      ctgcaactttttcac---------ctctgcctaatcatct---cttgttc
AY161140_PreC_P-RF-AD      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AY161141_PreC_P-RF-AD      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JN642160_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JN642137_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KF471643_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JN257174_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JN040798_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JN257210_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaktcatct---cttgttc
JF754616_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JN257191_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JN257216_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JN257206_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JN257207_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JN642139_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AB674432_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AB674433_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JN257164_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JN257189_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JN688689_PreC_P-RF-DE      atgcaacattttcac---------ctctgcctaatcatct---cttgttc
AB270538_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgtcc
MK052976_PreC_P-RF-BD      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KJ647349_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KJ470898_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KJ470897_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
HQ700494_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctagtcatct---cttgttc
KF192835_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KF192836_PreC_P-RF-DE      atgcaactttttcaa---------ctctgcctaatcatct---tttgttc
KF192838_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KF192837_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KF192839_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KF192841_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MF618347_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KF192840_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KF192833_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MF618346_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KJ470891_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KJ470892_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KJ470888_PreC_P-RF-DE      aggcaactttttcac---------ctctgcctaatcatct---cttgttc
KJ470890_PreC_P-RF-DE      aggcaactttttcac---------ctctgcctaatcatct---cttgttc
KJ470884_PreC_P-RF-DE      aggcaactttttcac---------ctctgcctaatcatct---cttgttc
KJ470886_PreC_P-RF-DE      aggcaactttttcac---------ctctgcctaatcatct---cttgttc
KJ470887_PreC_P-RF-DE      aggcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ692536_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
HQ700579_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
HQ700585_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
HQ700493_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---ctcgttc
HQ700492_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AB048702_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AB048703_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MH481862_PreC_P-RF-DE      atccaactttttcac---------ctctgcctaatcatctacgttgcttc
MH481860_PreC_P-RF-DE      gcccaaatttttcac---------ctctgcctaatcatct---cttgttc
MH481859_PreC_P-RF-DE      atgcaaatttttcac---------ctctgcctaatcatct---cttgttc
MH481858_PreC_P-RF-DE      gcccaaatttttcac---------ctctgcctaatcatct---cttgttc
MH481861_PreC_P-RF-DE      gcccaaatttttcac---------ctctgcctaatcatct---cttgttc
J02202_PreC_P-RF-DE        ggggggctttttcac---------ctctgcctaatcatct---cttgttc
HQ700534_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
HQ700533_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
HQ700536_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
HQ700541_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
HQ700581_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
HQ700582_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
HQ700503_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
HQ700583_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
HQ700584_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
HQ700497_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
HQ700501_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
HQ700524_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
HQ700525_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AB033559_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
HQ700535_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
HQ700537_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
HQ700538_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
HQ700539_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
HQ700540_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
HQ700500_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JN688717_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KJ647356_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---catgttc
JN688715_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KJ647351_PreC_P-RF-DE      attcaactttttcac---------ctctgcctaatcatct---cttgttc
KM359442_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KJ586811_PreC_P-RF-DF      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KM577666_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MF488702_PreC_P-RF-DE      atgcgactttttcac---------ctctgcctaatcatct---cttgtgc
KF679991_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MH724243_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MN507835_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
X65259_PreC_P-RF-DA        atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JN257204_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctgatcatct---cttgttc
MH724240_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MH724239_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KX827302_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AY341335_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AJ627221_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctagtcatct---cttgttc
JQ687532_PreC_P-RF-DE      atgcaattttttcac---------ctctgcctaatcatct---cttgttc
X80925_PreC_P-RF-DE        atgcaactttttcac---------ctctgcctaatcatct---cttgttc
EF103284_PreC_P-RF-AD      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MH464835_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC774450_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---catgttc
FJ349212_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AB188243_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AB188245_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KM577667_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
EU594406_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cgtgttc
AB210819_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KM386676_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KM577665_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AJ627217_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MK598656_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MK598654_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
DQ111987_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
EU594435_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MK618439_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
EU594436_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JF440012_PreC_P-RF-DE      atgcaactttttgaagagcatgagctctccggaa------------gggc
JF440007_PreC_P-RF-DE      atgcaactttttgaagagcatgagctctccggaa------------gggc
JF439999_PreC_P-RF-DE      atgcaattttttgaagagcatgagctctccggaa------------gggc
JF440004_PreC_P-RF-DE      atgcaactttttgaagagcatgagctctccggaa------------gggc
JF440005_PreC_P-RF-DE      atgcaactttttgaagagcatgagctctccggaa------------gggc
JF440013_PreC_P-RF-DE      atgcaactttttgaagagcatgagctctccggaa------------gggc
JF440001_PreC_P-RF-DE      atgcaactttttgaagagcatgagctctccggaa------------gggc
JF439996_PreC_P-RF-DE      atgcaactttttgaagagcatgagctctccggaa------------gggc
JF439998_PreC_P-RF-DE      atgcaactttttgaagagcatgagctctccggaa------------gggc
JF439995_PreC_P-RF-DE      atgcaactttttgaagagcatgagctctccggaa------------gggc
JF440000_PreC_P-RF-DE      atgcaactttttgaagagcatgagctctccggaa------------gggc
JF440006_PreC_P-RF-DE      atgcaactttttgaagagcatgagctctccggaa------------gggc
JF440008_PreC_P-RF-DE      atgcaactttttgaagagcatgagctctccggaa------------gggc
JF440009_PreC_P-RF-DE      atgcaactttttgaagagcatgagctctccggaa------------gggc
JF440010_PreC_P-RF-DE      atgcaactttttgaagagcatgagctctccggaa------------gggc
JF440014_PreC_P-RF-DE      atgcaactttttgaagagcatgagctctccggaa------------gggc
JF440015_PreC_P-RF-DE      atgcaactttttgaagagcatgagctctccggaa------------gggc
JF440003_PreC_P-RF-DE      gtgcaactttttgaagagcatgagctctccggaa------------gggc
AY373430_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KM524359_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KT366492_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
GQ183486_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MH724222_PreC_P-RF-DE      atgcaactttttgac---------ctctgcctaatcatct---cttgttc
AY236161_PreC_P-RF-DA      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JF440002_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JF440011_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
EU185780_PreC_P-RF-AD      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KC012653_PreC_P-RF-AD      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MF967563_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MK618438_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MK618440_PreC_P-RF-DE      atgcacctttttcac---------ctctgcctaatcatct---cttgttc
MK618444_PreC_P-RF-DE      atgcacctttttcac---------ctctgcctaatcatct---cttgttc
U95551_PreC_P-RF-DE        atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JX898690_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AJ344117_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JX898686_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JX898693_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JX898695_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JX898696_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JX898698_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JX898699_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MK618442_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MK618445_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JX898687_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
JX898688_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MK598652_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MK598653_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
DQ315777_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KM524337_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KM524336_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
LK995391_PreC_P-RF-ED      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AB583679_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KM577663_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KM577664_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MN507850_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
EF103285_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KT366504_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AY233293_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AY233295_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
GU563560_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MH464846_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MH464852_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MH464851_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ904409_PreC_P-RF-DE      ttgcaactttttcac---------ctctgcctaatcatct---cttgtac
FJ904405_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FN594767_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ904436_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MK052957_PreC_P-RF-DE      atgcaactttttcac---------ctctgcataatcatct---cttgttc
MK052969_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---catgttc
KP168421_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ904430_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ904414_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ904408_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ904416_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ904417_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ349207_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ904407_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ904425_PreC_P-RF-DE      attcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ904400_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaaccatct---cttgttc
DQ991753_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
GQ161788_PreC_P-RF-AE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ904394_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FN594769_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KX357628_PreC_P-RF-DE      attcaactttttcac---------ctctgcctaatcatct---cttgttc
GQ161753_PreC_P-RF-AE      atgcaactttttcac---------ctctgcctaatcatct---cttgtac
FJ904398_PreC_P-RF-DE      attcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ904396_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcacct---cttgttc
FJ904440_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
GQ161767_PreC_P-RF-AE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
HF571060_PreC_P-RF-AE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
GQ161837_PreC_P-RF-AE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
GQ161838_PreC_P-RF-AE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KP168420_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ904444_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ904428_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KX357627_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KX357631_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ904404_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ904442_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cctgttc
KX357632_PreC_P-RF-DE      ctgcaactttttcac---------ctctgcctaatcatct---cttgttc
KX357626_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ904441_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcacct---cttgttc
KU711666_PreC_P-RF-DE      atgcaactttttgaa---------gagctcaaaatcatct---cttgttc
FJ904397_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cctgttc
FJ904437_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ904401_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KU736921_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KU736922_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KP288875_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ904447_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KP168416_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ904403_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KP168417_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KP168418_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
MH685719_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KX357630_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KX357634_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KX357624_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KX357633_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KX357635_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KX357623_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KX357625_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KX357629_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KX357641_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KU736916_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KU736915_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KU736923_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KU736914_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KU736917_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FJ904406_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
AM494716_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cgtgttc
GU177079_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FN594771_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
FN594770_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
GQ161754_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KM606741_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KX357636_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KF170740_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KX827299_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KM606750_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KP995112_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
KM606751_PreC_P-RF-DE      atgcaactttttcac---------ctctgcctaatcatct---cttgttc
                                                                            *

KF219922_PreC_P-RF-GH      atgtcctactgttcaaggctccaagatgtgccttgggtggctttagggcc
JQ272886_PreC_P-RF-GF      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
HE981179_PreC_P-RF-FG      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HE981180_PreC_P-RF-GF      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JQ272887_PreC_P-RF-GF      atgtcctattgtccaagcctccaagctgtgccttgggtggctttagggca
KJ586803_PreC_P-RF-AF      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MF488699_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU833890_PreC_P-RF-GA      atgtcctactgttcaagcctccaagctgtgcctggggtggctttagggca
AB933283_PreC_P-RF-AG      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
JF440019_PreC_P-RF-AG      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
JF440021_PreC_P-RF-AG      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
JF440022_PreC_P-RF-AG      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
AB933282_PreC_P-RF-AG      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
EU833889_PreC_P-RF-GA      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KP274926_PreC_P-RF-GA      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
EF464099_PreC_P-RF-AG      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
AB933281_PreC_P-RF-AG      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
AB933279_PreC_P-RF-AG      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
AB933280_PreC_P-RF-AG      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707468_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707426_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707424_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707459_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707473_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707465_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707464_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707463_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707461_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgggccttgggtggctttagggca
JQ707457_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707458_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707460_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707462_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707466_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707467_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707469_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707470_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707448_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707474_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707421_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707430_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707432_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707445_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707450_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707456_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707471_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707472_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707475_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707441_PreC_P-RF-GA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttagggca
KC774323_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KJ803771_PreC_P-RF-DB      atgtcctactgttcaagcctccgagctgtgccttgggtggctttagggca
KU679952_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
HQ700580_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
MF925382_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
EF494378_PreC_P-RF-CA      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KF873530_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JQ027310_PreC_P-RF-CB      acgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KJ803785_PreC_P-RF-CB      atgtcccactgttcaagcctccaagctgtgccttgggtggctttgggaca
MG826150_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
FJ032343_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
FJ386674_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
EU939623_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ377592_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
EU939620_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
FJ562328_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KJ803822_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU660227_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
EU939621_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KJ803791_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
GQ377604_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
EU882006_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ377556_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
EU939630_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
MG826151_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU939631_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
EU939632_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
FJ562229_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggca
KM213033_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KJ803798_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KJ803782_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MK052970_PreC_P-RF-BD      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KJ410497_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctgtggggca
GQ377595_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF436919_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ032337_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KJ803803_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
HQ684848_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
EU939627_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JX661498_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ377626_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ562247_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KC774414_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ377590_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KJ173279_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KJ173280_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ377594_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ377564_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ377539_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KJ173358_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MK052968_PreC_P-RF-BD      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ377614_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ377613_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
GQ377602_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ377573_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ377565_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MK052967_PreC_P-RF-BD      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ377634_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KP148337_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC315400_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KJ803802_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ377549_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ377596_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MG826146_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MG826147_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KY470865_PreC_P-RF-GC      atgtcctacttttcaagcctccaagctgtgccttgggtggctttagggca
KY470858_PreC_P-RF-GC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KY470871_PreC_P-RF-GC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
EU787444_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KF214680_PreC_P-RF-GC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
FJ562267_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
EU916228_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ562287_PreC_P-RF-CB      aagtcctactgttcaagccttcaaagtgtgccttggggggctttggggca
KX774505_PreC_P-RF-BC      atgtcttactgttcaagcctccaagctgtgccttgggtggctttgaggca
AB241109_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB014375_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
FJ562227_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
EU589337_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU576837_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KU577083_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AF461361_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ562277_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ562271_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
FJ386593_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963930_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963931_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963932_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963933_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963934_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963935_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963936_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963938_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963939_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963940_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963941_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963942_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963943_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963944_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ040130_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU939629_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB642096_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
EU939602_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU939589_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ377633_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU871994_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU871995_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU871991_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
EU871987_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctatgccttgggtggctttggggca
EU871985_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU871992_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU871993_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU871996_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU872014_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU872015_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU871981_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU871983_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU871986_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU871999_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU871984_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU871988_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU871989_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU871990_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KR013806_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
FJ562305_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AF411409_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
AB198084_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GU357843_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ562336_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU939565_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JQ040146_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU939581_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB195939_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB195940_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB195941_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB195955_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB195956_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB195957_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KM875422_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774188_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
AB367393_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU871997_PreC_P-RF-CB      atgtcctacggttcaagcctccaagctgtgccttgggtggctttggggca
AY123424_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KY881840_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
M38454_PreC_P-RF-CB        atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JX429896_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JX661494_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774246_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
JX026887_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ386633_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KJ173299_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KJ173300_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KY470893_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ562302_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
LC458432_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
LC279263_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
LC279264_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
LC279265_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
LC279266_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
LC279267_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ377544_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ377581_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ377516_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ377520_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ377534_PreC_P-RF-CB      atgtcctactgttcaagcctccaagttgtgccttgggtggctttggggca
KC774294_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MG893561_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KJ173325_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KJ173326_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ787446_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ787480_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KR013816_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JQ040175_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774183_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774186_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AY167095_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB367400_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MK321265_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MK720627_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MK720628_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774230_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KC774258_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KJ173320_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KJ173322_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ386578_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ386585_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ386649_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774324_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU963990_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU963991_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU963993_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU963994_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU963995_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU963998_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU963999_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964001_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964003_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KJ173329_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KJ173330_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774317_PreC_P-RF-CB      atgtcccactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774322_PreC_P-RF-CB      atgtcccactgttcaagcctccaagctgtgccttgggtggctttggggca
KJ173350_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ377548_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774328_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700554_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KJ803827_PreC_P-RF-BC      atgtcccactgttcaagcctccaagctgtgccttgggtggctttggggca
MH368022_PreC_P-RF-GC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
FJ023665_PreC_P-RF-GC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
FJ882613_PreC_P-RF-GC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ882617_PreC_P-RF-GC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggca
EU833891_PreC_P-RF-GC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ882612_PreC_P-RF-GC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ882618_PreC_P-RF-GC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ023666_PreC_P-RF-GC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
FJ882611_PreC_P-RF-GC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ882610_PreC_P-RF-GC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ882614_PreC_P-RF-GC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ023664_PreC_P-RF-GC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ023667_PreC_P-RF-GC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ023673_PreC_P-RF-GC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ023670_PreC_P-RF-GC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ023659_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FR714496_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KP148442_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MH746811_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FR714490_PreC_P-RF-GB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC172106_PreC_P-RF-GB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MG826145_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MH746813_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MH746812_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700520_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ386643_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
KR013948_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU576102_PreC_P-RF-CB      atgtcctactattcaagcctccaagctgtgccttgggtggctttggggca
KU576103_PreC_P-RF-CB      atgtcctactattcaagcctccaagctgtgccttgggtggctttggggca
AB105172_PreC_P-RF-CB      atgtcccactgttcaagcctccaagctgtgccttgggtggctttggggca
AP011103_PreC_P-RF-CB      atgtcctattgttcaagcctccaagctgtgccttgggtggctttggggca
AP011102_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB493842_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB493840_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ358155_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB493837_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ358156_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB493838_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB493847_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU695742_PreC_P-RF-CB      atgtcctactattcaagcctccaagctgtgccttgggtggctttggggca
KJ598675_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU679945_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KF873537_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KF873540_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KF873542_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KF873538_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
KF873543_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU576384_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
EU589339_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
DQ089798_PreC_P-RF-CB      atgtcctactgttcaagcctcctagctgtgccttgggtggctttagggca
GQ475335_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
FJ562317_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KF873533_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttggatggctttrgggca
KF873534_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttggatggctttggggca
KF873531_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttggatggctttggggca
KF873532_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttggatggctttggggca
KU679940_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttggrtggctttrggrca
KF873535_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttggatggctttggggca
KU679939_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttggatggctttggggca
AP011108_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700509_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700507_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700508_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU695744_PreC_P-RF-CB      atgtcctattgttcaagcctccaagctgtgccttgggtggctttggggca
KU695746_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU695741_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU695743_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700505_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU679956_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggca
KF873527_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU679954_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggrca
KU679942_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU679943_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggrca
KU695745_PreC_P-RF-CB      atgtcctacygttcaagcctccaagctgtgccttgggtggctttggggca
HQ700557_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700542_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700462_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggrca
HQ700485_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
X75656_PreC_P-RF-CB        atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700498_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700499_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700560_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU679958_PreC_P-RF-CB      atgtcctactkttcaagcctccaagctgtgccttgggtggctttagggca
HQ700518_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700527_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700528_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700523_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700530_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700531_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700532_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700519_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700521_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KF873521_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU679955_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggca
KU679950_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KF873522_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggca
KF873523_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggca
KF873524_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU679941_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU679946_PreC_P-RF-BC      atgtcctactgttcaagcctccaagcagtgccttgagtggctttggggca
KU679944_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU679948_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU679953_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KF873519_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KF873517_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KF873518_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KF873515_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KF873511_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KF873513_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KY363272_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KY363273_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
FJ361772_PreC_P-RF-GC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
MG826141_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
MG826142_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KX660686_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
FJ386646_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
EU939668_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KT003704_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KP148352_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AP011104_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AP011105_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
LC416040_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KJ803788_PreC_P-RF-CB      atgtcccactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700526_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ386635_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
EU939577_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GU385774_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
JX661486_PreC_P-RF-CB      atgtcctactgtgtactggagggagctgtgccttgggtggctttggggca
FJ562314_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MG893559_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JQ040142_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ040148_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtsccttgggtggctttggggca
GQ377635_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JX661485_PreC_P-RF-CB      atgtcctactgttcaaggcctccagctgtgccttgggtggctttggggca
MG893554_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MG893555_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU717211_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KY363262_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KY363263_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JX504540_PreC_P-RF-CB      acgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
AB367419_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
AB300369_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
Y18856_PreC_P-RF-CB        atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KJ803772_PreC_P-RF-BC      atgtcccactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ386586_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
EU939547_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KJ803778_PreC_P-RF-BC      atgtcccactgttcaagcctccaagctgtgccttgggtggctttggggca
EU939551_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KY470845_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KY470848_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KY470851_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KY470852_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KY470853_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KY470844_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
KY470843_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
KY470846_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
KY470847_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
KY470849_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
KY470850_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
KY470855_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
KY470854_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
KY470856_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
KJ410506_PreC_P-RF-CB      atgttccactgttcaagcctccaagctgtgccttgggtggctttggggca
JF436923_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JN104438_PreC_P-RF-CB      atgttccactgttcaagcctccaagctgtgccttgggtggctttggggca
JN104442_PreC_P-RF-CB      atgttccactgttcaagcctccaagctgtgccttgggtggctttggggca
AB031265_PreC_P-RF-CB      atgtcccactgttcaagcctccaagctgtgccttgggtggctttggggca
MF925389_PreC_P-RF-DC      atgtcccactgttcaagcctccaagctgtgccttgggtggctttggggca
JQ801477_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JN664935_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
MF925381_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KJ803753_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JQ801476_PreC_P-RF-CG      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MF925370_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964351_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KX660685_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964366_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964367_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964370_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964372_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964374_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964379_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964380_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB205152_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KX096713_PreC_P-RF-CA      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KY670781_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774234_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU916232_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964315_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964308_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964010_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964005_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964007_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964008_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964009_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964303_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964304_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964305_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964306_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964307_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964309_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964310_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964311_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964312_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964313_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964314_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964316_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964317_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU964006_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MG826144_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KX765835_PreC_P-RF-GC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
AY206374_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB367800_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MG826149_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KC774305_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB670303_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774193_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KC774291_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KC774307_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KC774449_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ684849_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
FJ562263_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KT991424_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KT991427_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KR013843_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KC774485_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KJ803804_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU939606_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774198_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774201_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB033557_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KY629632_PreC_P-RF-DC      atgtcctactrttcaagcctccaagctgtgccttgggtggctttagggca
KP276253_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774482_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
HM750148_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AY057948_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KX660689_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KX660684_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AY817511_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KX354997_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HM750144_PreC_P-RF-DC      atgtcctactgttcaagcctccaagcagtgccttgggtggctttggggca
HM750142_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
DQ478890_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KP276256_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HM750150_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HM750147_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HM750145_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ349241_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774456_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HM750143_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HM750149_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HM750146_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JX661487_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU881995_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
AB049609_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
FJ715347_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ715345_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ715346_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU963883_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
HQ700547_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ377560_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774490_PreC_P-RF-DC      atgtcctactgttcaagcccccaagctgtgccttgggtggctttggggca
KX660682_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774497_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
KC774489_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774487_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
KC774479_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774475_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KC774499_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774480_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774495_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774484_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774494_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774498_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KC774492_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
KC774488_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KC774493_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KC774478_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KC774483_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
EU787435_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU522070_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB674504_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ924618_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MG826148_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU519423_PreC_P-RF-DC      atgtcccactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774453_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774212_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JQ040174_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AY040627_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774481_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ732168_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ562226_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KC774263_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KC774332_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774341_PreC_P-RF-CB      atgtcccactgttcaagcctccaagctgtgccttgggtggctttggggca
KT991420_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ562278_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KT991417_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KT991423_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KT991419_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF491451_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF491455_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KX660674_PreC_P-RF-DC      atgtcctactrttcaagcctccaagctgtgccttgggtggctttggggca
KX660680_PreC_P-RF-DC      atgtcctactrttcaagcctccaagctgtgccttgggtggctttggggca
Y18857_PreC_P-RF-CB        atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MH094410_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ377611_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ377522_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
JF828933_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF828934_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF828935_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF828936_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF828938_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
DQ478886_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KJ410520_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU919166_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
EU919167_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KC774486_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ707714_PreC_P-RF-CB      atgtcccactgttcaagcctccaagctgtgccttgggtggctttggggca
JF436922_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KC774476_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KC774222_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KC774178_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
DQ478898_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB270535_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KC774364_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774428_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KC774461_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774442_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774432_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
JN400086_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HM750133_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ377607_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
FJ386581_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB195950_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB195951_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AY817509_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774447_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ562294_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
EU916239_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU916241_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU916240_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774455_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774452_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774435_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KC774420_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KC774443_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KC774422_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963856_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963857_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963858_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963859_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963860_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963861_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963863_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963864_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963865_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963866_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963867_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963868_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963869_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963870_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU963862_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KF917451_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774470_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774454_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774439_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KC774434_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
GQ377630_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU835240_PreC_P-RF-GC      atgtcctactgttcaagcctccaagttgtgccttgggtggctttggggca
AY862865_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AY862864_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AY862866_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AF330110_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KC774430_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KC774431_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KX660677_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KX660675_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KT991421_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KP276255_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KP276254_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774468_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KC774466_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KC774463_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774349_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774344_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JX429898_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF491449_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU787434_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
DQ478892_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
DQ478889_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
DQ144601_PreC_P-RF-BC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AY817512_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774474_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KC774458_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774425_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ715413_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ715387_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ715384_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AY247030_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ715385_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ715411_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ715412_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ715414_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AY123041_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774457_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AY800249_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774426_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AY817515_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KJ173349_PreC_P-RF-CB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774471_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
DQ478897_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774433_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KC774472_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
AY817510_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
DQ478887_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF491448_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF491456_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774423_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774424_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC774448_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU519422_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AY817513_PreC_P-RF-DC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AY230115_PreC_P-RF-DA      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
GQ161806_PreC_P-RF-EA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttggggca
JF440017_PreC_P-RF-DA      atgtcccactcttcaagcctccaagctgtgccttgggtggctttggggca
X68292_PreC_P-RF-DA        atgtcccactgttcaagcctccaagctgtgccttgggtggctttggggca
AB453985_PreC_P-RF-AC      atgtcccactgttcaagcctccaagctgtgccttgggtggctttggggca
MF925386_PreC_P-RF-AC      atgtcccactgttcaagcctccaagctgtgccttgggtggctttggggca
AB330368_PreC_P-RF-DA      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB222708_PreC_P-RF-AD      atgtcccactgttcaagcctccaagctgtgccttgggtggctttggggca
EF494376_PreC_P-RF-CA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttggggca
AF297619_PreC_P-RF-DA      atgtccaactgttcaagcctccaagctgtgccttgggtggctttggggca
AF297620_PreC_P-RF-DA      atgtcccactgttcaagcctccaagctgtgccttgggtggctttggggca
JN664933_PreC_P-RF-DA      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JN664946_PreC_P-RF-DA      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
MF488705_PreC_P-RF-AD      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB194949_PreC_P-RF-AE      atgtcccacttttcaagcctccaagctgtgccttgggtggctttggggca
HM146131_PreC_P-RF-AD      atgtcccacttctcaagcctccaagctgtgccttggatggctttggggca
GQ331048_PreC_P-RF-AE      atgtcccactgttcaagcctccaagctgtgccttgggtggctttggggca
AY161147_PreC_P-RF-DA      atgtcccactgttcaagcctccaagctgtgccttggatggctttggggca
KJ586810_PreC_P-RF-AF      atgtcccacttttcaagcctccaagctgtgccttggatggctttggggca
KF214656_PreC_P-RF-AC      atgtcccactcttcaagcctccaagctgtgccttggatggctttggggca
AY233277_PreC_P-RF-AC      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MF925404_PreC_P-RF-AC      atgtcccactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ349221_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
AB674412_PreC_P-RF-DE      atgtcctacttttcaagcctccaagctgtgccttgggtggctttgggaca
JN664943_PreC_P-RF-DE      atgtcctactgttcaagtctccaagctgtgccttgggtggctttggggca
KU668440_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JN664934_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
JN664929_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ205379_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB033558_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
DQ315780_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KT366505_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
DQ315779_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JN664940_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MK516279_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MK516280_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MK541689_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
JN664915_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JN664925_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ205377_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC875338_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC875339_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ205378_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ205387_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
DQ464167_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
DQ464164_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
DQ464165_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
DQ464166_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
JN040803_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
JF754613_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
MF925401_PreC_P-RF-DB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MF925396_PreC_P-RF-DC      atgtcccactgttcaagcctccaagctgtgccttgggtggctttggggca
MF925360_PreC_P-RF-DB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
EF103283_PreC_P-RF-AD      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
EF103282_PreC_P-RF-AD      atgtcctactgttcaagcctccaagctgtgccttggatggctttggggca
KM524357_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KT366503_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KR905422_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MF925402_PreC_P-RF-BD      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
MF925392_PreC_P-RF-DB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MF925371_PreC_P-RF-DC      atgtcccactgttcaagcctccaagctgtgccttgggtggctttggggca
MF925388_PreC_P-RF-DC      atgtcccactgttcaagcctccaagctgtgccttgggtggctttggggca
JN257154_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
FJ562223_PreC_P-RF-CD      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
AB674436_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
AB674434_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JN642127_PreC_P-RF-DE      atgtcctacttttcaagcctccaagctgtgccttgggtggctttagggca
JN642141_PreC_P-RF-DE      atgtcctactgttccagcctccaagctgtgccttgggtggctttagggca
JN642152_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
MF925397_PreC_P-RF-DC      atgtcccactgttcaagcctccaagctgtgccttgggtggctttggggca
MF925384_PreC_P-RF-DB      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
AY161145_PreC_P-RF-AD      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AY161146_PreC_P-RF-AD      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ377627_PreC_P-RF-CD      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AY161140_PreC_P-RF-AD      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AY161141_PreC_P-RF-AD      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JN642160_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgaggca
JN642137_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KF471643_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
JN257174_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JN040798_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
JN257210_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
JF754616_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
JN257191_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggca
JN257216_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JN257206_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
JN257207_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
JN642139_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
AB674432_PreC_P-RF-DE      atgtcctactattcaagcctccaagctgtgccttgggtggctttagggca
AB674433_PreC_P-RF-DE      atgtcctactattcaagcctccaagctgtgccttgggtggctttagggca
JN257164_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
JN257189_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
JN688689_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggcggctttaggaca
AB270538_PreC_P-RF-DE      atgtcctactgttcaagccaccaagctgtgccttgagtggctttagggca
MK052976_PreC_P-RF-BD      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KJ647349_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KJ470898_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KJ470897_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
HQ700494_PreC_P-RF-DE      atgtcctacttttcaagcctccaagctgtgccttgggtggctttaggaca
KF192835_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KF192836_PreC_P-RF-DE      atgtactactgttcaagcctccaagctatgcattgggtggctttagggca
KF192838_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
KF192837_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KF192839_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KF192841_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MF618347_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KF192840_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KF192833_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MF618346_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KJ470891_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KJ470892_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KJ470888_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KJ470890_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KJ470884_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KJ470886_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KJ470887_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ692536_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700579_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
HQ700585_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
HQ700493_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
HQ700492_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
AB048702_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB048703_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
MH481862_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MH481860_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MH481859_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MH481858_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MH481861_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
J02202_PreC_P-RF-DE        atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
HQ700534_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
HQ700533_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
HQ700536_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
HQ700541_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700581_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700582_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700503_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700583_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700584_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700497_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700501_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700524_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700525_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB033559_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700535_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggca
HQ700537_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggca
HQ700538_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
HQ700539_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
HQ700540_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
HQ700500_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
JN688717_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KJ647356_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
JN688715_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KJ647351_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
KM359442_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KJ586811_PreC_P-RF-DF      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KM577666_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
MF488702_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgcctgaggtggatttggggca
KF679991_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
MH724243_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
MN507835_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
X65259_PreC_P-RF-DA        atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
JN257204_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
MH724240_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
MH724239_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KX827302_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
AY341335_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
AJ627221_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
JQ687532_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
X80925_PreC_P-RF-DE        atgtcctactgttcaagcctccaagctgtgcctcgggtggctttggggca
EF103284_PreC_P-RF-AD      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
MH464835_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KC774450_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ349212_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
AB188243_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
AB188245_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KM577667_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
EU594406_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB210819_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KM386676_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
KM577665_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
AJ627217_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
MK598656_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
MK598654_PreC_P-RF-DE      atgtcctactattcaagcctccaagctgtgccttgggtggctttggggca
DQ111987_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU594435_PreC_P-RF-DE      atgtcctactattcaagcctccaagctgtgccttgggtggctttggggca
MK618439_PreC_P-RF-DE      atgtcctactattcaagcctccaagctgtgccttgggtggctttggggca
EU594436_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF440012_PreC_P-RF-DE      gaatcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF440007_PreC_P-RF-DE      gaatcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF439999_PreC_P-RF-DE      gaatcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF440004_PreC_P-RF-DE      gaatcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF440005_PreC_P-RF-DE      gaatcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF440013_PreC_P-RF-DE      gaatcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF440001_PreC_P-RF-DE      gaatcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF439996_PreC_P-RF-DE      gaatcctactgttcaagcctccaagccgtgccttgggtggctttggggca
JF439998_PreC_P-RF-DE      gaatcctactgttcaagcctccaagccgtgccttgggtggctttggggca
JF439995_PreC_P-RF-DE      gaatcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF440000_PreC_P-RF-DE      gaatcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF440006_PreC_P-RF-DE      gaatcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF440008_PreC_P-RF-DE      gaatcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF440009_PreC_P-RF-DE      gaatcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF440010_PreC_P-RF-DE      gaatcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF440014_PreC_P-RF-DE      gaatcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF440015_PreC_P-RF-DE      gaatcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF440003_PreC_P-RF-DE      gaatcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AY373430_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KM524359_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KT366492_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ183486_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MH724222_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AY236161_PreC_P-RF-DA      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF440002_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JF440011_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EU185780_PreC_P-RF-AD      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KC012653_PreC_P-RF-AD      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MF967563_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MK618438_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MK618440_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MK618444_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
U95551_PreC_P-RF-DE        atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JX898690_PreC_P-RF-DE      atgtcctactgttcaagcctccaagttgtgccttgggtggctttggggca
AJ344117_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JX898686_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JX898693_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JX898695_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JX898696_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JX898698_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JX898699_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MK618442_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MK618445_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JX898687_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
JX898688_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MK598652_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MK598653_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
DQ315777_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KM524337_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KM524336_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
LK995391_PreC_P-RF-ED      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AB583679_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KM577663_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KM577664_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MN507850_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
EF103285_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KT366504_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AY233293_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
AY233295_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GU563560_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MH464846_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MH464852_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MH464851_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ904409_PreC_P-RF-DE      atgtcccactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ904405_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
FN594767_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggca
FJ904436_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
MK052957_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
MK052969_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KP168421_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
FJ904430_PreC_P-RF-DE      gtgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
FJ904414_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
FJ904408_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
FJ904416_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
FJ904417_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
FJ349207_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
FJ904407_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
FJ904425_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggca
FJ904400_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
DQ991753_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
GQ161788_PreC_P-RF-AE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
FJ904394_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
FN594769_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KX357628_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
GQ161753_PreC_P-RF-AE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ904398_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
FJ904396_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
FJ904440_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
GQ161767_PreC_P-RF-AE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
HF571060_PreC_P-RF-AE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ161837_PreC_P-RF-AE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
GQ161838_PreC_P-RF-AE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KP168420_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
FJ904444_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
FJ904428_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KX357627_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KX357631_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
FJ904404_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
FJ904442_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KX357632_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
KX357626_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
FJ904441_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KU711666_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
FJ904397_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
FJ904437_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
FJ904401_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KU736921_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU736922_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KP288875_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
FJ904447_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KP168416_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ904403_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KP168417_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KP168418_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
MH685719_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KX357630_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KX357634_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KX357624_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KX357633_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KX357635_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KX357623_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KX357625_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KX357629_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KX357641_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KU736916_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU736915_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
KU736923_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU736914_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KU736917_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FJ904406_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttaggaca
AM494716_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttgggaca
GU177079_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FN594771_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
FN594770_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggca
GQ161754_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KM606741_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KX357636_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttagggca
KF170740_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KX827299_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KM606750_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KP995112_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
KM606751_PreC_P-RF-DE      atgtcctactgttcaagcctccaagctgtgccttgggtggctttggggca
                              *   *               *      * *     ** * *  * * 

KF219922_PreC_P-RF-GH      tggaywgmamaacttgcccatattgcctttttggcttagacattgaccct
JQ272886_PreC_P-RF-GF      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
HE981179_PreC_P-RF-FG      tg------------------------------------gacattgaccct
HE981180_PreC_P-RF-GF      tg------------------------------------gacattgaccct
JQ272887_PreC_P-RF-GF      tggatagcacaactttgccatatggcctttttggcttagacattgaccct
KJ586803_PreC_P-RF-AF      tg------------------------------------gacattgaccct
MF488699_PreC_P-RF-DE      tg------------------------------------gaccttgaccct
EU833890_PreC_P-RF-GA      tggatagaataactttgccgtatggcttttttggcttagacattgaccct
AB933283_PreC_P-RF-AG      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JF440019_PreC_P-RF-AG      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JF440021_PreC_P-RF-AG      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JF440022_PreC_P-RF-AG      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
AB933282_PreC_P-RF-AG      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
EU833889_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
KP274926_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
EF464099_PreC_P-RF-AG      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
AB933281_PreC_P-RF-AG      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
AB933279_PreC_P-RF-AG      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
AB933280_PreC_P-RF-AG      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707468_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707426_PreC_P-RF-GA      tggatagaataactttgccatatggccttcttggcttagacattgaccct
JQ707424_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707459_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707473_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgactct
JQ707465_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707464_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707463_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707461_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707457_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707458_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707460_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707462_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707466_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707467_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707469_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707470_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707448_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707474_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707421_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707430_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707432_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707445_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707450_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707456_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707471_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707472_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707475_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
JQ707441_PreC_P-RF-GA      tggatagaacaactttgccatatggcctttttggcttagacattgaccct
KC774323_PreC_P-RF-CB      tg------------------------------------gacattgacacg
KJ803771_PreC_P-RF-DB      tg------------------------------------gacattgacccg
KU679952_PreC_P-RF-CB      tg------------------------------------gacatygaccct
HQ700580_PreC_P-RF-CB      tg------------------------------------gacattgaccct
MF925382_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EF494378_PreC_P-RF-CA      tg------------------------------------gacattgacccg
KF873530_PreC_P-RF-CB      tg------------------------------------gacattgaccct
JQ027310_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KJ803785_PreC_P-RF-CB      tg------------------------------------gacattgacccg
MG826150_PreC_P-RF-BC      tg------------------------------------gacattgacccg
FJ032343_PreC_P-RF-CB      tg------------------------------------gacatcgacccg
FJ386674_PreC_P-RF-BC      tg------------------------------------gacatcgacccg
EU939623_PreC_P-RF-CB      tg------------------------------------gacattgacacg
GQ377592_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU939620_PreC_P-RF-CB      tg------------------------------------gacattgacacg
FJ562328_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KJ803822_PreC_P-RF-CB      tg------------------------------------gacattgacacc
EU660227_PreC_P-RF-BC      tg------------------------------------gacattgacccg
EU939621_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KJ803791_PreC_P-RF-CB      tg------------------------------------gacattgacccg
GQ377604_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU882006_PreC_P-RF-CB      tg------------------------------------gacattgacccg
GQ377556_PreC_P-RF-CB      tg------------------------------------gacattgacacg
EU939630_PreC_P-RF-CB      tg------------------------------------gacattgacacg
MG826151_PreC_P-RF-BC      tg------------------------------------gacattgacccg
EU939631_PreC_P-RF-BC      tg------------------------------------gacattgacccg
EU939632_PreC_P-RF-CB      tg------------------------------------gacattgacacg
FJ562229_PreC_P-RF-CB      tg------------------------------------gacattgacacg
KM213033_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KJ803798_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KJ803782_PreC_P-RF-CB      tg------------------------------------gacattgacccg
MK052970_PreC_P-RF-BD      tg------------------------------------gacattgaccct
KJ410497_PreC_P-RF-BC      tg------------------------------------gacattgacacg
GQ377595_PreC_P-RF-BC      tg------------------------------------gacattgacccg
JF436919_PreC_P-RF-CB      tg------------------------------------gacattgacccg
FJ032337_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KJ803803_PreC_P-RF-CB      tg------------------------------------gacattgacccg
HQ684848_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU939627_PreC_P-RF-BC      tg------------------------------------gacattgacmcg
JX661498_PreC_P-RF-CB      tg------------------------------------gacattgacccg
GQ377626_PreC_P-RF-CB      tg------------------------------------gacattgacccg
FJ562247_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774414_PreC_P-RF-BC      tg------------------------------------gacattgacccg
GQ377590_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KJ173279_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KJ173280_PreC_P-RF-CB      tg------------------------------------gacattgacccg
GQ377594_PreC_P-RF-CB      tg------------------------------------gacattgacccg
GQ377564_PreC_P-RF-CB      tg------------------------------------gacattgacccg
GQ377539_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KJ173358_PreC_P-RF-CB      tg------------------------------------gacattgacccg
MK052968_PreC_P-RF-BD      tg------------------------------------gacattgacccg
GQ377614_PreC_P-RF-CB      tg------------------------------------gacattgacccg
GQ377613_PreC_P-RF-CB      tg------------------------------------gacattgacccg
GQ377602_PreC_P-RF-CB      tg------------------------------------gacattgacccg
GQ377573_PreC_P-RF-CB      tg------------------------------------gacattgacccg
GQ377565_PreC_P-RF-CB      tg------------------------------------gacattgacccg
MK052967_PreC_P-RF-BD      tg------------------------------------gacattgacccg
GQ377634_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KP148337_PreC_P-RF-BC      tg------------------------------------gacattgacccg
KC315400_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KJ803802_PreC_P-RF-CB      tg------------------------------------gacattgacccg
GQ377549_PreC_P-RF-CB      tg------------------------------------gacattgacccg
GQ377596_PreC_P-RF-CB      tg------------------------------------gacattgacccg
MG826146_PreC_P-RF-CB      tg------------------------------------gacattgacccg
MG826147_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KY470865_PreC_P-RF-GC      tg------------------------------------gacattgaccct
KY470858_PreC_P-RF-GC      tg------------------------------------gacattgaccct
KY470871_PreC_P-RF-GC      tg------------------------------------gacattgaccct
EU787444_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KF214680_PreC_P-RF-GC      tg------------------------------------gacattgaccct
FJ562267_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU916228_PreC_P-RF-CB      tg------------------------------------gacattgacacc
FJ562287_PreC_P-RF-CB      tg------------------------------------ggccttgacccg
KX774505_PreC_P-RF-BC      tg------------------------------------gacattgacccg
AB241109_PreC_P-RF-CB      tg------------------------------------gacattgacccg
AB014375_PreC_P-RF-CB      tg------------------------------------gacattgacccg
FJ562227_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU589337_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KU576837_PreC_P-RF-BC      tg------------------------------------gacattgacccg
KU577083_PreC_P-RF-BC      tg------------------------------------gacattgacccg
AF461361_PreC_P-RF-CB      tg------------------------------------gacattgacacc
FJ562277_PreC_P-RF-CB      tg------------------------------------gacattgacccg
FJ562271_PreC_P-RF-CB      tg------------------------------------gacattgacccg
FJ386593_PreC_P-RF-CB      tg------------------------------------gacattgacacc
KU963930_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KU963931_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KU963932_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KU963933_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KU963934_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KU963935_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KU963936_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KU963938_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KU963939_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KU963940_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KU963941_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KU963942_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KU963943_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KU963944_PreC_P-RF-CB      tg------------------------------------gacattgacccg
JQ040130_PreC_P-RF-CB      tg------------------------------------gacattgacacg
EU939629_PreC_P-RF-BC      tg------------------------------------gacattgacacg
AB642096_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU939602_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU939589_PreC_P-RF-CB      tg------------------------------------gacattgacgtg
GQ377633_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU871994_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU871995_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU871991_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU871987_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU871985_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU871992_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU871993_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU871996_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU872014_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU872015_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU871981_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU871983_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU871986_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU871999_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU871984_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU871988_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU871989_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU871990_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KR013806_PreC_P-RF-CB      tg------------------------------------gacattgacccg
FJ562305_PreC_P-RF-CB      tg------------------------------------gacattgacacc
AF411409_PreC_P-RF-CB      tg------------------------------------gacattgacccg
AB198084_PreC_P-RF-CB      tg------------------------------------gacattgaccca
GU357843_PreC_P-RF-CB      tg------------------------------------gacatcgacccg
FJ562336_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU939565_PreC_P-RF-CB      tg------------------------------------gacattgacccg
JQ040146_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU939581_PreC_P-RF-CB      tg------------------------------------gacattgacacg
AB195939_PreC_P-RF-CB      tg------------------------------------gacattgaccct
AB195940_PreC_P-RF-CB      tg------------------------------------gacattgaccct
AB195941_PreC_P-RF-CB      tg------------------------------------gacattgaccct
AB195955_PreC_P-RF-CB      tg------------------------------------gacattgaccct
AB195956_PreC_P-RF-CB      tg------------------------------------gacattgaccct
AB195957_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KM875422_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774188_PreC_P-RF-CB      tg------------------------------------gacattgacccg
AB367393_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU871997_PreC_P-RF-CB      tg------------------------------------gacattgacccg
AY123424_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KY881840_PreC_P-RF-CB      tg------------------------------------gacattgacccg
M38454_PreC_P-RF-CB        tg------------------------------------gacattgacccg
JX429896_PreC_P-RF-CB      tg------------------------------------gacattgacccg
JX661494_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774246_PreC_P-RF-CB      tg------------------------------------gacattgacccg
JX026887_PreC_P-RF-CB      tg------------------------------------gacattgacacg
FJ386633_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KJ173299_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KJ173300_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KY470893_PreC_P-RF-CB      tg------------------------------------gacattgacccg
FJ562302_PreC_P-RF-CB      tg------------------------------------gacattgacacc
LC458432_PreC_P-RF-CB      tg------------------------------------gacattgacccg
LC279263_PreC_P-RF-CB      tg------------------------------------gacattgacccg
LC279264_PreC_P-RF-CB      tg------------------------------------gacattgacccg
LC279265_PreC_P-RF-CB      tg------------------------------------gacattgacccg
LC279266_PreC_P-RF-CB      tg------------------------------------gacattgacccg
LC279267_PreC_P-RF-CB      tg------------------------------------gacattgacccg
GQ377544_PreC_P-RF-CB      tg------------------------------------gacattgacccg
GQ377581_PreC_P-RF-CB      tg------------------------------------gacattgacccg
GQ377516_PreC_P-RF-CB      tg------------------------------------gacattgacccg
GQ377520_PreC_P-RF-CB      tg------------------------------------gacattgacccg
GQ377534_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774294_PreC_P-RF-CB      tg------------------------------------gacattgacccg
MG893561_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KJ173325_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KJ173326_PreC_P-RF-CB      tg------------------------------------gacattgacccg
FJ787446_PreC_P-RF-CB      tg------------------------------------gacattgacccg
FJ787480_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KR013816_PreC_P-RF-CB      tg------------------------------------gacattgacccg
JQ040175_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774183_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774186_PreC_P-RF-CB      tg------------------------------------gacattgaccca
AY167095_PreC_P-RF-CB      tg------------------------------------gacattgacccg
AB367400_PreC_P-RF-CB      tg------------------------------------gacattgacccg
MK321265_PreC_P-RF-CB      tg------------------------------------gacattgacccg
MK720627_PreC_P-RF-CB      tg------------------------------------gacattgacccg
MK720628_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774230_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774258_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KJ173320_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KJ173322_PreC_P-RF-CB      tg------------------------------------gacattgacccg
FJ386578_PreC_P-RF-CB      tg------------------------------------gacattgacccg
FJ386585_PreC_P-RF-CB      tg------------------------------------gacattgacccg
FJ386649_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774324_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KU963990_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KU963991_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KU963993_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KU963994_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KU963995_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KU963998_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KU963999_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KU964001_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KU964003_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KJ173329_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KJ173330_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774317_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774322_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KJ173350_PreC_P-RF-CB      tg------------------------------------gacattgacccg
GQ377548_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774328_PreC_P-RF-CB      tg------------------------------------gacattgacccg
HQ700554_PreC_P-RF-CB      tg------------------------------------gacattgaccat
KJ803827_PreC_P-RF-BC      tg------------------------------------gacattgacccg
MH368022_PreC_P-RF-GC      tg------------------------------------gacattgaccct
FJ023665_PreC_P-RF-GC      tg------------------------------------gacattgaccct
FJ882613_PreC_P-RF-GC      tg------------------------------------gacattgaccct
FJ882617_PreC_P-RF-GC      tg------------------------------------gacattgaccct
EU833891_PreC_P-RF-GC      tg------------------------------------gacattgaccct
FJ882612_PreC_P-RF-GC      tg------------------------------------gacattgaccct
FJ882618_PreC_P-RF-GC      tg------------------------------------gacattgaccct
FJ023666_PreC_P-RF-GC      tg------------------------------------gacattgacccg
FJ882611_PreC_P-RF-GC      tg------------------------------------gacattgaccct
FJ882610_PreC_P-RF-GC      tg------------------------------------gacattgaccct
FJ882614_PreC_P-RF-GC      tg------------------------------------gacattgaccct
FJ023664_PreC_P-RF-GC      tg------------------------------------gacattgaccct
FJ023667_PreC_P-RF-GC      tg------------------------------------gacattgaccct
FJ023673_PreC_P-RF-GC      tg------------------------------------gacattgaccct
FJ023670_PreC_P-RF-GC      tg------------------------------------gacattgaccct
FJ023659_PreC_P-RF-BC      tg------------------------------------gacattgacccc
FR714496_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KP148442_PreC_P-RF-BC      tg------------------------------------gacattgaccct
MH746811_PreC_P-RF-BC      tg------------------------------------gacattgaccct
FR714490_PreC_P-RF-GB      tg------------------------------------gacattgaccct
KC172106_PreC_P-RF-GB      tg------------------------------------gacattgaccct
MG826145_PreC_P-RF-BC      tg------------------------------------gacattgaccct
MH746813_PreC_P-RF-BC      tg------------------------------------gacattgaccct
MH746812_PreC_P-RF-BC      tg------------------------------------gacattgaccct
HQ700520_PreC_P-RF-CB      tg------------------------------------gacattgaccct
FJ386643_PreC_P-RF-CB      tg------------------------------------gacatcgaccca
KR013948_PreC_P-RF-CB      tg------------------------------------gacattgacacg
KU576102_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU576103_PreC_P-RF-CB      tg------------------------------------gacattgaccca
AB105172_PreC_P-RF-CB      tg------------------------------------gacattgaccct
AP011103_PreC_P-RF-CB      tg------------------------------------gacattgaccct
AP011102_PreC_P-RF-CB      tg------------------------------------gacattgaccct
AB493842_PreC_P-RF-CB      tg------------------------------------gacattgaccca
AB493840_PreC_P-RF-CB      tg------------------------------------gacattgacccg
GQ358155_PreC_P-RF-CB      tg------------------------------------gacattgaccct
AB493837_PreC_P-RF-CB      tg------------------------------------gacattgaccct
GQ358156_PreC_P-RF-CB      tg------------------------------------gacattgaccct
AB493838_PreC_P-RF-CB      tg------------------------------------gacattgaccct
AB493847_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KU695742_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KJ598675_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KU679945_PreC_P-RF-CB      tg------------------------------------gacattgacmct
KF873537_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KF873540_PreC_P-RF-CB      tg------------------------------------gacattgaccmt
KF873542_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KF873538_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KF873543_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KU576384_PreC_P-RF-CB      tg------------------------------------gacattgacgta
EU589339_PreC_P-RF-CB      tg------------------------------------gacattaacaca
DQ089798_PreC_P-RF-CB      tg------------------------------------gacattgaccca
GQ475335_PreC_P-RF-CB      tg------------------------------------gacattgacccg
FJ562317_PreC_P-RF-CB      tg------------------------------------gacatcgaccca
KF873533_PreC_P-RF-CB      tg------------------------------------gacattgaccmt
KF873534_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KF873531_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KF873532_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KU679940_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KF873535_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KU679939_PreC_P-RF-CB      tg------------------------------------gacattgaccct
AP011108_PreC_P-RF-CB      tg------------------------------------gacattgaccct
HQ700509_PreC_P-RF-CB      tg------------------------------------gacattgaccct
HQ700507_PreC_P-RF-CB      tg------------------------------------gacattgaccct
HQ700508_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KU695744_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KU695746_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KU695741_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KU695743_PreC_P-RF-CB      tg------------------------------------gacattgaccct
HQ700505_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KU679956_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KF873527_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KU679954_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KU679942_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KU679943_PreC_P-RF-BC      tg------------------------------------gacattgaccmt
KU695745_PreC_P-RF-CB      tg------------------------------------gacattgaccct
HQ700557_PreC_P-RF-CB      tg------------------------------------gacattgaccct
HQ700542_PreC_P-RF-CB      tg------------------------------------gacattgaccct
HQ700462_PreC_P-RF-CB      tg------------------------------------gacatygaccct
HQ700485_PreC_P-RF-CB      tg------------------------------------gacattgaccct
X75656_PreC_P-RF-CB        tg------------------------------------gacattgaccct
HQ700498_PreC_P-RF-CB      tg------------------------------------gacattgaccct
HQ700499_PreC_P-RF-CB      tg------------------------------------gacattgaccct
HQ700560_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KU679958_PreC_P-RF-CB      tg------------------------------------gacattgaccct
HQ700518_PreC_P-RF-CB      tg------------------------------------gacattgaccct
HQ700527_PreC_P-RF-CB      tg------------------------------------gacattgaccct
HQ700528_PreC_P-RF-CB      tg------------------------------------gacattgaccct
HQ700523_PreC_P-RF-CB      tg------------------------------------gacattgaccct
HQ700530_PreC_P-RF-CB      tg------------------------------------gacattgaccct
HQ700531_PreC_P-RF-CB      tg------------------------------------gacattgaccct
HQ700532_PreC_P-RF-CB      tg------------------------------------gacattgaccct
HQ700519_PreC_P-RF-CB      tg------------------------------------gacattgaccct
HQ700521_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KF873521_PreC_P-RF-BC      tg------------------------------------gacattgaccct
KU679955_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KU679950_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KF873522_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KF873523_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KF873524_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KU679941_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KU679946_PreC_P-RF-BC      tg------------------------------------gacattgaccct
KU679944_PreC_P-RF-BC      tg------------------------------------gacatcgaccct
KU679948_PreC_P-RF-CB      tg------------------------------------gacattgaccmt
KU679953_PreC_P-RF-BC      tg------------------------------------gacatcgaccct
KF873519_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KF873517_PreC_P-RF-BC      tg------------------------------------gacattgaccct
KF873518_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KF873515_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KF873511_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KF873513_PreC_P-RF-CB      tg------------------------------------gacattgaccmt
KY363272_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KY363273_PreC_P-RF-CB      tg------------------------------------gacattgaccca
FJ361772_PreC_P-RF-GC      tg------------------------------------gacattgacccg
MG826141_PreC_P-RF-CB      tg------------------------------------gacattgacacc
MG826142_PreC_P-RF-CB      tg------------------------------------gacattgacacc
KX660686_PreC_P-RF-DC      tg------------------------------------gacattgacccg
FJ386646_PreC_P-RF-CB      tg------------------------------------gacattgaccca
EU939668_PreC_P-RF-CB      tg------------------------------------gacattgacctg
KT003704_PreC_P-RF-CB      tg------------------------------------gacattgaccct
KP148352_PreC_P-RF-CB      tg------------------------------------gacattgacccg
AP011104_PreC_P-RF-CB      tg------------------------------------gacattgaccct
AP011105_PreC_P-RF-CB      tg------------------------------------gacattgaccct
LC416040_PreC_P-RF-CB      tg------------------------------------gacattgaccat
KJ803788_PreC_P-RF-CB      tg------------------------------------gacattgacccg
HQ700526_PreC_P-RF-CB      tg------------------------------------gacattgaccct
FJ386635_PreC_P-RF-CB      tg------------------------------------gacattgacaca
EU939577_PreC_P-RF-CB      tg------------------------------------gacattgacccg
GU385774_PreC_P-RF-CB      tg------------------------------------gacattgacccg
JX661486_PreC_P-RF-CB      tg------------------------------------gacattgacccg
FJ562314_PreC_P-RF-CB      tg------------------------------------gacattgacccg
MG893559_PreC_P-RF-CB      tg------------------------------------gacattgacccg
JQ040142_PreC_P-RF-CB      tg------------------------------------gacattgacccg
JQ040148_PreC_P-RF-CB      tg------------------------------------gacattgacccg
GQ377635_PreC_P-RF-BC      tg------------------------------------gacattgacccg
JX661485_PreC_P-RF-CB      tg------------------------------------gacattgacccg
MG893554_PreC_P-RF-CB      tg------------------------------------gacattgaccca
MG893555_PreC_P-RF-CB      tg------------------------------------gacattgaccca
EU717211_PreC_P-RF-CB      tg------------------------------------gacattgacacc
KY363262_PreC_P-RF-CB      tg------------------------------------gacattgacacc
KY363263_PreC_P-RF-CB      tg------------------------------------gacattgacacc
JX504540_PreC_P-RF-CB      tg------------------------------------gacatcgaccac
AB367419_PreC_P-RF-CB      tg------------------------------------gacattgacccg
AB300369_PreC_P-RF-CB      tg------------------------------------gacattgacccg
Y18856_PreC_P-RF-CB        tg------------------------------------gacatcgacccg
KJ803772_PreC_P-RF-BC      tg------------------------------------gacattgacccg
FJ386586_PreC_P-RF-CB      tg------------------------------------gacatcgaccca
EU939547_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KJ803778_PreC_P-RF-BC      tg------------------------------------gacattgacccg
EU939551_PreC_P-RF-CB      tg------------------------------------gacattgacacc
KY470845_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KY470848_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KY470851_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KY470852_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KY470853_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KY470844_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KY470843_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KY470846_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KY470847_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KY470849_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KY470850_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KY470855_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KY470854_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KY470856_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KJ410506_PreC_P-RF-CB      tg------------------------------------gacattgacccg
JF436923_PreC_P-RF-CB      tg------------------------------------gacattgacccg
JN104438_PreC_P-RF-CB      tg------------------------------------gacattgacccg
JN104442_PreC_P-RF-CB      tg------------------------------------gacattgacccg
AB031265_PreC_P-RF-CB      tg------------------------------------gacattgacccg
MF925389_PreC_P-RF-DC      tg------------------------------------gacattgacccg
JQ801477_PreC_P-RF-BC      tg------------------------------------gacattgacccg
JN664935_PreC_P-RF-DC      tg------------------------------------gacattgacccg
MF925381_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KJ803753_PreC_P-RF-CB      tg------------------------------------gacattgaccac
JQ801476_PreC_P-RF-CG      tg------------------------------------gacattgacccg
MF925370_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KU964351_PreC_P-RF-CB      tg------------------------------------gacattgacacg
KX660685_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KU964366_PreC_P-RF-DC      tg------------------------------------gacattgacacg
KU964367_PreC_P-RF-DC      tg------------------------------------gacattgacacg
KU964370_PreC_P-RF-DC      tg------------------------------------gacattgacacg
KU964372_PreC_P-RF-DC      tg------------------------------------gacattgacacg
KU964374_PreC_P-RF-DC      tg------------------------------------gacattgacacg
KU964379_PreC_P-RF-DC      tg------------------------------------gacattgacacg
KU964380_PreC_P-RF-DC      tg------------------------------------gacattgacacg
AB205152_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KX096713_PreC_P-RF-CA      tg------------------------------------gacattgacccg
KY670781_PreC_P-RF-DC      tg------------------------------------gacattgacmcg
KC774234_PreC_P-RF-CB      tg------------------------------------gacattgaccca
EU916232_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU964315_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU964308_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU964010_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU964005_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU964007_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU964008_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU964009_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU964303_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU964304_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU964305_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU964306_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU964307_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU964309_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU964310_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU964311_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU964312_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU964313_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU964314_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU964316_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU964317_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU964006_PreC_P-RF-CB      tg------------------------------------gacattgaccca
MG826144_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KX765835_PreC_P-RF-GC      tg------------------------------------gacattgacccg
AY206374_PreC_P-RF-CB      tg------------------------------------gacattgacccg
AB367800_PreC_P-RF-CB      tg------------------------------------gacattgacccg
MG826149_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774305_PreC_P-RF-CB      tg------------------------------------gacattgacccg
AB670303_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774193_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774291_PreC_P-RF-CB      tg------------------------------------gacattgacacg
KC774307_PreC_P-RF-CB      tg------------------------------------gacattgacacg
KC774449_PreC_P-RF-DC      tg------------------------------------gacattgacccg
HQ684849_PreC_P-RF-BC      tg------------------------------------gacattgacccg
FJ562263_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KT991424_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KT991427_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KR013843_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774485_PreC_P-RF-DC      tg------------------------------------gacattgatcct
KJ803804_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU939606_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KC774198_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774201_PreC_P-RF-CB      tg------------------------------------gacattgacccg
AB033557_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KY629632_PreC_P-RF-DC      tg------------------------------------gacattgacctg
KP276253_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KC774482_PreC_P-RF-DC      tg------------------------------------gacattgaccct
HM750148_PreC_P-RF-DC      tg------------------------------------gacattgaccct
AY057948_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KX660689_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KX660684_PreC_P-RF-DC      tg------------------------------------gacattgacccg
AY817511_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KX354997_PreC_P-RF-DC      tg------------------------------------gacattgacccg
HM750144_PreC_P-RF-DC      tg------------------------------------gacattgacccg
HM750142_PreC_P-RF-DC      tg------------------------------------gacattgacccg
DQ478890_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KP276256_PreC_P-RF-DC      tg------------------------------------gacattgacccg
HM750150_PreC_P-RF-DC      tg------------------------------------gacattgacccg
HM750147_PreC_P-RF-DC      tg------------------------------------gacattgacccg
HM750145_PreC_P-RF-DC      tg------------------------------------gacattgacccc
FJ349241_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KC774456_PreC_P-RF-DC      tg------------------------------------gacattgacccg
HM750143_PreC_P-RF-DC      tg------------------------------------gacattgacccg
HM750149_PreC_P-RF-DC      tg------------------------------------gacattgacccg
HM750146_PreC_P-RF-DC      tg------------------------------------gacattgacccg
JX661487_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU881995_PreC_P-RF-CB      tg------------------------------------gacattgaccct
AB049609_PreC_P-RF-CB      tg------------------------------------gacattgacccg
FJ715347_PreC_P-RF-CB      tg------------------------------------gacatcgacccg
FJ715345_PreC_P-RF-CB      tg------------------------------------gacatcgacccg
FJ715346_PreC_P-RF-CB      tg------------------------------------gacatcgacccg
KU963883_PreC_P-RF-CB      tg------------------------------------gacattgacccg
HQ700547_PreC_P-RF-CB      tg------------------------------------gacattgacccg
GQ377560_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774490_PreC_P-RF-DC      tg------------------------------------gacattgatcct
KX660682_PreC_P-RF-DC      tg------------------------------------gacattgacacc
KC774497_PreC_P-RF-DC      tg------------------------------------gacattgaccct
KC774489_PreC_P-RF-DC      tg------------------------------------gacatcgaccct
KC774487_PreC_P-RF-DC      tg------------------------------------gacattgaccct
KC774479_PreC_P-RF-DC      tg------------------------------------gacatcgaccct
KC774475_PreC_P-RF-DC      tg------------------------------------gacattgatcct
KC774499_PreC_P-RF-DC      tg------------------------------------gacatcgaccct
KC774480_PreC_P-RF-DC      tg------------------------------------gacattgatcct
KC774495_PreC_P-RF-DC      tg------------------------------------gacattgatcct
KC774484_PreC_P-RF-DC      tg------------------------------------gacatcgaccct
KC774494_PreC_P-RF-DC      tg------------------------------------gacatcgaccct
KC774498_PreC_P-RF-DC      tg------------------------------------gacattgaccct
KC774492_PreC_P-RF-DC      tg------------------------------------gacattgaccct
KC774488_PreC_P-RF-DC      tg------------------------------------gacattgaccct
KC774493_PreC_P-RF-DC      tg------------------------------------gacattgaccct
KC774478_PreC_P-RF-DC      tg------------------------------------gacattgaccct
KC774483_PreC_P-RF-DC      tg------------------------------------gacattgaccct
EU787435_PreC_P-RF-DC      tg------------------------------------gacatcgaccca
EU522070_PreC_P-RF-CB      tg------------------------------------gacattgacccg
AB674504_PreC_P-RF-DC      tg------------------------------------gacattgacccg
GQ924618_PreC_P-RF-CB      tg------------------------------------gacattgacccg
MG826148_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KU519423_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KC774453_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KC774212_PreC_P-RF-CB      tg------------------------------------gacattgacccg
JQ040174_PreC_P-RF-CB      tg------------------------------------gacattgaccca
AY040627_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774481_PreC_P-RF-DC      tg------------------------------------gacattgaccct
JQ732168_PreC_P-RF-CB      tg------------------------------------gacattgacccg
FJ562226_PreC_P-RF-CB      tg------------------------------------gacattgaccac
KC774263_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774332_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774341_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KT991420_PreC_P-RF-DC      tg------------------------------------gacattgaccac
FJ562278_PreC_P-RF-DC      tg------------------------------------gacattgaccac
KT991417_PreC_P-RF-DC      tg------------------------------------gacattgaccac
KT991423_PreC_P-RF-DC      tg------------------------------------gacattgaccac
KT991419_PreC_P-RF-DC      tg------------------------------------gacattgaccac
JF491451_PreC_P-RF-DC      tg------------------------------------gacattgacccg
JF491455_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KX660674_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KX660680_PreC_P-RF-DC      tg------------------------------------gacattgacccg
Y18857_PreC_P-RF-CB        tg------------------------------------gacattgacccg
MH094410_PreC_P-RF-BC      tg------------------------------------gacattgacccg
GQ377611_PreC_P-RF-CB      tg------------------------------------gacattgacccg
GQ377522_PreC_P-RF-CB      tg------------------------------------gacattgacccg
JF828933_PreC_P-RF-CB      tg------------------------------------gacattgacccg
JF828934_PreC_P-RF-CB      tg------------------------------------gacattgacccg
JF828935_PreC_P-RF-CB      tg------------------------------------gacattgacccg
JF828936_PreC_P-RF-CB      tg------------------------------------gacattgacccg
JF828938_PreC_P-RF-CB      tg------------------------------------gacattgacccg
DQ478886_PreC_P-RF-DC      tg------------------------------------gacattgacccc
KJ410520_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU919166_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU919167_PreC_P-RF-CB      tg------------------------------------gacattgacacg
KC774486_PreC_P-RF-DC      tg------------------------------------gacattgaccct
JQ707714_PreC_P-RF-CB      tg------------------------------------gacattgacccg
JF436922_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774476_PreC_P-RF-DC      tg------------------------------------gacattgaccct
KC774222_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774178_PreC_P-RF-BC      tg------------------------------------gacattgaccct
DQ478898_PreC_P-RF-DC      tg------------------------------------gacattgaccca
AB270535_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KC774364_PreC_P-RF-BC      tg------------------------------------gacattgacccg
KC774428_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KC774461_PreC_P-RF-DC      tg------------------------------------gacattgaccca
KC774442_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KC774432_PreC_P-RF-DC      tg------------------------------------gacattgaccca
JN400086_PreC_P-RF-CB      tg------------------------------------gacattgacccg
HM750133_PreC_P-RF-CB      tg------------------------------------gacattgacccg
GQ377607_PreC_P-RF-CB      tg------------------------------------gacattgaccca
FJ386581_PreC_P-RF-CB      tg------------------------------------gacattgacccg
AB195950_PreC_P-RF-CB      tg------------------------------------gacattgacccg
AB195951_PreC_P-RF-CB      tg------------------------------------gacattgacccg
AY817509_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KC774447_PreC_P-RF-DC      tg------------------------------------gacattgacccg
FJ562294_PreC_P-RF-CB      tg------------------------------------gacattgacccg
EU916239_PreC_P-RF-CB      tg------------------------------------gacattgaccca
EU916241_PreC_P-RF-CB      tg------------------------------------gacattgaccca
EU916240_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KC774455_PreC_P-RF-DC      tg------------------------------------gacattgaccca
KC774452_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KC774435_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KC774420_PreC_P-RF-DC      tg------------------------------------gacattgacacg
KC774443_PreC_P-RF-DC      tg------------------------------------gacattgacacg
KC774422_PreC_P-RF-DC      tg------------------------------------gacattgaccca
KU963856_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU963857_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU963858_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU963859_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU963860_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU963861_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU963863_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU963864_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU963865_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU963866_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU963867_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU963868_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU963869_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU963870_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KU963862_PreC_P-RF-CB      tg------------------------------------gacattgaccca
KF917451_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KC774470_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KC774454_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KC774439_PreC_P-RF-DC      tg------------------------------------gacattgaccca
KC774434_PreC_P-RF-DC      tg------------------------------------gacattgacccg
GQ377630_PreC_P-RF-BC      tg------------------------------------gacattgacccg
EU835240_PreC_P-RF-GC      tg------------------------------------gacattgaccct
AY862865_PreC_P-RF-DC      tg------------------------------------gacattgacccg
AY862864_PreC_P-RF-DC      tg------------------------------------gacattgacccg
AY862866_PreC_P-RF-DC      tg------------------------------------gacattgacccg
AF330110_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774430_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KC774431_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KX660677_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KX660675_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KT991421_PreC_P-RF-DC      tg------------------------------------gacattgaccca
KP276255_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KP276254_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KC774468_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KC774466_PreC_P-RF-DC      tg------------------------------------gacattgaccca
KC774463_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KC774349_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774344_PreC_P-RF-CB      tg------------------------------------gacattgacccg
JX429898_PreC_P-RF-DC      tg------------------------------------gacattgacccg
JF491449_PreC_P-RF-DC      tg------------------------------------gacattgacccg
EU787434_PreC_P-RF-DC      tg------------------------------------gacattgaccca
DQ478892_PreC_P-RF-DC      tg------------------------------------gacattgacccg
DQ478889_PreC_P-RF-DC      tg------------------------------------gacattgacccg
DQ144601_PreC_P-RF-BC      tg------------------------------------gacattgacccg
AY817512_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KC774474_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KC774458_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KC774425_PreC_P-RF-DC      tg------------------------------------gacattgacccg
FJ715413_PreC_P-RF-CB      tg------------------------------------gacattgacccg
FJ715387_PreC_P-RF-CB      tg------------------------------------gacattgacccg
FJ715384_PreC_P-RF-CB      tg------------------------------------gacattgacccg
AY247030_PreC_P-RF-CB      tg------------------------------------gacattgacccg
FJ715385_PreC_P-RF-CB      tg------------------------------------gacattgacccg
FJ715411_PreC_P-RF-CB      tg------------------------------------gacattgacccg
FJ715412_PreC_P-RF-CB      tg------------------------------------gacattgacccg
FJ715414_PreC_P-RF-CB      tg------------------------------------gacattgacccg
AY123041_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774457_PreC_P-RF-DC      tg------------------------------------gacattgacccg
AY800249_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KC774426_PreC_P-RF-DC      tg------------------------------------gacattgacccg
AY817515_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KJ173349_PreC_P-RF-CB      tg------------------------------------gacattgacccg
KC774471_PreC_P-RF-DC      tg------------------------------------gacattgaccca
DQ478897_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KC774433_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KC774472_PreC_P-RF-DC      tg------------------------------------gacattgacccg
AY817510_PreC_P-RF-DC      tg------------------------------------gacattgacccg
DQ478887_PreC_P-RF-DC      tg------------------------------------gacattgacccg
JF491448_PreC_P-RF-DC      tg------------------------------------gacattgacccg
JF491456_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KC774423_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KC774424_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KC774448_PreC_P-RF-DC      tg------------------------------------gacattgacccg
KU519422_PreC_P-RF-DC      tg------------------------------------gacattgacccg
AY817513_PreC_P-RF-DC      tg------------------------------------gacattgacccg
AY230115_PreC_P-RF-DA      tg------------------------------------gacattgacact
GQ161806_PreC_P-RF-EA      tg------------------------------------gacattgaccct
JF440017_PreC_P-RF-DA      tg------------------------------------gacatcgaccct
X68292_PreC_P-RF-DA        tg------------------------------------gacattgaccct
AB453985_PreC_P-RF-AC      tg------------------------------------gacattgacccg
MF925386_PreC_P-RF-AC      tg------------------------------------gacattgacccg
AB330368_PreC_P-RF-DA      tg------------------------------------gacattgaccct
AB222708_PreC_P-RF-AD      tg------------------------------------gacattgaccct
EF494376_PreC_P-RF-CA      tg------------------------------------gacattgaccct
AF297619_PreC_P-RF-DA      tg------------------------------------gacattgaccct
AF297620_PreC_P-RF-DA      tg------------------------------------gacattgaccct
JN664933_PreC_P-RF-DA      tg------------------------------------gacatcgaccct
JN664946_PreC_P-RF-DA      tg------------------------------------gacattgaccct
MF488705_PreC_P-RF-AD      tg------------------------------------gacattgaccct
AB194949_PreC_P-RF-AE      tg------------------------------------gacattgaccct
HM146131_PreC_P-RF-AD      tg------------------------------------gacattgaccct
GQ331048_PreC_P-RF-AE      tg------------------------------------gacattgacccc
AY161147_PreC_P-RF-DA      tg------------------------------------gacattgaccct
KJ586810_PreC_P-RF-AF      tg------------------------------------gacattgaccct
KF214656_PreC_P-RF-AC      tg------------------------------------gacattgaccct
AY233277_PreC_P-RF-AC      tg------------------------------------gacattgacccg
MF925404_PreC_P-RF-AC      tg------------------------------------gacattgaccct
FJ349221_PreC_P-RF-DE      tg------------------------------------gacattgaccct
AB674412_PreC_P-RF-DE      tg------------------------------------gacatcgaccca
JN664943_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KU668440_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JN664934_PreC_P-RF-DE      tg------------------------------------gacattgaccct
JN664929_PreC_P-RF-DE      tg------------------------------------gacattgaccct
GQ205379_PreC_P-RF-DE      tg------------------------------------gacattgaccct
AB033558_PreC_P-RF-DE      tg------------------------------------gacattgaccct
DQ315780_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KT366505_PreC_P-RF-DE      tg------------------------------------gacattgaccct
DQ315779_PreC_P-RF-DE      tg------------------------------------gacattgaccct
JN664940_PreC_P-RF-DE      tg------------------------------------gacattgaccct
MK516279_PreC_P-RF-DE      tg------------------------------------gacattgaccct
MK516280_PreC_P-RF-DE      tg------------------------------------gacattgaccct
MK541689_PreC_P-RF-DE      tg------------------------------------gacattgaccct
JN664915_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JN664925_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
GQ205377_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KC875338_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KC875339_PreC_P-RF-DE      tg------------------------------------gacattgaccct
GQ205378_PreC_P-RF-DE      tg------------------------------------gacattgaccct
GQ205387_PreC_P-RF-DE      tg------------------------------------gacattgaccct
DQ464167_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
DQ464164_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
DQ464165_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
DQ464166_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JN040803_PreC_P-RF-DE      tg------------------------------------gacattgatcct
JF754613_PreC_P-RF-DE      tg------------------------------------gacattgacccg
MF925401_PreC_P-RF-DB      tg------------------------------------gacattgacccg
MF925396_PreC_P-RF-DC      tg------------------------------------gacattgaccct
MF925360_PreC_P-RF-DB      tg------------------------------------gacattgaccct
EF103283_PreC_P-RF-AD      tg------------------------------------gacattgaccct
EF103282_PreC_P-RF-AD      tg------------------------------------gacattgaccct
KM524357_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KT366503_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KR905422_PreC_P-RF-DE      tg------------------------------------gacattgaccct
MF925402_PreC_P-RF-BD      tg------------------------------------gacattgaccct
MF925392_PreC_P-RF-DB      tg------------------------------------gacattgaccct
MF925371_PreC_P-RF-DC      tg------------------------------------gacattgacccg
MF925388_PreC_P-RF-DC      tg------------------------------------gacattgacccg
JN257154_PreC_P-RF-DE      tg------------------------------------gacattgaccct
FJ562223_PreC_P-RF-CD      tg------------------------------------gacattgaccct
AB674436_PreC_P-RF-DE      tg------------------------------------gacattgaccct
AB674434_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JN642127_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JN642141_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JN642152_PreC_P-RF-DE      tg------------------------------------gacatcgatcct
MF925397_PreC_P-RF-DC      tg------------------------------------gacattgacccg
MF925384_PreC_P-RF-DB      tg------------------------------------gacattgatcct
AY161145_PreC_P-RF-AD      tg------------------------------------gacattgatcct
AY161146_PreC_P-RF-AD      tg------------------------------------gacattgatcct
GQ377627_PreC_P-RF-CD      tg------------------------------------gacattgatcct
AY161140_PreC_P-RF-AD      tg------------------------------------gacattgatcct
AY161141_PreC_P-RF-AD      tg------------------------------------gacattgatcct
JN642160_PreC_P-RF-DE      tg------------------------------------gacattgaccct
JN642137_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KF471643_PreC_P-RF-DE      tg------------------------------------gacattgatcct
JN257174_PreC_P-RF-DE      tg------------------------------------gacattgaccyt
JN040798_PreC_P-RF-DE      tg------------------------------------gaccttgatcct
JN257210_PreC_P-RF-DE      tg------------------------------------gacattgaccct
JF754616_PreC_P-RF-DE      tg------------------------------------gacattgaccct
JN257191_PreC_P-RF-DE      tg------------------------------------gacatygaccct
JN257216_PreC_P-RF-DE      tg------------------------------------gacattgaccct
JN257206_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JN257207_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JN642139_PreC_P-RF-DE      tg------------------------------------gacattgaccct
AB674432_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
AB674433_PreC_P-RF-DE      tg------------------------------------gacattgaccct
JN257164_PreC_P-RF-DE      tg------------------------------------gacattgaccct
JN257189_PreC_P-RF-DE      tg------------------------------------gacattgaccct
JN688689_PreC_P-RF-DE      tg------------------------------------gacattgaccct
AB270538_PreC_P-RF-DE      tg------------------------------------gacattgaccct
MK052976_PreC_P-RF-BD      tg------------------------------------gacattgaccct
KJ647349_PreC_P-RF-DE      tg------------------------------------gaccttgaccct
KJ470898_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
KJ470897_PreC_P-RF-DE      tg------------------------------------gacattgaccct
HQ700494_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KF192835_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
KF192836_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KF192838_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KF192837_PreC_P-RF-DE      tg------------------------------------gaccttgaccct
KF192839_PreC_P-RF-DE      tg------------------------------------gaccttgaccct
KF192841_PreC_P-RF-DE      tg------------------------------------gaccttgaccct
MF618347_PreC_P-RF-DE      tg------------------------------------gaccttgaccct
KF192840_PreC_P-RF-DE      tg------------------------------------gaccttgaccct
KF192833_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
MF618346_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
KJ470891_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KJ470892_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KJ470888_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KJ470890_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KJ470884_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KJ470886_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KJ470887_PreC_P-RF-DE      tg------------------------------------gacattgaccct
FJ692536_PreC_P-RF-DE      tg------------------------------------gacattgaccct
HQ700579_PreC_P-RF-DE      tg------------------------------------gacattgaccct
HQ700585_PreC_P-RF-DE      tg------------------------------------gacattgaccct
HQ700493_PreC_P-RF-DE      tg------------------------------------gacattgaccct
HQ700492_PreC_P-RF-DE      tg------------------------------------gacattgaccct
AB048702_PreC_P-RF-DE      tg------------------------------------gacattgaccct
AB048703_PreC_P-RF-DE      tg------------------------------------gacattgaccct
MH481862_PreC_P-RF-DE      tg------------------------------------gacagtgaccct
MH481860_PreC_P-RF-DE      tg------------------------------------gacattgaccct
MH481859_PreC_P-RF-DE      tg------------------------------------gacattgaccct
MH481858_PreC_P-RF-DE      tg------------------------------------gacattgaccct
MH481861_PreC_P-RF-DE      tg------------------------------------gacattgaccct
J02202_PreC_P-RF-DE        tg------------------------------------gacattgaccct
HQ700534_PreC_P-RF-DE      tg------------------------------------gacattgaccct
HQ700533_PreC_P-RF-DE      tg------------------------------------gacattgaccct
HQ700536_PreC_P-RF-DE      tg------------------------------------gacattgaccct
HQ700541_PreC_P-RF-DE      tg------------------------------------gacattgaccct
HQ700581_PreC_P-RF-DE      tg------------------------------------gacattgaccct
HQ700582_PreC_P-RF-DE      tg------------------------------------gacattgaccct
HQ700503_PreC_P-RF-DE      tg------------------------------------gacattgaccct
HQ700583_PreC_P-RF-DE      tg------------------------------------gacattgaccct
HQ700584_PreC_P-RF-DE      tg------------------------------------gacattgaccct
HQ700497_PreC_P-RF-DE      tg------------------------------------gacattgaccct
HQ700501_PreC_P-RF-DE      tg------------------------------------gacattgaccct
HQ700524_PreC_P-RF-DE      tg------------------------------------gacattgaccct
HQ700525_PreC_P-RF-DE      tg------------------------------------gacattgaccct
AB033559_PreC_P-RF-DE      tg------------------------------------gacattgaccct
HQ700535_PreC_P-RF-DE      tg------------------------------------gacattgaycct
HQ700537_PreC_P-RF-DE      tg------------------------------------gacattgaccct
HQ700538_PreC_P-RF-DE      tg------------------------------------gacattgaccct
HQ700539_PreC_P-RF-DE      tg------------------------------------gacattgaccct
HQ700540_PreC_P-RF-DE      tg------------------------------------gacattgaccct
HQ700500_PreC_P-RF-DE      tg------------------------------------gacattgaccct
JN688717_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KJ647356_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JN688715_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KJ647351_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KM359442_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
KJ586811_PreC_P-RF-DF      tg------------------------------------gacattgaccct
KM577666_PreC_P-RF-DE      tg------------------------------------gacattgaccct
MF488702_PreC_P-RF-DE      tg------------------------------------gacattgacact
KF679991_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
MH724243_PreC_P-RF-DE      tg------------------------------------gacattgaccct
MN507835_PreC_P-RF-DE      tg------------------------------------gacattgaccct
X65259_PreC_P-RF-DA        tg------------------------------------gacattgaccct
JN257204_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
MH724240_PreC_P-RF-DE      tg------------------------------------gacattgaccct
MH724239_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
KX827302_PreC_P-RF-DE      tg------------------------------------gacattgaccct
AY341335_PreC_P-RF-DE      tg------------------------------------gacattgaccct
AJ627221_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JQ687532_PreC_P-RF-DE      tg------------------------------------gacattgaccct
X80925_PreC_P-RF-DE        tg------------------------------------gacattgaccct
EF103284_PreC_P-RF-AD      tg------------------------------------gacatcgaccct
MH464835_PreC_P-RF-DE      tg------------------------------------gacattgacccg
KC774450_PreC_P-RF-DE      tg------------------------------------gacattgaccca
FJ349212_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
AB188243_PreC_P-RF-DE      tg------------------------------------gacattgaccct
AB188245_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KM577667_PreC_P-RF-DE      tg------------------------------------gacattgaccct
EU594406_PreC_P-RF-DE      tg------------------------------------gacattgaccct
AB210819_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
KM386676_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KM577665_PreC_P-RF-DE      tg------------------------------------gacattgaccct
AJ627217_PreC_P-RF-DE      tg------------------------------------gacattgaccct
MK598656_PreC_P-RF-DE      tg------------------------------------gacattgaccct
MK598654_PreC_P-RF-DE      tg------------------------------------gacattgaccct
DQ111987_PreC_P-RF-DE      tg------------------------------------gacattgaccct
EU594435_PreC_P-RF-DE      tg------------------------------------gacattgaccct
MK618439_PreC_P-RF-DE      tg------------------------------------gacattgaccct
EU594436_PreC_P-RF-DE      tg------------------------------------gacattgaccct
JF440012_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JF440007_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JF439999_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JF440004_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JF440005_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JF440013_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JF440001_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JF439996_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JF439998_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JF439995_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JF440000_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JF440006_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JF440008_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JF440009_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JF440010_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JF440014_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JF440015_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JF440003_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
AY373430_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KM524359_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KT366492_PreC_P-RF-DE      tg------------------------------------gacattgaccct
GQ183486_PreC_P-RF-DE      tg------------------------------------gacattgaccct
MH724222_PreC_P-RF-DE      tg------------------------------------gacattgaccct
AY236161_PreC_P-RF-DA      tg------------------------------------gacatcgaccct
JF440002_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JF440011_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
EU185780_PreC_P-RF-AD      tg------------------------------------gacatcgaccct
KC012653_PreC_P-RF-AD      tg------------------------------------gacatcgaccct
MF967563_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
MK618438_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
MK618440_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
MK618444_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
U95551_PreC_P-RF-DE        tg------------------------------------gacatcgaccct
JX898690_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
AJ344117_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JX898686_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JX898693_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JX898695_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JX898696_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JX898698_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JX898699_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
MK618442_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
MK618445_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JX898687_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
JX898688_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
MK598652_PreC_P-RF-DE      tg------------------------------------gacattgaccct
MK598653_PreC_P-RF-DE      tg------------------------------------gacattgaccct
DQ315777_PreC_P-RF-DE      tg------------------------------------gacattgatcct
KM524337_PreC_P-RF-DE      tg------------------------------------gacattgatcct
KM524336_PreC_P-RF-DE      tg------------------------------------gacattgatcct
LK995391_PreC_P-RF-ED      tg------------------------------------gacattgaccct
AB583679_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KM577663_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KM577664_PreC_P-RF-DE      tg------------------------------------gacattgaccct
MN507850_PreC_P-RF-DE      tg------------------------------------gacattgaccct
EF103285_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KT366504_PreC_P-RF-DE      tg------------------------------------gacattgaccct
AY233293_PreC_P-RF-DE      tg------------------------------------gacattgaccct
AY233295_PreC_P-RF-DE      tg------------------------------------gacattgaccct
GU563560_PreC_P-RF-DE      tg------------------------------------gacattgaccct
MH464846_PreC_P-RF-DE      tg------------------------------------gacattgaccct
MH464852_PreC_P-RF-DE      tg------------------------------------gacattgaccct
MH464851_PreC_P-RF-DE      tg------------------------------------gacattgaccct
FJ904409_PreC_P-RF-DE      tg------------------------------------gacattgaccct
FJ904405_PreC_P-RF-DE      tg------------------------------------gacattgatcct
FN594767_PreC_P-RF-DE      tg------------------------------------gacattgaccct
FJ904436_PreC_P-RF-DE      tg------------------------------------gacattgaccct
MK052957_PreC_P-RF-DE      tg------------------------------------gacattgaccct
MK052969_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KP168421_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
FJ904430_PreC_P-RF-DE      tg------------------------------------gacatcgatcct
FJ904414_PreC_P-RF-DE      tg------------------------------------gacattgaccct
FJ904408_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
FJ904416_PreC_P-RF-DE      tg------------------------------------gacattgaccct
FJ904417_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
FJ349207_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
FJ904407_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
FJ904425_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
FJ904400_PreC_P-RF-DE      tg------------------------------------gacattgaccct
DQ991753_PreC_P-RF-DE      tg------------------------------------gacattgaccct
GQ161788_PreC_P-RF-AE      tg------------------------------------gacattgaccct
FJ904394_PreC_P-RF-DE      tg------------------------------------gacattgatcct
FN594769_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KX357628_PreC_P-RF-DE      tg------------------------------------gacattgaccct
GQ161753_PreC_P-RF-AE      tg------------------------------------gacattgaccct
FJ904398_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
FJ904396_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
FJ904440_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
GQ161767_PreC_P-RF-AE      tg------------------------------------gacattgaccct
HF571060_PreC_P-RF-AE      tg------------------------------------gacattgaccct
GQ161837_PreC_P-RF-AE      tg------------------------------------gacattgaccct
GQ161838_PreC_P-RF-AE      tg------------------------------------gacattgaccct
KP168420_PreC_P-RF-DE      tg------------------------------------gacattgaccct
FJ904444_PreC_P-RF-DE      tg------------------------------------gacattgaccct
FJ904428_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KX357627_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KX357631_PreC_P-RF-DE      tg------------------------------------gacattgaccca
FJ904404_PreC_P-RF-DE      tg------------------------------------gacattgaccct
FJ904442_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KX357632_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KX357626_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
FJ904441_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KU711666_PreC_P-RF-DE      tg------------------------------------gacattgaccct
FJ904397_PreC_P-RF-DE      tg------------------------------------gacattgaccct
FJ904437_PreC_P-RF-DE      tg------------------------------------gacattgaccct
FJ904401_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
KU736921_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KU736922_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KP288875_PreC_P-RF-DE      tg------------------------------------gacattgaccct
FJ904447_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KP168416_PreC_P-RF-DE      tg------------------------------------gacattgaccct
FJ904403_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KP168417_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KP168418_PreC_P-RF-DE      tg------------------------------------gacattgaccct
MH685719_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KX357630_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KX357634_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KX357624_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KX357633_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KX357635_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KX357623_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KX357625_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KX357629_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KX357641_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KU736916_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KU736915_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KU736923_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KU736914_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KU736917_PreC_P-RF-DE      tg------------------------------------gacattgaccct
FJ904406_PreC_P-RF-DE      tg------------------------------------gacattgaccct
AM494716_PreC_P-RF-DE      tg------------------------------------gacattgaccct
GU177079_PreC_P-RF-DE      tg------------------------------------gacattgaccct
FN594771_PreC_P-RF-DE      tg------------------------------------gacattgaccct
FN594770_PreC_P-RF-DE      tg------------------------------------gacatcgaccct
GQ161754_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KM606741_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KX357636_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KF170740_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KX827299_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KM606750_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KP995112_PreC_P-RF-DE      tg------------------------------------gacattgaccct
KM606751_PreC_P-RF-DE      tg------------------------------------gacattgaccct
                           **                                    * *    *    

KF219922_PreC_P-RF-GH      tataaagaatttggagcttctgtggagttactctcatttttgccttctga
JQ272886_PreC_P-RF-GF      tataaagaatttggagctactgtggagttgctctcktttttgccttctga
HE981179_PreC_P-RF-FG      tataaagaatttggagcttctgtggaattgctctcttttttgccttctga
HE981180_PreC_P-RF-GF      tataaagaatttggagcttctgtggaattgctctcttttttgccttctga
JQ272887_PreC_P-RF-GF      tataaagaatttggagctactgtggagttactctcttttttgccttctga
KJ586803_PreC_P-RF-AF      tataaagaatttggagcttctgtggaattactctcttttttgccttctga
MF488699_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
EU833890_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
AB933283_PreC_P-RF-AG      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JF440019_PreC_P-RF-AG      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JF440021_PreC_P-RF-AG      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JF440022_PreC_P-RF-AG      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
AB933282_PreC_P-RF-AG      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
EU833889_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
KP274926_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
EF464099_PreC_P-RF-AG      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
AB933281_PreC_P-RF-AG      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
AB933279_PreC_P-RF-AG      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
AB933280_PreC_P-RF-AG      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707468_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707426_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707424_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttccga
JQ707459_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707473_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707465_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccctctga
JQ707464_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707463_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707461_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707457_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707458_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707460_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707462_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707466_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707467_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707469_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707470_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707448_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707474_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707421_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707430_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707432_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707445_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707450_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707456_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707471_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707472_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707475_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
JQ707441_PreC_P-RF-GA      tataaagaatttggagctactgtggagttgctctcgtttttgccttctga
KC774323_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KJ803771_PreC_P-RF-DB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU679952_PreC_P-RF-CB      tataaagaatttggagcttytgcggagttactctcttttttgccttytga
HQ700580_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
MF925382_PreC_P-RF-CB      tataaagaatttggagctacttctgagttactctcttttttgccttctga
EF494378_PreC_P-RF-CA      tataaagaatttggagcttctgtgcagttactctcatttttgccttctga
KF873530_PreC_P-RF-CB      tataaagaatttggagcgtctgtggagttactctcgtttttgccttccga
JQ027310_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KJ803785_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
MG826150_PreC_P-RF-BC      tataaagaatttggagcttctgcggagttaatctcttttttgccttctga
FJ032343_PreC_P-RF-CB      tataaagaatttggagcctctgcggagttaatctcttttttgccttctga
FJ386674_PreC_P-RF-BC      tataaagaatttggagcctctgcggagttaatctcttttttgccttctga
EU939623_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ377592_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgcctgctga
EU939620_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgcctactga
FJ562328_PreC_P-RF-CB      tataaagaatttggagcttctacagagttactctcttttttgccttctga
KJ803822_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU660227_PreC_P-RF-BC      tataaagaatttggagcttctgcgcctttactctcttttttgccttcgga
EU939621_PreC_P-RF-CB      tataaagaatttggagcttctggagagttactctcttttttgccttctga
KJ803791_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ377604_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgcctaatga
EU882006_PreC_P-RF-CB      tataaagaatttggagcttctgcagagttactctcttttttgccttctga
GQ377556_PreC_P-RF-CB      tataaagaatttggaggctctgtggagttactctcttttttgccttctga
EU939630_PreC_P-RF-CB      tataaagaatttggagcctctgtggagttactctcttttttgccttctga
MG826151_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU939631_PreC_P-RF-BC      tataaagaatttggagcttctatggagttactctcttttttgccttctga
EU939632_PreC_P-RF-CB      tataaagaatttggagcctctgtggagttactctcttttttgccttctga
FJ562229_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KM213033_PreC_P-RF-CB      tataaagaatttggagcttctgcggagttactctcttttttgccttctga
KJ803798_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KJ803782_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
MK052970_PreC_P-RF-BD      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KJ410497_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ377595_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttaccttctga
JF436919_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ032337_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KJ803803_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
HQ684848_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU939627_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
JX661498_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ377626_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ562247_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774414_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ377590_PreC_P-RF-CB      tataaagaatttggagcttctatggagttactctcttttttgccttctga
KJ173279_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KJ173280_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ377594_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ377564_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ377539_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KJ173358_PreC_P-RF-CB      tataaagaatttggagcttttgtggagttactttcttttttgccttctga
MK052968_PreC_P-RF-BD      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ377614_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ377613_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ377602_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ377573_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ377565_PreC_P-RF-CB      tataaagaatttggagcttctgtggaattactctcttttttgccttctga
MK052967_PreC_P-RF-BD      tataaagaatttggagcttctgtggagttactctcttctttgccttctga
GQ377634_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KP148337_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC315400_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KJ803802_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ377549_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ377596_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
MG826146_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
MG826147_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KY470865_PreC_P-RF-GC      tataaagaatttggagcttctgtggagttactctcttttttgcctaatga
KY470858_PreC_P-RF-GC      tataaagaatttggagcttctgtggagttactctcttttttgcctactga
KY470871_PreC_P-RF-GC      tttaaagaatttggagcttctgtggagttactctcttttttgcctactga
EU787444_PreC_P-RF-CB      aataaagaatttggagcttctgtggagttactctcttttttgccttctga
KF214680_PreC_P-RF-GC      tataaagaatttggagcttctttggagttactctcttttttgccttctga
FJ562267_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
EU916228_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctctttttttgcctctga
FJ562287_PreC_P-RF-CB      tataaagaatttggagcttttggggagttacttttttttttgccttttga
KX774505_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AB241109_PreC_P-RF-CB      tataaagaatttggagcttccgtggagttactctcttttttgccttctga
AB014375_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ562227_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccgtctga
EU589337_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU576837_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU577083_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AF461361_PreC_P-RF-CB      tataaagaatttggagcctctgtggagttactctcttttttgccttctga
FJ562277_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttaatctcttttttgccttctga
FJ562271_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ386593_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttccga
KU963930_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963931_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963932_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963933_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963934_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963935_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963936_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963938_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963939_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963940_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963941_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963942_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963943_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963944_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
JQ040130_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU939629_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AB642096_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgcctactga
EU939602_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU939589_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcgtttttgccttctga
GQ377633_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU871994_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU871995_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU871991_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU871987_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU871985_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU871992_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU871993_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU871996_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU872014_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU872015_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU871981_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttaccttctga
EU871983_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttaccttctga
EU871986_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttaccttctga
EU871999_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttaccttctga
EU871984_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU871988_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU871989_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU871990_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KR013806_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgcctgctga
FJ562305_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AF411409_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AB198084_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttatgccttctga
GU357843_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ562336_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU939565_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
JQ040146_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU939581_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AB195939_PreC_P-RF-CB      tataaagaatttggagcatccgtggagttactctcttttttgccttctga
AB195940_PreC_P-RF-CB      tataaagaatttggagcatccgtggagttactctcttttttgccttctga
AB195941_PreC_P-RF-CB      tataaagaatttggagcatccgtggagttactctcttttttgccttctga
AB195955_PreC_P-RF-CB      tataaagaatttggagcatccgtggagttactctcttttttgccttctga
AB195956_PreC_P-RF-CB      tataaagaatttggagcatccgtggagttactctcttttttgccttctga
AB195957_PreC_P-RF-CB      tataaagaatttggagcatccgtggagttactctcttttttgccttctga
KM875422_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttcgga
KC774188_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AB367393_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU871997_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AY123424_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KY881840_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
M38454_PreC_P-RF-CB        tataaagaatttggagcttctgtggagttactctcttttttgccttctga
JX429896_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttccga
JX661494_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttccga
KC774246_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccgtctga
JX026887_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttctgccttctga
FJ386633_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KJ173299_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KJ173300_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KY470893_PreC_P-RF-CB      tataaagaatttggaacttctgtggagttactctcttttttgccttctga
FJ562302_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
LC458432_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
LC279263_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
LC279264_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
LC279265_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
LC279266_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
LC279267_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ377544_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ377581_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ377516_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ377520_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ377534_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774294_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
MG893561_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KJ173325_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KJ173326_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ787446_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ787480_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KR013816_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
JQ040175_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774183_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774186_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AY167095_PreC_P-RF-CB      tataaagaatttggagcatctgtggagttactctcttttttgccttctga
AB367400_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgcctgctga
MK321265_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
MK720627_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
MK720628_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774230_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774258_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KJ173320_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KJ173322_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ386578_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
FJ386585_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
FJ386649_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
KC774324_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963990_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963991_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963993_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963994_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963995_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963998_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963999_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU964001_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU964003_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KJ173329_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KJ173330_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774317_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774322_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KJ173350_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ377548_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774328_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
HQ700554_PreC_P-RF-CB      tataaagaatttggcgcttctgtggagttactctcttttttgccttctga
KJ803827_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
MH368022_PreC_P-RF-GC      tataaagaatttggcgcttctgtggagttactctcttttttgccttctga
FJ023665_PreC_P-RF-GC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ882613_PreC_P-RF-GC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ882617_PreC_P-RF-GC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU833891_PreC_P-RF-GC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ882612_PreC_P-RF-GC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ882618_PreC_P-RF-GC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ023666_PreC_P-RF-GC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ882611_PreC_P-RF-GC      tataaagaatttggagcttctgcggagttactctcttttttgccttctga
FJ882610_PreC_P-RF-GC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ882614_PreC_P-RF-GC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ023664_PreC_P-RF-GC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ023667_PreC_P-RF-GC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ023673_PreC_P-RF-GC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ023670_PreC_P-RF-GC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ023659_PreC_P-RF-BC      tataaagaatttggagcttccgtggagttactctcttttttgccttctga
FR714496_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctccattttgccttctga
KP148442_PreC_P-RF-BC      tataaagaatttggagcttctgtggcgttactctcttttttgccttctga
MH746811_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FR714490_PreC_P-RF-GB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC172106_PreC_P-RF-GB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
MG826145_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
MH746813_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
MH746812_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
HQ700520_PreC_P-RF-CB      tataaagaatttggagcttctgcggagttactctcatttttgccttctga
FJ386643_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KR013948_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU576102_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU576103_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AB105172_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AP011103_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AP011102_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AB493842_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AB493840_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ358155_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AB493837_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ358156_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AB493838_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AB493847_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU695742_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KJ598675_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU679945_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KF873537_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KF873540_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KF873542_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KF873538_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KF873543_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU576384_PreC_P-RF-CB      tataaagaatttggagcctctgtggagttactctcttttttgccttctga
EU589339_PreC_P-RF-CB      tataaagaatttggagcttccgtggagttactctcttttttgccttctga
DQ089798_PreC_P-RF-CB      tataaagaattgggagcttccggggagttactctctttttggccttctga
GQ475335_PreC_P-RF-CB      tataaagaatttggagcttctttggagttactctcttttttgccgtctga
FJ562317_PreC_P-RF-CB      tataaagaatttggagcctcagcgcagttactctcttttttgcctactga
KF873533_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KF873534_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KF873531_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KF873532_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU679940_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
KF873535_PreC_P-RF-CB      tataaagaatttggagcttcagtggaattactctcttttttgccttctga
KU679939_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
AP011108_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcatttttgccttctga
HQ700509_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
HQ700507_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
HQ700508_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU695744_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU695746_PreC_P-RF-CB      tataaagaatttggagcttccgtggagttactctcttttttgccttctga
KU695741_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU695743_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
HQ700505_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU679956_PreC_P-RF-CB      tataaagaatttggagcttccgtggagttactctcttttttgcctkctga
KF873527_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
KU679954_PreC_P-RF-CB      tataaagaatttggagcttccgtcgagttactctcttttttgccttctga
KU679942_PreC_P-RF-CB      tataaagaatttggagcttccgtcgagttactctcttttttgccttctga
KU679943_PreC_P-RF-BC      tataaagaatttggagcttccgtcgagttactctcttttttgccttctga
KU695745_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
HQ700557_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
HQ700542_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
HQ700462_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
HQ700485_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
X75656_PreC_P-RF-CB        tataaagaatttggagcttctgtggagttactctcttttttgccttctga
HQ700498_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
HQ700499_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
HQ700560_PreC_P-RF-CB      tataaagaatttggagcttccgtggagttactctcttttttgccttctga
KU679958_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctgr
HQ700518_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcatttttgccttctga
HQ700527_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcatttttgccttctga
HQ700528_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcatttttgccttctga
HQ700523_PreC_P-RF-CB      tataaagaatttggagcttccgtggagttactctcatttttgccttctga
HQ700530_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcatttttgccttctga
HQ700531_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcatttttgccttctga
HQ700532_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcatttttgccttctga
HQ700519_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
HQ700521_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KF873521_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU679955_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgcctwctga
KU679950_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KF873522_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KF873523_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KF873524_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU679941_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU679946_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU679944_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU679948_PreC_P-RF-CB      tayaaagaatttggagcttctgtggagttactctcttttttgccttctga
KU679953_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KF873519_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KF873517_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KF873518_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KF873515_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KF873511_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KF873513_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KY363272_PreC_P-RF-CB      tataaagaatttggcgcttcagcggagttactctcttttttgcctactga
KY363273_PreC_P-RF-CB      tataaagaatttggcgcttcagcggagttactctcttttttgcctactga
FJ361772_PreC_P-RF-GC      tataaagaatttggagcttctgtggagttactctctttcttgccttctga
MG826141_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
MG826142_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttcgga
KX660686_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ386646_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU939668_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
KT003704_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KP148352_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AP011104_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AP011105_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
LC416040_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KJ803788_PreC_P-RF-CB      tataaagaatttggagcttctgtggagatacctttttttttgccttctga
HQ700526_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ386635_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU939577_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GU385774_PreC_P-RF-CB      tataaagaatttggagcatctacggagttactctcttttttgccttctga
JX661486_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ562314_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
MG893559_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
JQ040142_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
JQ040148_PreC_P-RF-CB      tataaagaatttggagcttctgkggagttactytcttttttgccttctga
GQ377635_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
JX661485_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
MG893554_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
MG893555_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU717211_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttctgccttctga
KY363262_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcgtttttgccttctga
KY363263_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcgtttttgccttctga
JX504540_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AB367419_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AB300369_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
Y18856_PreC_P-RF-CB        tataaagaatttggagcttctgcggagttactctcttttttgccttctga
KJ803772_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ386586_PreC_P-RF-CB      tataaagaatttggagcttctgcagagttactctcttttttgccttctga
EU939547_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KJ803778_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU939551_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KY470845_PreC_P-RF-DC      tataaagaatttggagcttctttggagttactctcttttttgccttctga
KY470848_PreC_P-RF-DC      tataaagaatttggagcttctttggagttactctcttttttgccttctga
KY470851_PreC_P-RF-DC      tataaagaatttggagcttctttggagttactctcttttttgccttctga
KY470852_PreC_P-RF-DC      tataaagaatttggagcttctttggagttactctcttttttgccttctga
KY470853_PreC_P-RF-DC      tataaagaatttggagcttctttggagttactctcttttttgccttctga
KY470844_PreC_P-RF-DC      tataaagaatttggagcttccttggagttactctcttttttgccttctga
KY470843_PreC_P-RF-DC      tataaagaatttggagcttctttggagttactctcttttttgccttctga
KY470846_PreC_P-RF-DC      tataaagaatttggagcttctttggagttactctcttttttgccttctga
KY470847_PreC_P-RF-DC      tataaagaatttggagcttctttggagttactctcttttttgccttctga
KY470849_PreC_P-RF-DC      tataaagaatttggagcttctttggagttactctcttttttgccttctga
KY470850_PreC_P-RF-DC      tataaagaatttggagcttctttggagttactctcttttttgccttctga
KY470855_PreC_P-RF-DC      tataaagaatttggagcttctttggagttactctcttttttgccttctga
KY470854_PreC_P-RF-DC      tataaagaatttggagcttctttggagttactctcttttttgccttctga
KY470856_PreC_P-RF-DC      tataaagaatttggagcttctttggagttactctcttttttgccttctga
KJ410506_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
JF436923_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
JN104438_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
JN104442_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AB031265_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
MF925389_PreC_P-RF-DC      tataaagaatttggagcttctatggagttactctcttttttgccttctga
JQ801477_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
JN664935_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
MF925381_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KJ803753_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
JQ801476_PreC_P-RF-CG      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
MF925370_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU964351_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgcctgctga
KX660685_PreC_P-RF-DC      tataaagaatttggagcttctgcggagttactctcttttttgccttctga
KU964366_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU964367_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU964370_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU964372_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU964374_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU964379_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU964380_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AB205152_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KX096713_PreC_P-RF-CA      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KY670781_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774234_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU916232_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU964315_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgcctgctga
KU964308_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
KU964010_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
KU964005_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
KU964007_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
KU964008_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
KU964009_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
KU964303_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
KU964304_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
KU964305_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
KU964306_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
KU964307_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
KU964309_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
KU964310_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
KU964311_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
KU964312_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
KU964313_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
KU964314_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
KU964316_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
KU964317_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
KU964006_PreC_P-RF-CB      tataaagaatttggagcttcagtggagttactctcttttttgccttctga
MG826144_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KX765835_PreC_P-RF-GC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AY206374_PreC_P-RF-CB      tataaagaatttggagcttctctggagttactctcttttttgccttctga
AB367800_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
MG826149_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774305_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AB670303_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774193_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774291_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774307_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774449_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
HQ684849_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ562263_PreC_P-RF-DC      tataaagaatttggagcttctgyggagttactctcgtttttgccttctga
KT991424_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcgtttttgccttctga
KT991427_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcgtttttgccttctga
KR013843_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774485_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KJ803804_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU939606_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774198_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774201_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AB033557_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KY629632_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KP276253_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774482_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
HM750148_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgcctgctga
AY057948_PreC_P-RF-DC      tataaagaatttggagcttctgtggaggtactctcttttttgccttctga
KX660689_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KX660684_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AY817511_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KX354997_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
HM750144_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
HM750142_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
DQ478890_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KP276256_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
HM750150_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
HM750147_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
HM750145_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ349241_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774456_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
HM750143_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
HM750149_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
HM750146_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
JX661487_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU881995_PreC_P-RF-CB      tataaagaatttggcgcatctgtggagttactctcttttttgccttctga
AB049609_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ715347_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ715345_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ715346_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963883_PreC_P-RF-CB      tataaagaatttggagcttccgtggagttactctcttttttgcctgctga
HQ700547_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttaccttctga
GQ377560_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774490_PreC_P-RF-DC      tataaagaatttggagcttctgtggaattactctcttttttgccttctga
KX660682_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774497_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774489_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774487_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774479_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774475_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774499_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774480_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774495_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774484_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774494_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774498_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774492_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774488_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774493_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774478_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774483_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU787435_PreC_P-RF-DC      tataaagaatttggagcttctctggagttactctcttttttgccttctga
EU522070_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AB674504_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ924618_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
MG826148_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU519423_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774453_PreC_P-RF-DC      tataaagaatttggagcttctgcggagttactctcttttttgccttctga
KC774212_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
JQ040174_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AY040627_PreC_P-RF-CB      tataaagaatttggagcttccgtggagttactctcttttttgccttctga
KC774481_PreC_P-RF-DC      tataaagaatttggagcgtctttggagttactctcttttttgccttctga
JQ732168_PreC_P-RF-CB      tataaagaatttggagcttccgtggagttactctcttttttgccttctga
FJ562226_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774263_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774332_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774341_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KT991420_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ562278_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KT991417_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KT991423_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KT991419_PreC_P-RF-DC      tatgaagaatttggagcttctgtggagttactctcttttttgccttctga
JF491451_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
JF491455_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KX660674_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KX660680_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
Y18857_PreC_P-RF-CB        tataaagaatttggagcttctgtggagttactctcttttttgcctgctga
MH094410_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ377611_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ377522_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
JF828933_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgcctgctga
JF828934_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgcctgctga
JF828935_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgcctgctga
JF828936_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgcctgctga
JF828938_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgcctgctga
DQ478886_PreC_P-RF-DC      tataaagaatttggagcttctgcggagttactctcttttttgccttctga
KJ410520_PreC_P-RF-CB      tataaagaatttggagcatctgtggagttactctcttttttgccttctga
EU919166_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU919167_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774486_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
JQ707714_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
JF436922_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttaatctcttttttgcctttgga
KC774476_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774222_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774178_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
DQ478898_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AB270535_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774364_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774428_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774461_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774442_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774432_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
JN400086_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
HM750133_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcgtttttgccttctga
GQ377607_PreC_P-RF-CB      tataaagaatttggagcttccgtggagttactctcttttttgccttctga
FJ386581_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AB195950_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AB195951_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AY817509_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774447_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ562294_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU916239_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU916241_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU916240_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774455_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774452_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774435_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774420_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774443_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774422_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963856_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963857_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963858_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963859_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963860_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963861_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963863_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963864_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963865_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963866_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963867_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963868_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963869_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963870_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU963862_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttaccttctga
KF917451_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774470_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774454_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774439_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774434_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccgtctga
GQ377630_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU835240_PreC_P-RF-GC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AY862865_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AY862864_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AY862866_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AF330110_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774430_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774431_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KX660677_PreC_P-RF-DC      tataaagaatttggagcttctatggagttactctcttttttgccttctga
KX660675_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KT991421_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KP276255_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KP276254_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774468_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774466_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774463_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774349_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774344_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
JX429898_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
JF491449_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
EU787434_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
DQ478892_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
DQ478889_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
DQ144601_PreC_P-RF-BC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AY817512_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774474_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774458_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774425_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ715413_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ715387_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ715384_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AY247030_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ715385_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ715411_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ715412_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ715414_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AY123041_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774457_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AY800249_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774426_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AY817515_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KJ173349_PreC_P-RF-CB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774471_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
DQ478897_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774433_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774472_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AY817510_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
DQ478887_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
JF491448_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
JF491456_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774423_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774424_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KC774448_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KU519422_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AY817513_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AY230115_PreC_P-RF-DA      tataaagaatttggagctactgtggagttgctctcttttttgcctggtga
GQ161806_PreC_P-RF-EA      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JF440017_PreC_P-RF-DA      tataaagaatttggagctactgtggagttactctcatttttgccttctga
X68292_PreC_P-RF-DA        tataaagaatttggagctactgtggagttactctcgtttttgccttctga
AB453985_PreC_P-RF-AC      tataaagaatttggagcttctgtggagttaatctcgtttttgcctcctga
MF925386_PreC_P-RF-AC      tataaagaatttggagctactgtggagttactctcttttttgccttctga
AB330368_PreC_P-RF-DA      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
AB222708_PreC_P-RF-AD      tataaagaatttggagcgactgtggagttactctcgtttttgccttctga
EF494376_PreC_P-RF-CA      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
AF297619_PreC_P-RF-DA      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
AF297620_PreC_P-RF-DA      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JN664933_PreC_P-RF-DA      tataaagaatttggagctactgtggagttactctcgtttttgcctcctga
JN664946_PreC_P-RF-DA      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
MF488705_PreC_P-RF-AD      tataaagaatttggagcgactgtggagttactctcgtttttgccttctga
AB194949_PreC_P-RF-AE      tataaagaatttggagctactgtggagttactctcatttttgccttctga
HM146131_PreC_P-RF-AD      tataaagaatttggagcttctgtggagttactctcatttttgccttctga
GQ331048_PreC_P-RF-AE      tataaagaatttggagctactgtggagttactctcatttttgccttctga
AY161147_PreC_P-RF-DA      tataaagaatttggagctactgtggagttactctcatttttgccttctga
KJ586810_PreC_P-RF-AF      tataaagaatttggagctactgtggagttactctcatttttgccttctga
KF214656_PreC_P-RF-AC      tataaagaatttggagctactgtggagttactctcatttttgccttctga
AY233277_PreC_P-RF-AC      tataaagaatttggagcttctgtggagttactctcgtttttgccttctga
MF925404_PreC_P-RF-AC      tataaagaatttggagctactgtggagttactctcatttttgccttctga
FJ349221_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttgctctcgtttttgccttctga
AB674412_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgcctgctga
JN664943_PreC_P-RF-DE      tataaagaatttggagcgactgtggagttactctcatttttgcctactga
KU668440_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JN664934_PreC_P-RF-DE      tataaagaatttggagcgactgtggagttactctcttttttgcctactga
JN664929_PreC_P-RF-DE      tataaagaatttggagcgactgtggagttactctcatttttgccttctga
GQ205379_PreC_P-RF-DE      tataaagaatttggagcgactgtggagttactctcatttttgccttctga
AB033558_PreC_P-RF-DE      tataaagaatttggagcgactgtggagttactctcatttttgccttctga
DQ315780_PreC_P-RF-DE      tataaagaatttggagcaactgtggagttactctcatttttgccttctga
KT366505_PreC_P-RF-DE      tataaagaatttggagcgactgtggagttactctcatttttgccttctga
DQ315779_PreC_P-RF-DE      tataaagaatttggagcgactgtggagttactctcatttttgccttctga
JN664940_PreC_P-RF-DE      tataaagaatttggagcgactgtggagttactctcatttttgccttctga
MK516279_PreC_P-RF-DE      tataaagaatttggagcgactgtggagttactctcatttttgccttctga
MK516280_PreC_P-RF-DE      tataaagaatttggagcgactgtggagttactctcatttttgccttctga
MK541689_PreC_P-RF-DE      tataaagaatttggagcgactgtggagttactctcatttttgccttctga
JN664915_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JN664925_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttccga
GQ205377_PreC_P-RF-DE      tataaagaatttggagcaactgtggagttactctcatttttgccttccga
KC875338_PreC_P-RF-DE      tataaagaatttggagcaactgtggagttactctcatttttgccttccga
KC875339_PreC_P-RF-DE      tataaagaatttggagcaactgtggagttactctcatttttgccttccga
GQ205378_PreC_P-RF-DE      tataaagaatttggagcaactgtggagttactctcatttttgccttccga
GQ205387_PreC_P-RF-DE      tataaagaatttggagcaactgtggagttactctcatttttgccttccga
DQ464167_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
DQ464164_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcatttttgccgtctga
DQ464165_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcatttttgccgtctga
DQ464166_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcatttttgccgtctga
JN040803_PreC_P-RF-DE      tataaagaatttggagctagtgtggagttactctcgtttttgccttctga
JF754613_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcttttttgcctgctga
MF925401_PreC_P-RF-DB      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
MF925396_PreC_P-RF-DC      tataaagaatttggagctactgtggagttactctcgtttttgcctactga
MF925360_PreC_P-RF-DB      tataaagaatttggagctactgtggagttactctcgtttttgcctgctga
EF103283_PreC_P-RF-AD      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
EF103282_PreC_P-RF-AD      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KM524357_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KT366503_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KR905422_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
MF925402_PreC_P-RF-BD      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
MF925392_PreC_P-RF-DB      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
MF925371_PreC_P-RF-DC      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
MF925388_PreC_P-RF-DC      tataaagaatttggagctactgtggagttactctcttttttgccttctga
JN257154_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgcctactga
FJ562223_PreC_P-RF-CD      tataaagaatttggagctactgtggagttactctcttttttgccttctaa
AB674436_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgccttctga
AB674434_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgcctactga
JN642127_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcatttttgccttctga
JN642141_PreC_P-RF-DE      taaaagaaatttggagcttctgtggagttactctcgtttttgcctgttga
JN642152_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgccttttga
MF925397_PreC_P-RF-DC      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
MF925384_PreC_P-RF-DB      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
AY161145_PreC_P-RF-AD      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
AY161146_PreC_P-RF-AD      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
GQ377627_PreC_P-RF-CD      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
AY161140_PreC_P-RF-AD      cataaagaatttggagctactgtggagttactctcgtttttgccttctga
AY161141_PreC_P-RF-AD      cataaagaaattggagctactgtggagttactctcgtttttgccttctga
JN642160_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttctgccttctga
JN642137_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgccttctga
KF471643_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgcctcagga
JN257174_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JN040798_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JN257210_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JF754616_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgcctgctga
JN257191_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JN257216_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JN257206_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JN257207_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JN642139_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
AB674432_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
AB674433_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JN257164_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgccttctga
JN257189_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JN688689_PreC_P-RF-DE      tataaagaattgggagcttccgtggagttactctcgtttttgccttctga
AB270538_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
MK052976_PreC_P-RF-BD      tataaagaatttggagcttccgtggagttactctcgtttttgccttctga
KJ647349_PreC_P-RF-DE      tataaagaatttggagcttcagtggagttactctcgtttttgcctaatga
KJ470898_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcttttttgcctactga
KJ470897_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgccttctga
HQ700494_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KF192835_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KF192836_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KF192838_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KF192837_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KF192839_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KF192841_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
MF618347_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KF192840_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KF192833_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
MF618346_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KJ470891_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KJ470892_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KJ470888_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KJ470890_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KJ470884_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KJ470886_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KJ470887_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
FJ692536_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
HQ700579_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgcctggtga
HQ700585_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgcctggtga
HQ700493_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
HQ700492_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgcctcatga
AB048702_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
AB048703_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
MH481862_PreC_P-RF-DE      tataaagaatttggagctactatggagttactctcgtttttgccttctga
MH481860_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
MH481859_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
MH481858_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
MH481861_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
J02202_PreC_P-RF-DE        tataaagaatttggagctactgtggagttactctcgtttttgccttctga
HQ700534_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
HQ700533_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
HQ700536_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
HQ700541_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
HQ700581_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
HQ700582_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
HQ700503_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
HQ700583_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
HQ700584_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
HQ700497_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
HQ700501_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
HQ700524_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
HQ700525_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
AB033559_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
HQ700535_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
HQ700537_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
HQ700538_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
HQ700539_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
HQ700540_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
HQ700500_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JN688717_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttcccttctga
KJ647356_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcttttttgcctcagga
JN688715_PreC_P-RF-DE      tataaagaatttggagcttccgtggagttactctcgtttttgccttctga
KJ647351_PreC_P-RF-DE      tataaagaatttggagcttccgtggagttactctcgtttttgcctactga
KM359442_PreC_P-RF-DE      tataaagaatttggcgctacygtggagttactctcgtttttgcctcagga
KJ586811_PreC_P-RF-DF      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KM577666_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
MF488702_PreC_P-RF-DE      tataaagaatttggagcgactgtggagatactctcatttttgtctcctga
KF679991_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgccttctga
MH724243_PreC_P-RF-DE      tataaagaatttggagcttccgtggagttactctcgtttttgccttctga
MN507835_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
X65259_PreC_P-RF-DA        tataaacaatttggagctactgtggagttactcccgtatttgccttctga
JN257204_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
MH724240_PreC_P-RF-DE      tataaagaatttggagcttcngtggagttactctcgtttttgccttctga
MH724239_PreC_P-RF-DE      tataaagaatttggagcttccgtggagttactctcgtttttgccttctga
KX827302_PreC_P-RF-DE      tataaagaatttggagctaccttggagttactctcgtttttgccttctga
AY341335_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
AJ627221_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgccttctga
JQ687532_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcatttttgccttctga
X80925_PreC_P-RF-DE        tataaagaatttggagctactgtggagttactctcatttttgccttctga
EF103284_PreC_P-RF-AD      tataaagaatttggagctaccgtggagttactctcttttttgccttctga
MH464835_PreC_P-RF-DE      tataaagaatttggagctaccgtggagttactctcgtttttgccttctga
KC774450_PreC_P-RF-DE      tataaagaatttggagctaccgtggagttactctcttttttgccttctga
FJ349212_PreC_P-RF-DE      tataaagaatttggcgcttctgtggagttactctcgtttttgccttctga
AB188243_PreC_P-RF-DE      tataaagaatttggagcttccgtggagttactctcgtttttgccttctga
AB188245_PreC_P-RF-DE      tataaagaatttggagcttccgtggagttactctcgtttttgccttctga
KM577667_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgcctgctga
EU594406_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
AB210819_PreC_P-RF-DE      tataaagaatttggagctactgtgcagttactctcgtttttgccttctga
KM386676_PreC_P-RF-DE      tataaagaatttggagctaccgtggagttactctcgtttttgccttctga
KM577665_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgcctactga
AJ627217_PreC_P-RF-DE      tataaagaatttggagcttccgtggagttactctcgtttttgccttctga
MK598656_PreC_P-RF-DE      tataaagaatttggagctaccgtggagttactctcgtttttgccttctga
MK598654_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
DQ111987_PreC_P-RF-DE      tataaagaatttggagctaccgtggagttactctcgtttttgccttctga
EU594435_PreC_P-RF-DE      tataaagaatttggagctaccgtggagttactctcgtttttgccttctga
MK618439_PreC_P-RF-DE      tataaagaatttggagctaccgtggagttactctcgtttttgccttctga
EU594436_PreC_P-RF-DE      tataaagaatttggagctaccgtggagttactctcgtttttgccttctga
JF440012_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgcctactga
JF440007_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JF439999_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JF440004_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JF440005_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JF440013_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgcctactga
JF440001_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JF439996_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JF439998_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JF439995_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JF440000_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JF440006_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JF440008_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JF440009_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JF440010_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JF440014_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JF440015_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JF440003_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
AY373430_PreC_P-RF-DE      tataaagaatttggagctaccgtggagttactctcgtttttgccttctga
KM524359_PreC_P-RF-DE      tataaagaatttggagctaccgtggagttactctcgtttttgccttctga
KT366492_PreC_P-RF-DE      tataaagaatttggagctaccgtggagttactctcgtttttgccttctga
GQ183486_PreC_P-RF-DE      tataaagaatttggagctaccgtggagttactctcgtttttgccttctga
MH724222_PreC_P-RF-DE      tataaagaatttggagctaccgtggagttactctcgtttttgccttctga
AY236161_PreC_P-RF-DA      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JF440002_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JF440011_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
EU185780_PreC_P-RF-AD      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KC012653_PreC_P-RF-AD      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
MF967563_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
MK618438_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
MK618440_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
MK618444_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
U95551_PreC_P-RF-DE        tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JX898690_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
AJ344117_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JX898686_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JX898693_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JX898695_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JX898696_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JX898698_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JX898699_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
MK618442_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
MK618445_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JX898687_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
JX898688_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
MK598652_PreC_P-RF-DE      tataaagaatttggagctaccgtggagttactctcgtttttgccttctga
MK598653_PreC_P-RF-DE      tataaagaatttggagctaccgtggagttactctcgtttttgccttctga
DQ315777_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KM524337_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KM524336_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
LK995391_PreC_P-RF-ED      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
AB583679_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KM577663_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KM577664_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
MN507850_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
EF103285_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KT366504_PreC_P-RF-DE      tataaagaatttggagctaccgtggagttactctcgtttttgccttctga
AY233293_PreC_P-RF-DE      tataaagaatttggagctaccgtggagttactctcgtttttgccttctga
AY233295_PreC_P-RF-DE      tataaagaatttggagctaccgtggagttactctcgtttttgccttctga
GU563560_PreC_P-RF-DE      tataaagaatttggagctaccgtggagttactctcgtttttgccttctga
MH464846_PreC_P-RF-DE      tataaagaatttggagctaccgtggagttactctcgtttttgccttctga
MH464852_PreC_P-RF-DE      tataaagaatttggagctaccgtggagttactctcgtttttgccttctga
MH464851_PreC_P-RF-DE      tataaagaatttggagctaccgtggagttactctcgtttttgccttctga
FJ904409_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgcctcatga
FJ904405_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgcctcaaga
FN594767_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgcctcatga
FJ904436_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgcctaatga
MK052957_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgccttctga
MK052969_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
KP168421_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
FJ904430_PreC_P-RF-DE      tataaagaatttggagctactgtgcagttactctcgtttttgccttctga
FJ904414_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgcctactga
FJ904408_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgcctgctga
FJ904416_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgcctgctga
FJ904417_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgcctgctga
FJ349207_PreC_P-RF-DE      tataaagaatttggagctactgttgagttactctcgtttttgcctgctga
FJ904407_PreC_P-RF-DE      tataaagaatttggagctactgtsgagttactctcgtttttgccttctga
FJ904425_PreC_P-RF-DE      tataaagaatttggagctactgtgcagttactctcgtttttgccttctga
FJ904400_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgccttctga
DQ991753_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgcctactga
GQ161788_PreC_P-RF-AE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
FJ904394_PreC_P-RF-DE      tataaagaatttggagctactgtgcagttactctcttttttgcctgttga
FN594769_PreC_P-RF-DE      tataaagaatttggagctwstgtgkagttactctcgtttttgccttctga
KX357628_PreC_P-RF-DE      tataaagaatttggagcttctgtgcagttactctcgtttttgcctgctga
GQ161753_PreC_P-RF-AE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
FJ904398_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgccttctga
FJ904396_PreC_P-RF-DE      tataaagagtttggagctactgtggagttactctcgtttttgccttctga
FJ904440_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcttttttgccttctga
GQ161767_PreC_P-RF-AE      tataaagaatttggagcttctgtggagttactctcgtttttgccttctga
HF571060_PreC_P-RF-AE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
GQ161837_PreC_P-RF-AE      tataaagaatttggagctactgtggagttactctcggttttgccctttgg
GQ161838_PreC_P-RF-AE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KP168420_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgccttctga
FJ904444_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgccttctga
FJ904428_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgcctcagga
KX357627_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcatttttgccttctga
KX357631_PreC_P-RF-DE      tataaagaatttggagcctctgtggagttactctcgtttttgccttctga
FJ904404_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgcctgttga
FJ904442_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KX357632_PreC_P-RF-DE      tataaagaatttggagctactgtgcagttactctcgtttttgccttctga
KX357626_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgcctcagga
FJ904441_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgccttmtga
KU711666_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
FJ904397_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgccttctga
FJ904437_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgccttctga
FJ904401_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgccttctga
KU736921_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcttttttgccttctga
KU736922_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcttttttgccttctga
KP288875_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgcctactga
FJ904447_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgccttctga
KP168416_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
FJ904403_PreC_P-RF-DE      tataaagaatttggagcttctgtggagttactctcgtttttgccttctga
KP168417_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcttttttgccttctga
KP168418_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcttttttgccttctga
MH685719_PreC_P-RF-DE      tataaagaatttggagctaccgtggagttactctcgtttttgccttccga
KX357630_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KX357634_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KX357624_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KX357633_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KX357635_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KX357623_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KX357625_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KX357629_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KX357641_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KU736916_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KU736915_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KU736923_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KU736914_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KU736917_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
FJ904406_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgcctactga
AM494716_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
GU177079_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
FN594771_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
FN594770_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
GQ161754_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KM606741_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttccga
KX357636_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KF170740_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KX827299_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KM606750_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KP995112_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
KM606751_PreC_P-RF-DE      tataaagaatttggagctactgtggagttactctcgtttttgccttctga
                               *  *  * **              *              *      

KF219922_PreC_P-RF-GH      ctttttcccgtctgttcgtgaycttctcgacaccgcttcagctytstacc
JQ272886_PreC_P-RF-GF      ctttttcccgtcwgttcgggayctwctcgacaccgcttcagccttstacc
HE981179_PreC_P-RF-FG      tttcttcccgtcggttcgggacctactcgacaccgcttcagccctctaca
HE981180_PreC_P-RF-GF      tttcttcccgtcggttcgggacctactcgacaccgcttcagccctctaca
JQ272887_PreC_P-RF-GF      ctttttcccgtcagttcgggacctactcgacaccgcttcagccctctacc
KJ586803_PreC_P-RF-AF      ctttttcccgtcagttcgggacctactcgacaccgcttcagccctctacc
MF488699_PreC_P-RF-DE      cttctttccttccgtccgagatcttctagataccgcctcagctctgtatc
EU833890_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
AB933283_PreC_P-RF-AG      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JF440019_PreC_P-RF-AG      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JF440021_PreC_P-RF-AG      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JF440022_PreC_P-RF-AG      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
AB933282_PreC_P-RF-AG      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
EU833889_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
KP274926_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
EF464099_PreC_P-RF-AG      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
AB933281_PreC_P-RF-AG      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
AB933279_PreC_P-RF-AG      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
AB933280_PreC_P-RF-AG      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707468_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707426_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707424_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707459_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707473_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707465_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707464_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707463_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707461_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707457_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707458_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707460_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707462_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707466_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707467_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707469_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707470_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707448_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707474_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707421_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707430_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707432_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707445_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707450_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707456_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707471_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707472_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707475_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
JQ707441_PreC_P-RF-GA      ctttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
KC774323_PreC_P-RF-CB      cttctttccttctattcgagatcttctcgacaccgcctcagctctgtatc
KJ803771_PreC_P-RF-DB      cttctttccttctattcgagatctcctcgacaccgcccttgctctgtatc
KU679952_PreC_P-RF-CB      cttttttccgtctattcgagatcttctcgacactgcatccgctctatatc
HQ700580_PreC_P-RF-CB      tttctttccgtctgttcgagatctcctcgacaccgcctcagctctgtacc
MF925382_PreC_P-RF-CB      cttctttccgtctattcgggatctcctcgacaccgccaatgctttgtttc
EF494378_PreC_P-RF-CA      cttctttccttctattcgagatcttctcgacaccgcctctgctctgtacc
KF873530_PreC_P-RF-CB      tttctttccatctattcgtgatctcctcgacacggcctccgctctctatc
JQ027310_PreC_P-RF-CB      cttctttccttctgttcgagatctcctcgacaccgcctctgctctatatc
KJ803785_PreC_P-RF-CB      cttctttccgtctattcgggaccttctcgacaccgcctctgctctgtgtc
MG826150_PreC_P-RF-BC      cttctttcctactattcgagatctcctcgacaccgcctctgctctgtatc
FJ032343_PreC_P-RF-CB      cttctttcctaatattcgagatctcctcgacaccgcctctgctctgtatc
FJ386674_PreC_P-RF-BC      cttctttcctaatattcragatctcctcgacaccgcctctgctctgtatc
EU939623_PreC_P-RF-CB      cttctttcctaatattcgagatctcctcgacaccgcctctgctctgtatm
GQ377592_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
EU939620_PreC_P-RF-CB      cttctatccttctgttcgagatcttctcgacaccgccgctgctctgtatc
FJ562328_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgtctctgctctgcatc
KJ803822_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
EU660227_PreC_P-RF-BC      cttctttccttctattcgagatctcctcgacaccgccactgccctgtatc
EU939621_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
KJ803791_PreC_P-RF-CB      cttttttccttctgttcgggatctcctcgacaccgcctctgctttgtatc
GQ377604_PreC_P-RF-CB      cttctttccttctgctcgagatctcctcgacaccgcctctgctctgtatc
EU882006_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctccgctctgtacc
GQ377556_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
EU939630_PreC_P-RF-CB      tttctttccttctattcgagatctcctcgacaccgccactgctctgtatc
MG826151_PreC_P-RF-BC      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
EU939631_PreC_P-RF-BC      cttctttcctaatattcgagatctcctcgacaccgcctctgctctgtatc
EU939632_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctctgcatc
FJ562229_PreC_P-RF-CB      cttctttccttctattcgagatcttctcgacaccgcctctgctctgcatc
KM213033_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
KJ803798_PreC_P-RF-CB      cttctttccttctgttcgagatctcctcgacaccgcctctgctctgtatc
KJ803782_PreC_P-RF-CB      cttctttccttctgttcgagatctcctcgacaccgcctctgctctgtatc
MK052970_PreC_P-RF-BD      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
KJ410497_PreC_P-RF-BC      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
GQ377595_PreC_P-RF-BC      cttctttccttctattcgagatcttctcgacaccgcctctgctctgtatc
JF436919_PreC_P-RF-CB      cttctttcctgctattcgagatctcctcgacaccgcctctgctctgtatc
FJ032337_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctcagctctgtatc
KJ803803_PreC_P-RF-CB      cttctttccttctgttcgagatctcctcgacaccgcctccgctctgtatc
HQ684848_PreC_P-RF-CB      cttctttccttctgttcgagatctcctcgacaccgcatctgctctgtatc
EU939627_PreC_P-RF-BC      cttctttccttctattcgagatctgctcgacaccgcctctgctctgcatc
JX661498_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
GQ377626_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctcagctctgtatc
FJ562247_PreC_P-RF-CB      cttctttccttctattcgagatctactcgacaccgcctctgctctgtatc
KC774414_PreC_P-RF-BC      cttttttccttctattcgagatctcctcgacaccgcctctgctctgtacc
GQ377590_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
KJ173279_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
KJ173280_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
GQ377594_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctttgtatc
GQ377564_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
GQ377539_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
KJ173358_PreC_P-RF-CB      cttttttccttctattcgagatctcctcgacaccgcctctgctctgtatc
MK052968_PreC_P-RF-BD      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
GQ377614_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtacc
GQ377613_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
GQ377602_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
GQ377573_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
GQ377565_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
MK052967_PreC_P-RF-BD      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
GQ377634_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
KP148337_PreC_P-RF-BC      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
KC315400_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
KJ803802_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctttgtatc
GQ377549_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgcgctgtatc
GQ377596_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
MG826146_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
MG826147_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
KY470865_PreC_P-RF-GC      cttctttccgtctattcaagacctcttcgacaccgcaacagctctgtatc
KY470858_PreC_P-RF-GC      tttctttccgtctattcaagatcttatcgacacagcaacagctctgtatc
KY470871_PreC_P-RF-GC      tttctttccgtctattcaagaccttatcgacacagcaacagctctgtatc
EU787444_PreC_P-RF-CB      cttctttccttctattcgagatctcctcaacaccgcctctgctctgtatc
KF214680_PreC_P-RF-GC      tttctttccatctgttcgagatctcctcgacaccgcctcagctttgtatc
FJ562267_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctcagctctgtatc
EU916228_PreC_P-RF-CB      cctttttccttctgttcgtgatctacttgacaccgccactgctctgtatc
FJ562287_PreC_P-RF-CB      cttttttccttccattcgagatctcctcgacaccgcctccgctctgtatc
KX774505_PreC_P-RF-BC      cttctttccttctattcgagatctgctcgacaccgcctctgctctgtatc
AB241109_PreC_P-RF-CB      tttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
AB014375_PreC_P-RF-CB      cttctttccttccattcgggatctcctcgacaccgcctccgctctgtatc
FJ562227_PreC_P-RF-CB      cttctttccttcaattcgagatctcctcgacactgcctctgctctatatc
EU589337_PreC_P-RF-CB      cttttttccttctatccgggatctcctcgacaccgcctctgctctgtatc
KU576837_PreC_P-RF-BC      cttttttccttctattcgggagctcctcgacaccgcctcagctctgtatc
KU577083_PreC_P-RF-BC      cttttttccttctattcgggagctcctcgacaccgcctcagctctgtatc
AF461361_PreC_P-RF-CB      cttttttccgtctattcgagatctccttgacaccgcctcagctctgtatc
FJ562277_PreC_P-RF-CB      cttctttccttccattcgagatctcctcgacaccgcctctgctctgtatc
FJ562271_PreC_P-RF-CB      cttctttccttccattcgagatctcctcgacaccgcctctgctctgtatc
FJ386593_PreC_P-RF-CB      cttttttccttctattcgagatctcctcgacaccgcctctgctctgtatc
KU963930_PreC_P-RF-CB      tttctttccttctattcgagatctcctcgacaccgcctcagctctgtatc
KU963931_PreC_P-RF-CB      tttctttccttctattcgagatctcctcgacaccgcctcagctctgtatc
KU963932_PreC_P-RF-CB      tttctttccttctattcgagatctcctcgacaccgcctcagctctgtatc
KU963933_PreC_P-RF-CB      tttctttccttctattcgagatctcctcgacaccgcctcagctctgtatc
KU963934_PreC_P-RF-CB      tttctttccttctattcgagatctcctcgacaccgcctcagctctgtatc
KU963935_PreC_P-RF-CB      tttctttccttctattcgagatctcctcgacaccgcctcagctctgtatc
KU963936_PreC_P-RF-CB      tttctttccttctattcgagatctcctcgacaccgcctcagctctgtatc
KU963938_PreC_P-RF-CB      tttctttccttctattcgagatctcctcgacaccgcctcagctctgtatc
KU963939_PreC_P-RF-CB      tttctttccttctattcgagatctcctcgacaccgcctcagctctgtatc
KU963940_PreC_P-RF-CB      tttctttccttctattcgagatctcctcgacaccgcctcagctctgtatc
KU963941_PreC_P-RF-CB      tttctttccttctattcgagatctcctcgacaccgcctcagctctgtatc
KU963942_PreC_P-RF-CB      tttctttccttctattcgagatctcctcgacaccgcctcagctctgtatc
KU963943_PreC_P-RF-CB      tttctttccttctattcgagatctcctcgacaccgcctcagctctgtatc
KU963944_PreC_P-RF-CB      tttctttccttctattcgagatctcctcgacaccgcctcagctctgtatc
JQ040130_PreC_P-RF-CB      cttctttccttctattcgagatcttctcgacaccgcctctgctctgtatc
EU939629_PreC_P-RF-BC      cttctttccttctattcgagatctcctcgacaccgcctcagctctgtatc
AB642096_PreC_P-RF-CB      cttctttccgtctattcgagatctcctcgacaccgcctctgctctgtatc
EU939602_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
EU939589_PreC_P-RF-CB      cttttttccttctattcgagatctcctcgacaccgcctcagctctgtatc
GQ377633_PreC_P-RF-CB      cttctttccgtctattcgagatctccttgacaccgcctcagctctgtatc
EU871994_PreC_P-RF-CB      cttctttccgtctattcaagatctccgcgacaccgcctcagctctgtatc
EU871995_PreC_P-RF-CB      cttctttccgtctattcgagatctcctcgacaccgcctcagctctgtatc
EU871991_PreC_P-RF-CB      cttctttccgtctattcgagatctcctcgacaccgcctcagctctgtatc
EU871987_PreC_P-RF-CB      cttctttccgtctattcgagatctcctcgacaccgcctcagctctgtatc
EU871985_PreC_P-RF-CB      cttctttccgtctattcgagatctcctcgacaccgcctcagctctgtgtc
EU871992_PreC_P-RF-CB      cttctttccgtctattcgagatctcctcgacaccgcctcagctctgtatc
EU871993_PreC_P-RF-CB      cttctttccgtctattcgagatctcctcgacaccgcctcagctctgtatc
EU871996_PreC_P-RF-CB      cttctttccgtctattcgagatctcctcgacaccgcctcagctctgtatc
EU872014_PreC_P-RF-CB      cttctttccgtctattcgagatctcctcgacaccgcctcagctctgtatc
EU872015_PreC_P-RF-CB      cttctttccgtctattcgagatctcctcgacaccgcctcagctctgtatc
EU871981_PreC_P-RF-CB      cttctttccgtctattcgagatctcctcgacaccgcctcagctctgtatc
EU871983_PreC_P-RF-CB      cttctttccgtctattcgagatctcctcgacaccgcctcagctctgtatc
EU871986_PreC_P-RF-CB      cttctttccgtctattcgagatctcctcgacaccgcctcagctctgtatc
EU871999_PreC_P-RF-CB      cttctttccgtctattcgagatctcctcgacaccgcctcagctctgtatc
EU871984_PreC_P-RF-CB      cttctttccgtctattcgagatctcctcgacaccgcctcagctctgtatc
EU871988_PreC_P-RF-CB      cttctttccgtctattcgagatctcctcgacaccgcctcagctctgtatc
EU871989_PreC_P-RF-CB      cttctttccgtctattcgagatctcctcgacaccgcctcagctctgtatc
EU871990_PreC_P-RF-CB      cttctttccgtctattcgagatctcctcgacaccgcctcagctctgtatc
KR013806_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcatctgctctgtatc
FJ562305_PreC_P-RF-CB      cttctttccttccattcgagatctcctcgacaccgcctcagctctgtatc
AF411409_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctcagctctgtatc
AB198084_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctccgctctgtatc
GU357843_PreC_P-RF-CB      cttctttccttctatccgggatctcctcgacaccgcctctgctctgtatc
FJ562336_PreC_P-RF-CB      cttctttccttctgttcgagatctcgtcgacaccgccacagctctgtatc
EU939565_PreC_P-RF-CB      cttctttccttctgttcgrgatctcctcgacaccgcctcagctctgtatc
JQ040146_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctttgtatc
EU939581_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctctgcatc
AB195939_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctttgtatc
AB195940_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctttgtatc
AB195941_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctttgtatc
AB195955_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctttgtatc
AB195956_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctttgtatc
AB195957_PreC_P-RF-CB      cttctttccttctattcgagatctcctcgacaccgcctctgctttgtatc
KM875422_PreC_P-RF-CB      cttctttccttccgttcgggatctcctcgacaccgcctcagctctgtatc
KC774188_PreC_P-RF-CB      cttctttccttctgttcgagatctcctcgacaccgcctcagctctgtatc
AB367393_PreC_P-RF-CB      cttc